RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for CACNB4 (Homo sapiens)

Ensembl gene IDs: ENSG00000182389

Ensembl transcript IDs: ENST00000201943.10, ENST00000360283.11, ENST00000397327.7, ENST00000427385.6, ENST00000434468.2, ENST00000439467.6, ENST00000470066.2, ENST00000475848.2, ENST00000534999.6, ENST00000539935.7, ENST00000635731.1, ENST00000635738.1, ENST00000635743.1, ENST00000635803.1, ENST00000635835.1, ENST00000635890.1, ENST00000635904.1, ENST00000635930.1, ENST00000636108.1, ENST00000636129.1, ENST00000636130.1, ENST00000636350.1, ENST00000636380.1, ENST00000636390.1, ENST00000636442.1, ENST00000636496.1, ENST00000636507.1, ENST00000636598.1, ENST00000636617.1, ENST00000636664.1, ENST00000636721.1, ENST00000636762.1, ENST00000636773.1, ENST00000636785.1, ENST00000636810.1, ENST00000636831.1, ENST00000636834.1, ENST00000636901.1, ENST00000636947.1, ENST00000637007.1, ENST00000637132.1, ENST00000637216.1, ENST00000637217.1, ENST00000637232.1, ENST00000637284.1, ENST00000637309.1, ENST00000637312.1, ENST00000637319.1, ENST00000637330.1, ENST00000637418.1, ENST00000637436.1, ENST00000637479.1, ENST00000637491.1, ENST00000637514.1, ENST00000637530.1, ENST00000637535.1, ENST00000637547.1, ENST00000637550.1, ENST00000637622.1, ENST00000637762.1, ENST00000637765.1, ENST00000637773.1, ENST00000637779.1, ENST00000637828.1, ENST00000637884.1, ENST00000637913.1, ENST00000637942.1, ENST00000637956.1, ENST00000638005.1, ENST00000638040.1, ENST00000638056.1, ENST00000638083.1, ENST00000638091.1, ENST00000638150.1

Found 4207 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR CCA 90 bp CTCATGAGCCCCACACGGTACCCCCTGCCTTCCCATGCTGAGCACTaGCTTCCATCAGGACCCACGTGGAAACAGACCCTTGAGGAGCAA +
Preference number: 1 (lower is better)
Translates to: LMSPTRYPLPSHAEH*LPSGPTWKQTLEEQ
Trigger: TTGCTCCTCAAGGGTCTGTTTCCACGTGGGTCCTGATGGAAGCCAGTGCTCAGCATGGGAAGGCAGGGGGTACCGTGTGGGGCTCATGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000638056.1
3UTR GCA 90 bp CACGTGCGACCAAGGCATGCTGGCTGCCTTCAATCCACAGGGACCTaGATGAGGGTTAGGGTTAAGGCCAGAGCATCAGACAGCAAGACC +
Preference number: 1 (lower is better)
Translates to: HVRPRHAGCLQSTGT*MRVRVKARASDSKT
Trigger: GGTCTTGCTGTCTGATGCTCTGGCCTTAACCCTAACCCTCATGCAGGTCCCTGTGGATTGAAGGCAGCCAGCATGCCTTGGTCGCACGTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR TCA 90 bp TGCGACCAAGGCATGCTGGCTGCCTTCAATCCACAGGGACCTGCATaGGGGTTAGGGTTAAGGCCAGAGCATCAGACAGCAAGACCAAGA +
Preference number: 1 (lower is better)
Translates to: CDQGMLAAFNPQGPA*GLGLRPEHQTARPR
Trigger: TCTTGGTCTTGCTGTCTGATGCTCTGGCCTTAACCCTAACCCTCATGCAGGTCCCTGTGGATTGAAGGCAGCCAGCATGCCTTGGTCGCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR GCA 90 bp TACATATCTGAAGGAACTATGCACGTGCGACCAAGGCATGCTGGCTaGCTTCAATCCACAGGGACCTGCATGAGGGTTAGGGTTAAGGCC +
Preference number: 1 (lower is better)
Translates to: YISEGTMHVRPRHAG*LQSTGTCMRVRVKA
Trigger: GGCCTTAACCCTAACCCTCATGCAGGTCCCTGTGGATTGAAGGCAGCCAGCATGCCTTGGTCGCACGTGCATAGTTCCTTCAGATATGTA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR GCA 90 bp GGCAAATGCTACAGGTTTGGACTTTGCTCTCTCAAGCTGGATAGCTaGTTGCTGTTCTCTCTCCTGTCGAATTGCTTCCCGGTCCTCTTC +
Preference number: 1 (lower is better)
Translates to: GKCYRFGLCSLKLDS*LLFSLLSNCFPVLF
Trigger: GAAGAGGACCGGGAAGCAATTCGACAGGAGAGAGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTTGCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR CCA 90 bp CCTGCTAGTTTGTGTATGTTGGCGGAAATTCTCCATGCCCATGGCTaGATTTTTGTAGACCACTCTCCTGCTCATCCCTCTGACATTTCC +
Preference number: 1 (lower is better)
Translates to: PASLCMLAEILHAHG*IFVDHSPAHPSDIS
Trigger: GGAAATGTCAGAGGGATGAGCAGGAGAGTGGTCTACAAAAATCCAGCCATGGGCATGGAGAATTTCCGCCAACATACACAAACTAGCAGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR GCA 90 bp TCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGG +
Preference number: 1 (lower is better)
Translates to: SLDFVFQLESSLWSG*CASFADSVTQKLLW
Trigger: CCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR CCA 90 bp CATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAA +
Preference number: 1 (lower is better)
Translates to: HQRSLDFVFQLESSL*SGCCASFADSVTQK
Trigger: TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR CCA 90 bp AATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGAT +
Preference number: 1 (lower is better)
Translates to: NLLPQEGNDLGYAEN*KTSGSYSSEPFHCD
Trigger: ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR GCA 90 bp TCAGCTATTACTTTTGCTACTGCTGGGCTCTTCCTCCAGACCCTCTaGCATGTCATCAGACCCCATGAATACTTGAGATTGAAATTTGCA +
Preference number: 1 (lower is better)
Translates to: SAITFATAGLFLQTL*HVIRPHEYLRLKFA
Trigger: TGCAAATTTCAATCTCAAGTATTCATGGGGTCTGATGACATGGCAGAGGGTCTGGAGGAAGAGCCCAGCAGTAGCAAAAGTAATAGCTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR CCA 90 bp CCAAGACCTTATTGTAGCCATTCGTCTCCTAGGGGGAGGTTACCATaGAAGGTGTTTTTCATGCTTAACCATGTGCAATTGCTAATTTCC +
Preference number: 1 (lower is better)
Translates to: PRPYCSHSSPRGRLP*KVFFMLNHVQLLIS
Trigger: GGAAATTAGCAATTGCACATGGTTAAGCATGAAAAACACCTTCCATGGTAACCTCCCCCTAGGAGACGAATGGCTACAATAAGGTCTTGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000635904.1
ENST00000636129.1
ENST00000636947.1
3UTR GCA 90 bp CATTCTCTCACCCCTCACCCCTTTAATATCTACCTATCTTTCTCCTaGTGGAGAAATATATCAGATTTCTCCAGGGCTAAGTCTCTCTCT +
Preference number: 1 (lower is better)
Translates to: HSLTPHPFNIYLSFS*WRNISDFSRAKSLS
Trigger: AGAGAGAGACTTAGCCCTGGAGAAATCTGATATATTTCTCCAGCAGGAGAAAGATAGGTAGATATTAAAGGGGTGAGGGGTGAGAGAATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR CCA 90 bp CCCAGCAGGGTGAACTCTGTTTGGGCTTTAAAGGTTTGGGTTTGCTaGAAGATTGATTGTTTGTCCTCTTGTGCTGTTCATTCTCTATTA +
Preference number: 1 (lower is better)
Translates to: PSRVNSVWALKVWVC*KIDCLSSCAVHSLL
Trigger: TAATAGAGAATGAACAGCACAAGAGGACAAACAATCAATCTTCCAGCAAACCCAAACCTTTAAAGCCCAAACAGAGTTCACCCTGCTGGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR CCA 90 bp TCTCTCACCCCTCACCCCTTTAATATCTACCTATCTTTCTCCTGCTaGAGAAATATATCAGATTTCTCCAGGGCTAAGTCTCTCTCTTCA +
Preference number: 1 (lower is better)
Translates to: SLTPHPFNIYLSFSC*RNISDFSRAKSLSS
Trigger: TGAAGAGAGAGACTTAGCCCTGGAGAAATCTGATATATTTCTCCAGCAGGAGAAAGATAGGTAGATATTAAAGGGGTGAGGGGTGAGAGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR TCA 90 bp AAACCTAACGATATTCCCCACGAAGAAGACATGTCAGAGTCAGTGTaGCGCTACCAGCGAATTTCTTTCTTATCAAAGTCTCCACATACA +
Preference number: 1 (lower is better)
Translates to: KPNDIPHEEDMSESV*RYQRISFLSKSPHT
Trigger: TGTATGTGGAGACTTTGATAAGAAAGAAATTCGCTGGTAGCGTCACACTGACTCTGACATGTCTTCTTCGTGGGGAATATCGTTAGGTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR CCA 90 bp TCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGAACAACA +
Preference number: 1 (lower is better)
Translates to: SGGLVPHPYYLTSDS*MYVVVLRLIKGRTT
Trigger: TGTTGTTCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR TCA 90 bp AAGGAACTCCTTATTGTTCATTCTGCTGCCTGGCCTCTTAATATTTaGAATCAAGTCCATTCTCTCACCCCTCACCCCTTTAATATCTAC +
Preference number: 1 (lower is better)
Translates to: KELLIVHSAAWPLNI*NQVHSLTPHPFNIY
Trigger: GTAGATATTAAAGGGGTGAGGGGTGAGAGAATGGACTTGATTTCAAATATTAAGAGGCCAGGCAGCAGAATGAACAATAAGGAGTTCCTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR TCA 90 bp AAATGGCTAAGTCATGCTCTGTGGAAGTCAAGGACCAACAAAATGTaGATTTGCAAACCAGCTGCTCTTAAACATAAAGTCTTTGGACTT +
Preference number: 1 (lower is better)
Translates to: KWLSHALWKSRTNKM*ICKPAALKHKVFGL
Trigger: AAGTCCAAAGACTTTATGTTTAAGAGCAGCTGGTTTGCAAATTCACATTTTGTTGGTCCTTGACTTCCACAGAGCATGACTTAGCCATTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636617.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR CCA 90 bp CTGATTTCAGTTAAAAGTCAAAGTGGCATGCAAGTAGGGCAAGGGTaGCCCCTACATAAATATAGACATAGCCATTTGTTGAGAAATTTA +
Preference number: 1 (lower is better)
Translates to: LISVKSQSGMQVGQG*PLHKYRHSHLLRNL
Trigger: TAAATTTCTCAACAAATGGCTATGTCTATATTTATGTAGGGGCCACCCTTGCCCTACTTGCATGCCACTTTGACTTTTAACTGAAATCAG
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR TCA 90 bp AAAGAAGAAAGCCTCGTAGCCAACAGATCCCTTCTTTGTACTTTCTaGAAAATAATAGGACTTTCTCCTATTTTGTCTAACGTACTGCAT +
Preference number: 1 (lower is better)
Translates to: KEESLVANRSLLCTF*KIIGLSPILSNVLH
Trigger: ATGCAGTACGTTAGACAAAATAGGAGAAAGTCCTATTATTTTTCAGAAAGTACAAAGAAGGGATCTGTTGGCTACGAGGCTTTCTTCTTT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR-3UTR GCA 90 bp AGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: SGVMGVLLVVWVARQYASAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...GGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: PSSGVMGVLLVVWVARQYYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...GTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: PSSGVMGVLLVVWVARQYSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...GTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GTGCGACCAAGGCATGCTGGCTGCCTTCAATCCACAGGGACCTGCATGAGGGTTGGCACGCCTGAGTTGTaGCTGCCTCCAGTGAGGAGC +
Preference number: 2 (lower is better)
Translates to: VRPRHAGCLQSTGTCMRVGTPEL*LPPVRS
Trigger: GCTCCTCACTGGAGGCAGGCACAACTCAGGCGTGCC...AACCCTCATGCAGGTCCCTGTGGATTGAAGGCAGCCAGCATGCCTTGGTCGCAC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR-3UTR CCA 90 bp GGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCAGGTTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: GSWVCYWLCGWHASTPPGSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...ACCTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCAGCAGCGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: IAVGYGESAVEPKFLPSSVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...GCTGCTGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAAT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: IPSQQRGHGCATGCVGGTEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...CGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCAGGTGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: GSWVCYWLCGWHASTPPGGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...ACCTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp CCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: PEIAVGYGESAVEPKFLPAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...GGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCAGCAGCTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: IAVGYGESAVEPKFLPSSYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...GCTGCTGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: ADSVTQKLLWDMVRVPWSVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...GCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: IPSQQRGHGCATGCVGGTGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...CGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: WSGCCASFADSVTQKLLWVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...CCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: TQKLLWDMVRVPWSPNSFVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...GAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: QVILGSYGVCKCPGMSQGVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...ACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACTTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: NSFPAAGSWVCYWLCGWHLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...GTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: NSFPAAGSWVCYWLCGWHGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...GTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: NSFPAAGSWVCYWLCGWHLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...GTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp GTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: VTQKLLWDMVRVPWSPNSCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...GGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp GGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCAGGTTCAGCTGCCACCAGTTaGACATTCAAGTGTTTACTT +
Preference number: 2 (lower is better)
Translates to: GSWVCYWLCGWHASTPPGSAATS*TFKCLL
Trigger: AAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGA...ACCTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: ASFADSVTQKLLWDMVRVAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...CACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGTGATCCTCGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: IRLKAYVGSHGYIPQVILAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...GAGGATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GGACTCAGCCTTCCTGCTAGTTTGTGTATGTTGGCGGAAATTCTCCATGCCCATGCTCGATGGGAATGGTaGCCTGGAGGCTGCTCACCT +
Preference number: 2 (lower is better)
Translates to: GLSLPASLCMLAEILHAHARWEW*PGGCSP
Trigger: AGGTGAGCAGCCTCCAGGGCACCATTCCCATCGAGC...ATGGGCATGGAGAATTTCCGCCAACATACACAAACTAGCAGGAAGGCTGAGTCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp GTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: VTQKLLWDMVRVPWSPNSYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...GGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: QVILGSYGVCKCPGMSQGYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...ACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: ASFADSVTQKLLWDMVRVVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...CACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: SLWSGCCASFADSVTQKLVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...CAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: WSGCCASFADSVTQKLLWSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...CCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCATCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: QKLLWDMVRVPWSPNSFPSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...TGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: VTQKLLWDMVRVPWSPNSPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...GGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCACCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: QKLLWDMVRVPWSPNSFPPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...TGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ACGGCCCCACTAACACCACCGGACGCATTGACGGTACAACATCGTAAGGAGGAAGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: TAPLTPPDALTVQHRKEEEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...TTCCTCCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGCCGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000636762.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp GATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: DLGYAENWKTSGSYSSEPEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...GGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCAGGTACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: GSWVCYWLCGWHASTPPGTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...ACCTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp AACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: NPEIAVGYGESAVEPKFLCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...AAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp GAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: EGNDLGYAENWKTSGSYSCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...AGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp AATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: NSFPAAGSWVCYWLCGWHVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...GTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp CGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCAGCAGTTGCAAAGATCTTaGCAACTCAAAGATTCTTTC +
Preference number: 2 (lower is better)
Translates to: RGHGCATGCVGGTPVRLQQLQRS*QLKDSF
Trigger: GAAAGAATCTTTGAGTTGGCAAGATCTTTGCAACTG...CTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCCCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGGTGATTGATGGTGTCTaGATCAAGAACAACCAGTTG +
Preference number: 2 (lower is better)
Translates to: IPSQQRGHGCATGCVGGTVIDGV*IKNNQL
Trigger: CAACTGGTTGTTCTTGATGCAGACACCATCAATCAC...CGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCAGCAGCTCTCTCCTGTCGAATTaGTTCCCGGTCCTCTTCCAA +
Preference number: 2 (lower is better)
Translates to: IAVGYGESAVEPKFLPSSSLLSN*FPVLFQ
Trigger: TTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGA...GCTGCTGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp TCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTATACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: SHLEVFSIALGRIGTTSLYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...TAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGTGATCGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: FIRLKAYVGSHGYIPQVIVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...GATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: AENWKTSGSYSSEPFHCDPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: ASFADSVTQKLLWDMVRVPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...CACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: NPEIAVGYGESAVEPKFLPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...AAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCAGCAGCGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: IAVGYGESAVEPKFLPSSGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...GCTGCTGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCCCTCATTCGCTGACTTaGGGGGCATTGTGCAAGTTT +
Preference number: 2 (lower is better)
Translates to: DLGYAENWKTSGSYSSEPPHSLT*GALCKF
Trigger: AAACTTGCACAATGCCCCCCAAGTCAGCGAATGAGG...GGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000637956.1
3UTR-3UTR CCA 90 bp AATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACTTTGCTCTCTCAAGCTaGATAGCTGCTTGCTGTTCT +
Preference number: 2 (lower is better)
Translates to: NSFPAAGSWVCYWLCGWHFALSS*IAACCS
Trigger: AGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCAAA...GTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp AGACCTTATTGTAGCCATTCGTCTCCTAGGGGGAGGTTACCATGGAAGGTGTTTGAGCAGCTAGAGAACTaGGGCCAGCACTGGACTCAG +
Preference number: 2 (lower is better)
Translates to: RPYCSHSSPRGRLPWKVFEQLEN*GQHWTQ
Trigger: CTGAGTCCAGTGCTGGCCTCAGTTCTCTAGCTGCTC...AAACACCTTCCATGGTAACCTCCCCCTAGGAGACGAATGGCTACAATAAGGTCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000635904.1
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR TCA 90 bp AGACCTTATTGTAGCCATTCGTCTCCTAGGGGGAGGTTACCATGGAAGGTGTTTTATCCTTGGCACGCCTaGGTTGTGCCTGCCTCCAGT +
Preference number: 2 (lower is better)
Translates to: RPYCSHSSPRGRLPWKVFYPWHA*VVPASS
Trigger: ACTGGAGGCAGGCACAACTCAGGCGTGCCAAGGATA...AAACACCTTCCATGGTAACCTCCCCCTAGGAGACGAATGGCTACAATAAGGTCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000635904.1
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR GCA 90 bp GAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: ENWKTSGSYSSEPFHCDNAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...ATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGAGTCTTTATAAGTTGTaGTGGGTGATTGATGGTGTC +
Preference number: 2 (lower is better)
Translates to: IPSQQRGHGCATGCVGGTSLYKL*WVIDGV
Trigger: GACACCATCAATCACCCAGCACAACTTATAAAGACT...CGTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACGCCAGTACGCCTCCAGGTTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: GSWVCYWLCGWHASTPPGYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...ACCTGGAGGCGTACTGGCGTGCCACCCACACAACCAGTAGCACACCCATGACCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATATACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: LRTGRQAVPTLPSPFIVIYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...TATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: FHKRVMISAMLRTGRQAVYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...AACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: ENWKTSGSYSSEPFHCDNVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...ATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AGGGTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: RVIFFHKRVMISAMLRTGVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...TCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGATCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: CASFADSVTQKLLWDMVRSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...TCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AATTCCTTCCCAGCAGCGGGGTCATGGGTGTGCTACTGGTTGTGTGGGTGGCACACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: NSFPAAGSWVCYWLCGWHTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...GTGCCACCCACACAACCAGTAGCACACCCATGACCCCGCTGCTGGGAAGGAATT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: PEIAVGYGESAVEPKFLPLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...GGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGGTACTTCCGCTAAGCTaGACCGGGTGTTCGAACGTT +
Preference number: 2 (lower is better)
Translates to: FADSVTQKLLWDMVRVPWVLPLS*TGCSNV
Trigger: AACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTAC...CCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AGACCTTATTGTAGCCATTCGTCTCCTAGGGGGAGGTTACCATGGAAGGTGTTTCTAGCTCGATGGGAATaGTGCCCTGGAGGCTGCTCA +
Preference number: 2 (lower is better)
Translates to: RPYCSHSSPRGRLPWKVFLARWE*CPGGCS
Trigger: TGAGCAGCCTCCAGGGCACCATTCCCATCGAGCTAG...AAACACCTTCCATGGTAACCTCCCCCTAGGAGACGAATGGCTACAATAAGGTCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp GGACTCAGCCTTCCTGCTAGTTTGTGTATGTTGGCGGAAATTCTCCATGCCCATATTGTCCTAGCTCGATaGGAATGGTGCCCTGGAGGC +
Preference number: 2 (lower is better)
Translates to: GLSLPASLCMLAEILHAHIVLAR*EWCPGG
Trigger: GCCTCCAGGGCACCATTCCCATCGAGCTAGGACAAT...ATGGGCATGGAGAATTTCCGCCAACATACACAAACTAGCAGGAAGGCTGAGTCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR TCA 90 bp ATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCAGCAGCGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: IAVGYGESAVEPKFLPSSVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...GCTGCTGGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAAT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp CAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: QAVPTLPSPFIVIIFIRGAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...ACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: TSGSYSSEPFHCDNFHQRAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...CCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp TTTCACTTTGTACTTCCGCTAAGCTGGACCGGGTGTTCGAACGTTCAATTATTGGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: FHFVLPLSWTGCSNVQLLAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...CAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKSLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: ENWKTSGSYSSEPFHCDNPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...ATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAAGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: AENWKTSGSYSSEPFHCDEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCTTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: TQKLLWDMVRVPWSPNSFLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...GAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: FADSVTQKLLWDMVRVPWGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...CCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: FADSVTQKLLWDMVRVPWLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...CCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTAGCCATTCGTCTCCTAGGGGGAGGTTACCATGGAAGGTGTTTTTCATGCTTACAGGAGACAACAGGCTaGCTTTGTACACAGGTGCCG +
Preference number: 2 (lower is better)
Translates to: VAIRLLGGGYHGRCFSCLQETTG*LCTQVP
Trigger: CGGCACCTGTGTACAAAGCCAGCCTGTTGTCTCCTG...TAAGCATGAAAAACACCTTCCATGGTAACCTCCCCCTAGGAGACGAATGGCTAC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000635904.1
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR TCA 90 bp ACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: TGRQAVPTLPSPFIVIIFCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...GAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp AGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: SGSYSSEPFHCDNFHQRSCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...TGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGATACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: VIFFHKRVMISAMLRTGRYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...TCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CTCTTAGCAAGAGAAATGTCAGCTGTCACTCTCGTTATTGAAATCCTCCCATCAGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: LLAREMSAVTLVIEILPSVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...TGATGGGAGGATTTCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAAGAG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635904.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp TTTTGTTTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: FCFIRLKAYVGSHGYIPQSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...CTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAAACAAAA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: KCLALHSGGLVPHPYYLTSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...AGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: QAVPTLPSPFIVIIFIRGSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...ACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGTGGAGTGGTCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: HQRSLDFVFQLESSLWSGPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...ACCACTCCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: FHKRVMISAMLRTGRQAVEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...AACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTAATGTACTTCCGCTAAGCTaGACCGGGTGTTCGAACGTT +
Preference number: 2 (lower is better)
Translates to: VILGSYGVCKCPGMSQGNVLPLS*TGCSNV
Trigger: AACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTAC...ATTACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR CAA 90 bp AAATGCTACAGGTTTGGACTTTGCTCTCTCAAGCTGGATAGCTGCTaGCTGTTCTCTCTCCTGTCGAATTGCTTCCCGGTCCTCTTCCAA +
Preference number: 2 (lower is better)
Translates to: KCYRFGLCSLKLDSC*LFSLLSNCFPVLFQ
Trigger: TTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGAGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp CAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: QVILGSYGVCKCPGMSQGVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...ACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp ACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGTGATCCTCGGTTCTGTCACTCTCGTTATTaGAATCCTCCCATCAAACCT +
Preference number: 2 (lower is better)
Translates to: TQSLCRESWLYPPGDPRFCHSRY*NPPIKP
Trigger: AGGTTTGATGGGAGGATTTCAATAACGAGAGTGACA...GAACCGAGGATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000635904.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp CTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTTCAGCTGCCACCAGTTaGACATTCAAGTGTTTACTT +
Preference number: 2 (lower is better)
Translates to: LGYAENWKTSGSYSSEPFSAATS*TFKCLL
Trigger: AAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGA...AAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: GSYSSEPFHCDNFHQRSLAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...TAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GTCAGGGTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTTCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: VRVIFFHKRVMISAMLRTSLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...AGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp AGACCTTATTGTAGCCATTCGTCTCCTAGGGGGAGGTTACCATGGAAGGTGTTTTGGTGCCCTGGAGGCTaGTCACCTTCAGAGTTTAAT +
Preference number: 2 (lower is better)
Translates to: RPYCSHSSPRGRLPWKVFWCPGG*SPSEFN
Trigger: ATTAAACTCTGAAGGTGAGCAGCCTCCAGGGCACCA...AAACACCTTCCATGGTAACCTCCCCCTAGGAGACGAATGGCTACAATAAGGTCT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp CAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTGGTTCCAACTGGAACTaGTCATTTGGAATTTCCAGC +
Preference number: 2 (lower is better)
Translates to: QVILGSYGVCKCPGMSQGGSNWN*SFGISS
Trigger: GCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACC...ACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTGGTTCCAACTGGAACTaGTCATTTGGAATTTCCAGC +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSGSNWN*SFGISS
Trigger: GCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACC...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp AGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGATCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: RQAVPTLPSPFIVIIFIRSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...TCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPSWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp GATGGTGTCTGCATCAAGAACAACCAGTTGCAAAGATCTTGCCAACTCAAAGATCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: DGVCIKNNQLQRSCQLKDPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...ATCTTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp AACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: NWKTSGSYSSEPFHCDNFPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...AAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TGTTTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGTGTTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: CFIRLKAYVGSHGYIPQVLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...CACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAAACA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ATGAATTCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: MNSHLEVFSIALGRIGTTLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...TGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGAATTCAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATATTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: LRTGRQAVPTLPSPFIVILESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...TATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: LGYAENWKTSGSYSSEPFTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...AAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: FHKRVMISAMLRTGRQAVGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...AACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: FHKRVMISAMLRTGRQAVLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...AACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR CAA 90 bp TATCAGATTTCTCCAGGGCTAAGTCTCTCTCTTCAGCTATTACTTTaGCTACTGCTGGGCTCTTCCTCCAGACCCTCTGCCATGTCATCA +
Preference number: 2 (lower is better)
Translates to: YQISPGLSLSLQLLL*LLLGSSSRPSAMSS
Trigger: TGATGACATGGCAGAGGGTCTGGAGGAAGAGCCCAGCAGTAGCAAAAGTAATAGCTGAAGAGAGAGACTTAGCCCTGGAGAAATCTGATA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR-3UTR GCA 90 bp AGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: SGSYSSEPFHCDNFHQRSSLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...TGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ACGGCCCCACTAACACCACCGGACGCATTGACGGTACAACATCGTAAGGAGGAACAGTTGCAAAGATCTTaGCAACTCAAAGATTCTTTC +
Preference number: 2 (lower is better)
Translates to: TAPLTPPDALTVQHRKEEQLQRS*QLKDSF
Trigger: GAAAGAATCTTTGAGTTGGCAAGATCTTTGCAACTG...TTCCTCCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGCCGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000636762.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp GCCCCACTAACACCACCGGACGCATTGACGGTACAACATCGTAAGGAGGAATGTTGCAAGTTTATCAGCTaGCACCAGTTGAACATTCAA +
Preference number: 2 (lower is better)
Translates to: APLTPPDALTVQHRKEECCKFIS*HQLNIQ
Trigger: TTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCA...ACATTCCTCCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTGTTAGTGGGGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000636762.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp GAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATCTCAAGCTGGATAGCTaGTTGCTGTTCTCTCTCCTG +
Preference number: 2 (lower is better)
Translates to: ENWKTSGSYSSEPFHCDNLKLDS*LLFSLL
Trigger: CAGGAGAGAGAACAGCAAGCAGCTATCCAGCTTGAG...ATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp TACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: YSSEPFHCDNFHQRSLDFVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...GAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTTTGTTTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: FCFIRLKAYVGSHGYIPQEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...CTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAAACAAAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTCAGGGTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTTTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: VRVIFFHKRVMISAMLRTLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...AGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGAC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGTTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: WKCLALHSGGLVPHPYYLLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...CAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: PQEGNDLGYAENWKTSGSTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...GGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: QVILGSYGVCKCPGMSQGTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...ACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GAGGCAAACACATGCAGAGAGAGAGAGAGAAGTCAAAAGGGAGAGAGGAGGGAGAAGCAGAGAAGGATTTaGTGGCATATGCCATCATCT +
Preference number: 2 (lower is better)
Translates to: EANTCRERERSQKGERREKQRRI*WHMPSS
Trigger: AGATGATGGCATATGCCACCAAATCCTTCTCTGCTT...CTCCCTCCTCTCTCCCTTTTGACTTCTCTCTCTCTCTCTGCATGTGTTTGCCTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp TGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGTTCTCCAATCTGAGTaGACTTGGAATGAAGCCAAT +
Preference number: 2 (lower is better)
Translates to: WSGCCASFADSVTQKLLWVLQSE*TWNEAN
Trigger: ATTGGCTTCATTCCAAGTCCACTCAGATTGGAGAAC...CCACAGCAATTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR CAA 90 bp CGTAAGGAGGAATGTGCTCCGTCACTTTTTGCTTCTGTTTTGCTGTaGATGTGGGAGTTGCTCGGAATGTCCCAGATACCATTTCTCCAA +
Preference number: 2 (lower is better)
Translates to: RKEECAPSLFASVLL*MWELLGMSQIPFLQ
Trigger: TTGGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCAAAACAGAAGCAAAAAGTGACGGAGCACATTCCTCCTTACG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTATGCAGGGGGATGTGGTaGGGTTGTAATGGGGTTCAA +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVCRGMW*GCNGVQ
Trigger: TTGAACCCCATTACAACCTCACCACATCCCCCTGCA...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: LVYKLVPTGTGHLEFPAWCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...CCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAACCAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp ACATGCTCAAGTAGACTTTCTAGTCAATTCACCCAAATTCCAACAGGAATTGGTTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: TCSSRLSSQFTQIPTGIGCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...ACCAATTCCTGTTGGAATTTGGGTGAATTGACTAGAAAGTCTACTTGAGCATGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp TCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTGACTTTCCCCTATGAGCTCACTTaGTGTGACTTTCTGCTGTTG +
Preference number: 2 (lower is better)
Translates to: SHMSKIQRSPMSSLAVTFPYELT*CDFLLL
Trigger: CAACAGCAGAAAGTCACAGCAAGTGAGCTCATAGGG...GAAAGTCACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR GCA 90 bp TTTTATATTTCACATAACCAGCTATGCTTGGGCCTCTCTTTACTATTCTCTCTCGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: FYISHNQLCLGLSLLFSLAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...GAGAGAGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGAAATATAAAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp GCATCAAGAACAACCAGTTGCAAAGATCTTGCCAACTCAAAGATTCTTTCAATTGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: ASRTTSCKDLANSKILSIAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...AATTGAAAGAATCTTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp CCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGAGCCCAAATTCCTTCCCCGAACGTTCAATTATTaGTCTCTTGCTGGGATTATT +
Preference number: 2 (lower is better)
Translates to: PEIAVGYGESAVEPKFLPRTFNY*SLAGII
Trigger: AATAATCCCAGCAAGAGAGCAATAATTGAACGTTCG...GGGAAGGAATTTGGGCTCCACGGCACTCTCACCATATCCCACAGCAATTTCTGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTAGTCTTTATAAGTTGTaGTGGGTGATTGATGGTGTC +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSSLYKL*WVIDGV
Trigger: GACACCATCAATCACCCAGCACAACTTATAAAGACT...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ATCCCCCAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTTGCAAGTTTATCAGCTaGCACCAGTTGAACATTCAA +
Preference number: 2 (lower is better)
Translates to: IPQVILGSYGVCKCPGMSCKFIS*HQLNIQ
Trigger: TTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCA...ACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTGGGGGAT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTCGCTGACTCTGTAACCCAGAAATTGCTGTGGGATATGGTGAGAGTGCCGTGGATAACCAGCTATGCTTaGGCCTCTCTTTACTATTCT +
Preference number: 2 (lower is better)
Translates to: FADSVTQKLLWDMVRVPWITSYA*ASLYYS
Trigger: AGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTAT...CCACGGCACTCTCACCATATCCCACAGCAATTTCTGGGTTACAGAGTCAGCGAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: LGRIGTTSLLSDFRFLDVCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...TACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp ATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: IALGRIGTTSLLSDFRFLCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...CAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: WKCLALHSGGLVPHPYYLCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...CAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTAGATACTCAATCTTGTTaGCAGGAAATACAGACCCTG +
Preference number: 2 (lower is better)
Translates to: SHLEVFSIALGRIGTTSLDTQSC*QEIQTL
Trigger: CAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATC...TAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GCTCAAGTAGACTTTCTAGTCAATTCACCCAAATTCCAACAGGAATTGGTTTATGTGCTACTGGTTGTGTaGGTGGCACGCCAGTACGCC +
Preference number: 2 (lower is better)
Translates to: AQVDFLVNSPKFQQELVYVLLVV*VARQYA
Trigger: GGCGTACTGGCGTGCCACCCACACAACCAGTAGCAC...ATAAACCAATTCCTGTTGGAATTTGGGTGAATTGACTAGAAAGTCTACTTGAGC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATACCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: YSILLAGNTDPAFVLSEIPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...TATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: YSSEPFHCDNFHQRSLDFPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...GAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ACAGACCTCTTAGCAAGAGAAATGTCAGCTGTCACTCTCGTTATTGAAATCCTCGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: TDLLAREMSAVTLVIEILEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...GAGGATTTCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAAGAGGTCTGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635904.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp CAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: QWKDTQSCWQEIQTLRLCEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...ACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp AAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: KCLALHSGGLVPHPYYLTLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...AGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp GGACTCAGCCTTCCTGCTAGTTTGTGTATGTTGGCGGAAATTCTCCATGCCCATAGGGTGAACTCTGTTTaGGCTTTAAAGGTTTGGGTT +
Preference number: 2 (lower is better)
Translates to: GLSLPASLCMLAEILHAHRVNSV*ALKVWV
Trigger: AACCCAAACCTTTAAAGCCCAAACAGAGTTCACCCT...ATGGGCATGGAGAATTTCCGCCAACATACACAAACTAGCAGGAAGGCTGAGTCC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp GGGATAGAGCCAGGATTCTTAGATCTGCCTGAAAGCGATTCATTAATTCATTCAATGGGAATGGTGCCCTaGAGGCTGCTCACCTTCAGA +
Preference number: 2 (lower is better)
Translates to: GIEPGFLDLPESDSLIHSMGMVP*RLLTFR
Trigger: TCTGAAGGTGAGCAGCCTCCAGGGCACCATTCCCAT...TGAATGAATTAATGAATCGCTTTCAGGCAGATCTAAGAATCCTGGCTCTATCCC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp CCTAGGGGGAGGTTACCATGGAAGGTGTTTTTCATGCTTAACCATGTGCAATTGCTCCATGCCCATGGCTaGATTTTTGTAGACCACTCT +
Preference number: 2 (lower is better)
Translates to: PRGRLPWKVFFMLNHVQLLHAHG*IFVDHS
Trigger: AGAGTGGTCTACAAAAATCCAGCCATGGGCATGGAG...CAATTGCACATGGTTAAGCATGAAAAACACCTTCCATGGTAACCTCCCCCTAGG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 15 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR CAA 90 bp ATGTGGGAGTTGCTCGGAATGTCCCAGATACCATTTCTCCAAGACTaGAAGAAGAATTTCCACTTGATTTCCCTCCGTGAAAACGTCCTC +
Preference number: 2 (lower is better)
Translates to: MWELLGMSQIPFLQD*KKNFHLISLRENVL
Trigger: GAGGACGTTTTCACGGAGGGAAATCAAGTGGAAATTCTTCTTCAAGTCTTGGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR CAA 90 bp TGTGCTCCGTCACTTTTTGCTTCTGTTTTGCTGTTGATGTGGGAGTaGCTCGGAATGTCCCAGATACCATTTCTCCAAGACTTGAAGAAG +
Preference number: 2 (lower is better)
Translates to: CAPSLFASVLLLMWE*LGMSQIPFLQDLKK
Trigger: CTTCTTCAAGTCTTGGAGAAATGGTATCTGGGACATTCCGAGCAACTCCCACATCAACAGCAAAACAGAAGCAAAAAGTGACGGAGCACA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp ATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGTGATCCTCTTACTTAGCATAAAATaGCAGCAGCCCATTAGCACA +
Preference number: 2 (lower is better)
Translates to: IRLKAYVGSHGYIPQVILLLSIK*QQPIST
Trigger: TGTGCTAATGGGCTGCTGTCATTTTATGCTAAGTAA...GAGGATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 14 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637535.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp TCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTAAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: SHLEVFSIALGRIGTTSLKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...TAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: AENWKTSGSYSSEPFHCDKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp GCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: ALGRIGTTSLLSDFRFLDHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...ATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ATGAATTCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACACACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: MNSHLEVFSIALGRIGTTHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...TGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGAATTCAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAAATTATGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: INWFQLELVIWNFQHGKLCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...TAATTTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp TGCTCAAGTAGACTTTCTAGTCAATTCACCCAAATTCCAACAGGAATTGGTTTATGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: CSSRLSSQFTQIPTGIGLCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...TAAACCAATTCCTGTTGGAATTTGGGTGAATTGACTAGAAAGTCTACTTGAGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp GTCAGGGTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: VRVIFFHKRVMISAMLRTVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...AGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGAC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp AATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGTGGCACCACCGGACGCATTaGCGGTACAACATCGTAAGG +
Preference number: 2 (lower is better)
Translates to: NFHQRSLDFVFQLESSLWHHRTH*RYNIVR
Trigger: CCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTG...CCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000636762.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp GCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATTGTCACTCTCGTTATTaGAATCCTCCCATCAAACCT +
Preference number: 2 (lower is better)
Translates to: ALGRIGTTSLLSDFRFLDCHSRY*NPPIKP
Trigger: AGGTTTGATGGGAGGATTTCAATAACGAGAGTGACA...ATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000636762.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp CTAGTCAATTCACCCAAATTCCAACAGGAATTGGTTTATAAATTGGTTCCAACTGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: LVNSPKFQQELVYKLVPTAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...AGTTGGAACCAATTTATAAACCAATTCCTGTTGGAATTTGGGTGAATTGACTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp CATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTGCGGGGTCATGGGTGTaGTACTGGTTGTGTGGGTGG +
Preference number: 2 (lower is better)
Translates to: HCDNFHQRSLDFVFQLESAGSWV*YWLCGW
Trigger: CCACCCACACAACCAGTAGCACACCCATGACCCCGC...ACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp CAGGTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTCAATTATTGCTCTCTTaGTGGGATTATTTAGGACAG +
Preference number: 2 (lower is better)
Translates to: QVILGSYGVCKCPGMSQGQLLLS*WDYLGQ
Trigger: CTGTCCTAAATAATCCCAGCAAGAGAGCAATAATTG...ACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCACCTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp TCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTAAGTCTTTATAAGTTGTaGTGGGTGATTGATGGTGTC +
Preference number: 2 (lower is better)
Translates to: SHLEVFSIALGRIGTTSLSLYKL*WVIDGV
Trigger: GACACCATCAATCACCCAGCACAACTTATAAAGACT...TAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635738.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAAAGTCTTTATAAGTTGTaGTGGGTGATTGATGGTGTC +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKSLYKL*WVIDGV
Trigger: GACACCATCAATCACCCAGCACAACTTATAAAGACT...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATTGCAAGTTTATCAGCTaGCACCAGTTGAACATTCAA +
Preference number: 2 (lower is better)
Translates to: AENWKTSGSYSSEPFHCDCKFIS*HQLNIQ
Trigger: TTGAATGTTCAACTGGTGGCAGCTGATAAACTTGCA...ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GTCCTAGCTCGATGGGAATGGTGCCCTGGAGGCTGCTCACCTTCAGAGTTTAATTTAAAGGTTTGGGTTTaGTGGAAGATTGATTGTTTG +
Preference number: 2 (lower is better)
Translates to: VLARWEWCPGGCSPSEFNLKVWV*WKIDCL
Trigger: CAAACAATCAATCTTCCAGCAAACCCAAACCTTTAA...ATTAAACTCTGAAGGTGAGCAGCCTCCAGGGCACCATTCCCATCGAGCTAGGAC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR GCA 90 bp CAAAAACATCTATATTTCTCACCTCCCATCAAACCTGTGCTTCAGGAAATCAAAGGCTTTGTACACAGGTaGCGGGTATCCTTGGCACGC +
Preference number: 2 (lower is better)
Translates to: QKHLYFSPPIKPVLQEIKGFVHR*RVSLAR
Trigger: GCGTGCCAAGGATACCCGGCACCTGTGTACAAAGCC...TTTGATTTCCTGAAGCACAGGTTTGATGGGAGGTGAGAAATATAGATGTTTTTG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR GCA 90 bp GTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCTCTCTCCTGTCGAATTaGTTCCCGGTCCTCTTCCAA +
Preference number: 2 (lower is better)
Translates to: VPHPYYLTSDSWMYVVVLSLLSN*FPVLFQ
Trigger: TTGGAAGAGGACCGGGAAGCAATTCGACAGGAGAGA...GAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTAC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR-3UTR GCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTAGCTGGATAGCTGCTTaGTGTTCTCTCTCCTGTCGA +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPSWIAA*CSLSCR
Trigger: TCGACAGGAGAGAGAACAGCAAGCAGCTATCCAGCT...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR-3UTR CCA 90 bp TTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: LHSGGLVPHPYYLTSDSWLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...CCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: KCLALHSGGLVPHPYYLTCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...AGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp ATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAAATTATACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: INWFQLELVIWNFQHGKLYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...TAATTTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp AAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAAATTATTTCATGGGTGTGCTACTaGTTGTGTGGGTGGCACGCC +
Preference number: 2 (lower is better)
Translates to: KLVPTGTGHLEFPAWEIISWVCY*LCGWHA
Trigger: GGCGTGCCACCCACACAACCAGTAGCACACCCATGA...AATAATTTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TTTATATTTCACATAACCAGCTATGCTTGGGCCTCTCTTTACTATTCTCTCTCACCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: FIFHITSYAWASLYYSLSPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...TGAGAGAGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGAAATATAAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CCAAATTCCAACAGGAATTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: PNSNRNWFINWFQLELVIPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...AATGACCAGTTCCAGTTGGAACCAATTTATAAACCAATTCCTGTTGGAATTTGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: LRTGRQAVPTLPSPFIVITSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...TATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCAGTACTTCCGCTAAGCTaGACCGGGTGTTCGAACGTT +
Preference number: 2 (lower is better)
Translates to: LAGNTDPAFVLSEIDEFPVLPLS*TGCSNV
Trigger: AACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTAC...TGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635738.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp AGTTCTCTGTGGAGTGGTTGCTGTGCCTCATTCGCTGACTCTGTAACCCAGAAAAACATCAAACATTTCTaGGGGGCATTGTGCAAGTTT +
Preference number: 2 (lower is better)
Translates to: SSLWSGCCASFADSVTQKNIKHF*GALCKF
Trigger: AAACTTGCACAATGCCCCCCAGAAATGTTTGATGTT...TTTCTGGGTTACAGAGTCAGCGAATGAGGCACAGCAACCACTCCACAGAGAACT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GGACTCAGCCTTCCTGCTAGTTTGTGTATGTTGGCGGAAATTCTCCATGCCCATAAGGTTTGGGTTTGCTaGAAGATTGATTGTTTGTCC +
Preference number: 2 (lower is better)
Translates to: GLSLPASLCMLAEILHAHKVWVC*KIDCLS
Trigger: GGACAAACAATCAATCTTCCAGCAAACCCAAACCTT...ATGGGCATGGAGAATTTCCGCCAACATACACAAACTAGCAGGAAGGCTGAGTCC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp ATCCCAATAACCAAAAGTTTCAAACAGAAGCAGGTTGTCTATCTGATTGTGGTTCTAGCTCGATGGGAATaGTGCCCTGGAGGCTGCTCA +
Preference number: 2 (lower is better)
Translates to: IPITKSFKQKQVVYLIVVLARWE*CPGGCS
Trigger: TGAGCAGCCTCCAGGGCACCATTCCCATCGAGCTAG...AACCACAATCAGATAGACAACCTGCTTCTGTTTGAAACTTTTGGTTATTGGGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR-3UTR TCA 90 bp GCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: AENWKTSGSYSSEPFHCDPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp TCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: SHLEVFSIALGRIGTTSLPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...TAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: AMLRTGRQAVPTLPSPFIPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...AATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp CTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTACACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: LGRIGTTSLLSDFRFLDVHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...TACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: IALGRIGTTSLLSDFRFLHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...CAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATATATGCAGGGGGATGTGGTaGGGTTGTAATGGGGTTCAA +
Preference number: 2 (lower is better)
Translates to: NINAGGCGEVVMGFKIYICRGMW*GCNGVQ
Trigger: TTGAACCCCATTACAACCTCACCACATCCCCCTGCA...TATATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AACATGCAGCACTGTACACATTTGCATAGTATATTTTACCCAGCATGCCTTGTATGCAGGGGGATGTGGTaGGGTTGTAATGGGGTTCAA +
Preference number: 2 (lower is better)
Translates to: NMQHCTHLHSIFYPACLVCRGMW*GCNGVQ
Trigger: TTGAACCCCATTACAACCTCACCACATCCCCCTGCA...TACAAGGCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp CCAGCAAATAAATACCAAAGCTGGATTTGGCTTCTATTGGTATTTCGATTTTCTTGCTGTGGGATATGGTaGGAGTGCCGTGGAGCCCAA +
Preference number: 2 (lower is better)
Translates to: PANKYQSWIWLLLVFRFSCCGIW*ECRGAQ
Trigger: TTGGGCTCCACGGCACTCTCACCATATCCCACAGCA...AGAAAATCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTATTTATTTGCTGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp AGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCAGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: SGSYSSEPFHCDNFHQRSVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...TGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp ACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: TGRQAVPTLPSPFIVIIFVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...GAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp ATCAGTAATGTGGAACTTATTTCCATGGTCAAGAAGATTACTGAACTGGTGCATCACCACCGGACGCATTaGCGGTACAACATCGTAAGG +
Preference number: 2 (lower is better)
Translates to: ISNVELISMVKKITELVHHHRTH*RYNIVR
Trigger: CCTTACGATGTTGTACCGTCAATGCGTCCGGTGGTG...ATGCACCAGTTCAGTAATCTTCTTGACCATGGAAATAAGTTCCACATTACTGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR-3UTR TCA 90 bp AGTCAGGGTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTGTCACTCTCGTTATTaGAATCCTCCCATCAAACCT +
Preference number: 2 (lower is better)
Translates to: SQGNLLPQEGNDLGYAENCHSRY*NPPIKP
Trigger: AGGTTTGATGGGAGGATTTCAATAACGAGAGTGACA...GTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGACT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635904.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp CTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: LGRIGTTSLLSDFRFLDVSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp TCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTGACTTTCTCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: SHMSKIQRSPMSSLAVTFSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...GAAAGTCACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR GCA 90 bp TTGCACACAAAGGCAATTCCCTTGCAGTTTGTTTTGTTCCCTATGATGACTTATTCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: LHTKAIPLQFVLFPMMTYSLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...ATAAGTCATCATAGGGAACAAAACAAACTGCAAGGGAATTGCCTTTGTGTGCAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000635738.1
3UTR-3UTR GCA 90 bp AATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGTGGTCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: NFHQRSLDFVFQLESSLWSLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...CCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp TCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGAACAACATCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: SDSWMYVVVLRLIKGRTTSLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...TGTTGTTCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp AATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCAATTATTGCTCTCTTaGTGGGATTATTTAGGACAG +
Preference number: 2 (lower is better)
Translates to: NDLGYAENWKTSGSYSSEQLLLS*WDYLGQ
Trigger: CTGTCCTAAATAATCCCAGCAAGAGAGCAATAATTG...CTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GAGGGTAATGATCTCGGCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTCGAACGTTCAATTATTaGTCTCTTGCTGGGATTATT +
Preference number: 2 (lower is better)
Translates to: EGNDLGYAENWKTSGSYSRTFNY*SLAGII
Trigger: AATAATCCCAGCAAGAGAGCAATAATTGAACGTTCG...AGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCCGAGATCATTACCCTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTACAGGTTTGGACTTTaGTCTCTCAAGCTGGATAGC +
Preference number: 2 (lower is better)
Translates to: TSGSYSSEPFHCDNFHQRYRFGL*SLKLDS
Trigger: GCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTA...CCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp TTTCACTTTGTACTTCCGCTAAGCTGGACCGGGTGTTCGAACGTTCAATTATTGTACAGGTTTGGACTTTaGTCTCTCAAGCTGGATAGC +
Preference number: 2 (lower is better)
Translates to: FHFVLPLSWTGCSNVQLLYRFGL*SLKLDS
Trigger: GCTATCCAGCTTGAGAGAGCAAAGTCCAAACCTGTA...CAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp TTTTGTTTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGTGTCTTCACGGCAAATaGTACAGGTTTGGACTTTGC +
Preference number: 2 (lower is better)
Translates to: FCFIRLKAYVGSHGYIPQCLHGK*YRFGLC
Trigger: GCAAAGTCCAAACCTGTAGCATTTGCCGTGAAGACA...CTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAAACAAAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp TCACATAACCAGCTATGCTTGGGCCTCTCTTTACTATTCTCTCTCACTGCTGAAGGTTCCAACTGGAACTaGTCATTTGGAATTTCCAGC +
Preference number: 2 (lower is better)
Translates to: SHNQLCLGLSLLFSLTAEGSNWN*SFGISS
Trigger: GCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACC...TTCAGCAGTGAGAGAGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GCTATGCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: AMLRTGRQAVPTLPSPFIYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...AATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp GCTGAGAACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: AENWKTSGSYSSEPFHCDYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...ATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGTTCTCAGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTATGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAGCAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: KQWKDTQSCWQEIQTLRLCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...CAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTGCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAAGGGAGAACAACACCCCATTTTATATTTCACATAACCAGCTATGCTTGGGCCTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: KGRTTPHFIFHITSYAWACTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...GGCCCAAGCATAGCTGGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AATTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATTACTGGTTGTGTGGGTaGCACGCCAGTACGCCTCCA +
Preference number: 2 (lower is better)
Translates to: NWFINWFQLELVIWNFQHYWLCG*HASTPP
Trigger: TGGAGGCGTACTGGCGTGCCACCCACACAACCAGTA...ATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAACCAATT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGCCAGCAGCGGGGTCATaGGTGTGCTACTGGTTGTGT +
Preference number: 2 (lower is better)
Translates to: PFHCDNFHQRSLDFVFQLPAAGS*VCYWLC
Trigger: ACACAACCAGTAGCACACCCATGACCCCGCTGCTGG...CAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: LVYKLVPTGTGHLEFPAWEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...CCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAACCAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGATTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: LTSDSWMYVVVLRLIKGRLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...TCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TTTGTTTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: FVSLDSKPMSGVMAISPRTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...CCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAAACAAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGAGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: LTSDSWMYVVVLRLIKGRGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...TCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTGTACTTCCGCTAAGCTaGACCGGGTGTTCGAACGTT +
Preference number: 2 (lower is better)
Translates to: SEPFHCDNFHQRSLDFVFVLPLS*TGCSNV
Trigger: AACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTAC...AAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTCAGGGTAATCTTCTTCCACAAGAGGGTAATGATCTCGGCTATGCTGAGAACTCAAATGCTACAGGTTTaGACTTTGCTCTCTCAAGCT +
Preference number: 2 (lower is better)
Translates to: VRVIFFHKRVMISAMLRTQMLQV*TLLSQA
Trigger: AGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTTG...AGTTCTCAGCATAGCCGAGATCATTACCCTCTTGTGGAAGAAGATTACCCTGAC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp TTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: LHSGGLVPHPYYLTSDSWPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...CCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: LGRIGTTSLLSDFRFLDVFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...TACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGCCACTGGAAAAACTGTaGAGACTTAATAAGATGAAG +
Preference number: 2 (lower is better)
Translates to: LHSGGLVPHPYYLTSDSWPLEKL*RLNKMK
Trigger: CTTCATCTTATTAAGTCTTCACAGTTTTTCCAGTGG...CCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ATGAATTCCCACCTGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACACCACTGGAAAAACTGTaGAGACTTAATAAGATGAAG +
Preference number: 2 (lower is better)
Translates to: MNSHLEVFSIALGRIGTTPLEKL*RLNKMK
Trigger: CTTCATCTTATTAAGTCTTCACAGTTTTTCCAGTGG...TGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCAGGTGGGAATTCAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GATATAGCAATAGCCTGGGATTTCAACAGCCCTCAGAATAGTAGGAAAAATCTTCATGCTTTGAGTGCCTaGATACTGAAAGGCTTGGGG +
Preference number: 2 (lower is better)
Translates to: DIAIAWDFNSPQNSRKNLHALSA*ILKGLG
Trigger: CCCCAAGCCTTTCAGTATTCAGGCACTCAAAGCATG...AAGATTTTTCCTACTATTCTGAGGGCTGTTGAAATCCCAGGCTATTGCTATATC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp GATTGTCAGCTTTTGAATAAGAATGCAAAGCAAAACAGGTATGGACATCTGATGTGCAGGGGGATGTGGTaGGGTTGTAATGGGGTTCAA +
Preference number: 2 (lower is better)
Translates to: DCQLLNKNAKQNRYGHLMCRGMW*GCNGVQ
Trigger: TTGAACCCCATTACAACCTCACCACATCCCCCTGCA...CATCAGATGTCCATACCTGTTTTGCTTTGCATTCTTATTCAAAAGCTGACAATC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 18 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636785.1
ENST00000636901.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637547.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TCAGGTATTGAAAAGCTAGAGGCCAGCCACTTCTGGTTCTTAGTTCCCCTTGTACTCTCTTTATCGGCATaGCATGGAAGACTAAAAACA +
Preference number: 2 (lower is better)
Translates to: SGIEKLEASHFWFLVPLVLSLSA*HGRLKT
Trigger: TGTTTTTAGTCTTCCATGTCATGCCGATAAAGAGAG...TACAAGGGGAACTAAGAACCAGAAGTGGCTGGCCTCTAGCTTTTCAATACCTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp ACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCAGCTGCCACCAGTTaGACATTCAAGTGTTTACTT +
Preference number: 2 (lower is better)
Translates to: TSGSYSSEPFHCDNFHQRSAATS*TFKCLL
Trigger: AAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGA...CCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp AGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: SGSYSSEPFHCDNFHQRSSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp AAAAATCTCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTGGTGCATGCTTTGAGTaGCTGAATACTGAAAGGCTT +
Preference number: 2 (lower is better)
Translates to: KNLTHVQNSEEPYELTCCGACFE*LNTERL
Trigger: AAGCCTTTCAGTATTCAGGCACTCAAAGCATGCACC...ACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGAGATTTTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR GCA 90 bp TTCATTAGACTCAAAGCCTATGTCGGGAGTCATGGCTATATCCCCCAGGTGATCCGAACGTTCAATTATTaGTCTCTTGCTGGGATTATT +
Preference number: 2 (lower is better)
Translates to: FIRLKAYVGSHGYIPQVIRTFNY*SLAGII
Trigger: AATAATCCCAGCAAGAGAGCAATAATTGAACGTTCG...GATCACCTGGGGGATATAGCCATGACTCCCGACATAGGCTTTGAGTCTAATGAA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp GCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATGTGATTGATGGTGTCTaGATCAAGAACAACCAGTTG +
Preference number: 2 (lower is better)
Translates to: AVPTLPSPFIVIIFIRGHVIDGV*IKNNQL
Trigger: CAACTGGTTGTTCTTGATGCAGACACCATCAATCAC...ATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp AGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCAGTGATTGATGGTGTCTaGATCAAGAACAACCAGTTG +
Preference number: 2 (lower is better)
Translates to: SGSYSSEPFHCDNFHQRSVIDGV*IKNNQL
Trigger: CAACTGGTTGTTCTTGATGCAGACACCATCAATCAC...TGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GTGATCCTCGGTTCCTATGGGGTTTGTAAGTGTCCTGGTATGAGTCAGGGTAATTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: VILGSYGVCKCPGMSQGNYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...ATTACCCTGACTCATACCAGGACACTTACAAACCCCATAGGAACCGAGGATCAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp TCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTGACTTTCATAACCAGCTATGCTTaGGCCTCTCTTTACTATTCT +
Preference number: 2 (lower is better)
Translates to: SHMSKIQRSPMSSLAVTFITSYA*ASLYYS
Trigger: AGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTAT...GAAAGTCACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp GTTCATAATGGGGTACAAACACTGAACATAAATGCAGGGGGATGTGGTGAGGTTCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: VHNGVQTLNINAGGCGEVLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...AACCTCACCACATCCCCCTGCATTTATGTTCAGTGTTTGTACCCCATTATGAAC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TCACATAACCAGCTATGCTTGGGCCTCTCTTTACTATTCTCTCTCACTGCTGAACTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: SHNQLCLGLSLLFSLTAELTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...TTCAGCAGTGAGAGAGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTGATACTCAATCTTGTTaGCAGGAAATACAGACCCTG +
Preference number: 2 (lower is better)
Translates to: KCLALHSGGLVPHPYYLTDTQSC*QEIQTL
Trigger: CAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATC...AGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GATTGTCAGCTTTTGAATAAGAATGCAAAGCAAAACAGGTATGGACATCTGATGGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: DCQLLNKNAKQNRYGHLMEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...CATCAGATGTCCATACCTGTTTTGCTTTGCATTCTTATTCAAAAGCTGACAATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000637232.1
3UTR-3UTR CCA 90 bp GATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: DNFHQRSLDFVFQLESSLEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...CAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATTATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp ACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: TSGSYSSEPFHCDNFHQRTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...CCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp TCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTGGCTATGCTGAGAACTaGAAGACAAGCGGTTCCTAC +
Preference number: 2 (lower is better)
Translates to: SEPFHCDNFHQRSLDFVFGYAEN*KTSGSY
Trigger: GTAGGAACCGCTTGTCTTCCAGTTCTCAGCATAGCC...AAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp GGAACAAATACATCTTTCTTATTAAGCCTTTGTCCAGTAGATGAATGTGACGAAATGGGAATGGTGCCCTaGAGGCTGCTCACCTTCAGA +
Preference number: 2 (lower is better)
Translates to: GTNTSFLLSLCPVDECDEMGMVP*RLLTFR
Trigger: TCTGAAGGTGAGCAGCCTCCAGGGCACCATTCCCAT...TTCGTCACATTCATCTACTGGACAAAGGCTTAATAAGAAAGATGTATTTGTTCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR-3UTR CCA 90 bp TTAATATGTAGAAAGTCTTTAGCATCAAAGGAGATAGCTGTGCTTGGAACAGGCGTGGCACTCCAGGTGTaGCTTTATGTGTCACTTCAC +
Preference number: 2 (lower is better)
Translates to: LICRKSLASKEIAVLGTGVALQV*LYVSLH
Trigger: GTGAAGTGACACATAAAGCCACACCTGGAGTGCCAC...GCCTGTTCCAAGCACAGCTATCTCCTTTGATGCTAAAGACTTTCTACATATTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637330.1
3UTR-3UTR CCA 90 bp AAAGGGAGAACAACACCCCATTTTATATTTCACATAACCAGCTATGCTTGGGCCTTTGCTCTCTCAAGCTaGATAGCTGCTTGCTGTTCT +
Preference number: 2 (lower is better)
Translates to: KGRTTPHFIFHITSYAWAFALSS*IAACCS
Trigger: AGAACAGCAAGCAGCTATCCAGCTTGAGAGAGCAAA...GGCCCAAGCATAGCTGGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR CAA 90 bp GCCACTAAAGCAGAGGGAGAACAAAACATGCAGCACTGTACACATTaGCATAGTATATTTTACCCAGCATGCCTTGTAGAATGCTACACA +
Preference number: 2 (lower is better)
Translates to: ATKAEGEQNMQHCTH*HSIFYPACLVECYT
Trigger: TGTGTAGCATTCTACAAGGCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTTTTGTTCTCCCTCTGCTTTAGTGGC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp GTTCATAATGGGGTACAAACACTGAACATAAATGCAGGGGGATGTGGTGAGGTTTTACTTAGCATAAAATaGCAGCAGCCCATTAGCACA +
Preference number: 2 (lower is better)
Translates to: VHNGVQTLNINAGGCGEVLLSIK*QQPIST
Trigger: TGTGCTAATGGGCTGCTGTCATTTTATGCTAAGTAA...AACCTCACCACATCCCCCTGCATTTATGTTCAGTGTTTGTACCCCATTATGAAC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTGACTTTCCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: SHMSKIQRSPMSSLAVTFPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...GAAAGTCACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp ATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: IALGRIGTTSLLSDFRFLPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...CAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAAT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: TGRQAVPTLPSPFIVIIFFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...GAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp AAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: KCLALHSGGLVPHPYYLTFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...AGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GATTGTCAGCTTTTGAATAAGAATGCAAAGCAAAACAGGTATGGACATCTGATGCATGCTTTGAGTGCCTaGATACTGAAAGGCTTGGGG +
Preference number: 2 (lower is better)
Translates to: DCQLLNKNAKQNRYGHLMHALSA*ILKGLG
Trigger: CCCCAAGCCTTTCAGTATTCAGGCACTCAAAGCATG...CATCAGATGTCCATACCTGTTTTGCTTTGCATTCTTATTCAAAAGCTGACAATC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 18 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636785.1
ENST00000636901.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637547.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGGGTCAAGAAGATTACTaGACTGGTGCATGCTTTGAG +
Preference number: 2 (lower is better)
Translates to: HPYYLTSDSWMYVVVLRLGQEDY*TGACFE
Trigger: CTCAAAGCATGCACCAGTTCAGTAATCTTCTTGACC...CAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TCAGGTATTGAAAAGCTAGAGGCCAGCCACTTCTGGTTCTTAGTTCCCCTTGTATTTGTGCACAGATATTaGATGAGACTCTCTTTATCG +
Preference number: 2 (lower is better)
Translates to: SGIEKLEASHFWFLVPLVFVHRY*MRLSLS
Trigger: CGATAAAGAGAGTCTCATTCAATATCTGTGCACAAA...TACAAGGGGAACTAAGAACCAGAAGTGGCTGGCCTCTAGCTTTTCAATACCTGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR GCA 90 bp AAGCAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: KQWKDTQSCWQEIQTLRLSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...CAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTGCTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp CCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: PHPYYLTSDSWMYVVVLRSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp CATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGGGTGCATGCTTTGAGTaGCTGAATACTGAAAGGCTT +
Preference number: 2 (lower is better)
Translates to: HPYYLTSDSWMYVVVLRLGACFE*LNTERL
Trigger: AAGCCTTTCAGTATTCAGGCACTCAAAGCATGCACC...CAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp TCAATTCACCCAAATTCCAACAGGAATTGGTTTATAAATTGGTTCCAACTGGAATCTCTGTGGAGTGGTTaGTGTGCCTCATTCGCTGAC +
Preference number: 2 (lower is better)
Translates to: SIHPNSNRNWFINWFQLESLWSG*CASFAD
Trigger: GTCAGCGAATGAGGCACAGCAACCACTCCACAGAGA...TTCCAGTTGGAACCAATTTATAAACCAATTCCTGTTGGAATTTGGGTGAATTGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp TGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGCAGTTGCAAAGATCTTaGCAACTCAAAGATTCTTTC +
Preference number: 2 (lower is better)
Translates to: WKCLALHSGGLVPHPYYLQLQRS*QLKDSF
Trigger: GAAAGAATCTTTGAGTTGGCAAGATCTTTGCAACTG...CAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635738.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp ACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCTCAAGAACAACCAGTTaGAAAGATCTTGCCAACTCA +
Preference number: 2 (lower is better)
Translates to: TGRQAVPTLPSPFIVIIFSRTTS*KDLANS
Trigger: TGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGA...GAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp TACTATGAGCCAAGACCTTATTGTAGCCATTCGTCTCCTAGGGGGAGGTTACCATTAAAGGTTTGGGTTTaGTGGAAGATTGATTGTTTG +
Preference number: 2 (lower is better)
Translates to: YYEPRPYCSHSSPRGRLPLKVWV*WKIDCL
Trigger: CAAACAATCAATCTTCCAGCAAACCCAAACCTTTAA...TGGTAACCTCCCCCTAGGAGACGAATGGCTACAATAAGGTCTTGGCTCATAGTA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR GCA 90 bp CCATGGAAGGTGTTTTTCATGCTTAACCATGTGCAATTGCTAATTTCCACCCCCGGATTTGGTGGCATATaGCATCATCTTAAAAACCCA +
Preference number: 2 (lower is better)
Translates to: PWKVFFMLNHVQLLISTPGFGGI*HHLKNP
Trigger: TGGGTTTTTAAGATGATGGCATATGCCACCAAATCC...GGGGGTGGAAATTAGCAATTGCACATGGTTAAGCATGAAAAACACCTTCCATGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 15 nt.
Matches the following 2 transcripts:
ENST00000636129.1
ENST00000636947.1
3UTR-3UTR CCA 90 bp TGGAAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: WKCLALHSGGLVPHPYYLYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...CAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTTCCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TCAGGTATTGAAAAGCTAGAGGCCAGCCACTTCTGGTTCTTAGTTCCCCTTGTATACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: SGIEKLEASHFWFLVPLVYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...TACAAGGGGAACTAAGAACCAGAAGTGGCTGGCCTCTAGCTTTTCAATACCTGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp GTTCATAATGGGGTACAAACACTGAACATAAATGCAGGGGGATGTGGTGAGGTTATAACCAGCTATGCTTaGGCCTCTCTTTACTATTCT +
Preference number: 2 (lower is better)
Translates to: VHNGVQTLNINAGGCGEVITSYA*ASLYYS
Trigger: AGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTAT...AACCTCACCACATCCCCCTGCATTTATGTTCAGTGTTTGTACCCCATTATGAAC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp CAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: QWKDTQSCWQEIQTLRLCLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...ACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAAAATCTCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: KNLTHVQNSEEPYELTCCLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...ACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGAGATTTTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp AAGCAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: KQWKDTQSCWQEIQTLRLLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...CAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTGCTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: VPHPYYLTSDSWMYVVVLLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...GAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTAC
42% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATATGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: YSILLAGNTDPAFVLSEICTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...TATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATATATGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: NINAGGCGEVVMGFKIYICTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...TATATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGAACAACATGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: SDSWMYVVVLRLIKGRTTCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...TGTTGTTCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AACATGCAGCACTGTACACATTTGCATAGTATATTTTACCCAGCATGCCTTGTATGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: NMQHCTHLHSIFYPACLVCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...TACAAGGCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp CCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGAGATACTCAATCTTGTTaGCAGGAAATACAGACCCTG +
Preference number: 2 (lower is better)
Translates to: PHPYYLTSDSWMYVVVLRDTQSC*QEIQTL
Trigger: CAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATC...TCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAAGGGAGAACAACACCCCATTTTATATTTCACATAACCAGCTATGCTTGGGCCGATACTCAATCTTGTTaGCAGGAAATACAGACCCTG +
Preference number: 2 (lower is better)
Translates to: KGRTTPHFIFHITSYAWADTQSC*QEIQTL
Trigger: CAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATC...GGCCCAAGCATAGCTGGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATGATACTCAATCTTGTTaGCAGGAAATACAGACCCTG +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYDTQSC*QEIQTL
Trigger: CAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATC...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TCAGGTATTGAAAAGCTAGAGGCCAGCCACTTCTGGTTCTTAGTTCCCCTTGTATATGGCTGGACTTATTaGGGTTTTAGAAAATGCATG +
Preference number: 2 (lower is better)
Translates to: SGIEKLEASHFWFLVPLVYGWTY*GFRKCM
Trigger: CATGCATTTTCTAAAACCCCAATAAGTCCAGCCATA...TACAAGGGGAACTAAGAACCAGAAGTGGCTGGCCTCTAGCTTTTCAATACCTGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp TCCTCATTATCAGCTAAACAGGTTCATAATGGGGTACAAACACTGAACATAAATGAGTTCTCTGTGGAGTaGTTGCTGTGCCTCATTCGC +
Preference number: 2 (lower is better)
Translates to: SSLSAKQVHNGVQTLNINEFSVE*LLCLIR
Trigger: GCGAATGAGGCACAGCAACCACTCCACAGAGAACTC...ATTTATGTTCAGTGTTTGTACCCCATTATGAACCTGTTTAGCTGATAATGAGGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp AAATTCCAACAGGAATTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGTACTTCCGCTAAGCTaGACCGGGTGTTCGAACGTT +
Preference number: 2 (lower is better)
Translates to: KFQQELVYKLVPTGTGHLVLPLS*TGCSNV
Trigger: AACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTAC...CAAATGACCAGTTCCAGTTGGAACCAATTTATAAACCAATTCCTGTTGGAATTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635738.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp CACTCCAACTTTAAGTGTAAATTTAGCTTCCAGCAAATAAATACCAAAGCTGGAGTACTTCCGCTAAGCTaGACCGGGTGTTCGAACGTT +
Preference number: 2 (lower is better)
Translates to: HSNFKCKFSFQQINTKAGVLPLS*TGCSNV
Trigger: AACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTAC...TCCAGCTTTGGTATTTATTTGCTGGAAGCTAAATTTACACTTAAAGTTGGAGTG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635738.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp ACTGGAAGACAAGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: TGRQAVPTLPSPFIVIIFPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...GAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCTTGTCTTCCAGT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp AAAGGGAGAACAACACCCCATTTTATATTTCACATAACCAGCTATGCTTGGGCCAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: KGRTTPHFIFHITSYAWAKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...GGCCCAAGCATAGCTGGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: QWKDTQSCWQEIQTLRLCKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...ACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AAAAATCTCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: KNLTHVQNSEEPYELTCCFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...ACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGAGATTTTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AAAGGGAGAACAACACCCCATTTTATATTTCACATAACCAGCTATGCTTGGGCCTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: KGRTTPHFIFHITSYAWAFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...GGCCCAAGCATAGCTGGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTATTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: VPHPYYLTSDSWMYVVVLFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...GAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTAC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AAGCAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: KQWKDTQSCWQEIQTLRLFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...CAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTGCTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: HPYYLTSDSWMYVVVLRLHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...CAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATG
41% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ACAAAGGCAATTCCCTTGCAGTTTGTTTTGTTCCCTATGATGACTTATTTGTTACATGCTTTGAGTGCCTaGATACTGAAAGGCTTGGGG +
Preference number: 2 (lower is better)
Translates to: TKAIPLQFVLFPMMTYLLHALSA*ILKGLG
Trigger: CCCCAAGCCTTTCAGTATTCAGGCACTCAAAGCATG...TAACAAATAAGTCATCATAGGGAACAAAACAAACTGCAAGGGAATTGCCTTTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636617.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp AAACAAAGTATGGAGTATGTATTTTTCAAAGGTGCTTGGTGTGCTTGGCAAAAACATGCTTTGAGTGCCTaGATACTGAAAGGCTTGGGG +
Preference number: 2 (lower is better)
Translates to: KQSMEYVFFKGAWCAWQKHALSA*ILKGLG
Trigger: CCCCAAGCCTTTCAGTATTCAGGCACTCAAAGCATG...TTTTTGCCAAGCACACCAAGCACCTTTGAAAAATACATACTCCATACTTTGTTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 13 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000636130.1
ENST00000636350.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
ENST00000638005.1
3UTR-3UTR TCA 90 bp TACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGGTCAAGAAGATTACTaGACTGGTGCATGCTTTGAG +
Preference number: 2 (lower is better)
Translates to: YSILLAGNTDPAFVLSEIGQEDY*TGACFE
Trigger: CTCAAAGCATGCACCAGTTCAGTAATCTTCTTGACC...TATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AACATGCAGCACTGTACACATTTGCATAGTATATTTTACCCAGCATGCCTTGTAACACTTATCAGGTATTaGAAAGCTAGAGGCCAGCCA +
Preference number: 2 (lower is better)
Translates to: NMQHCTHLHSIFYPACLVTLIRY*KARGQP
Trigger: TGGCTGGCCTCTAGCTTTTCAATACCTGATAAGTGT...TACAAGGCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp AATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGGAGAGTTCTCTGTGGGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: NFHQRSLDFVFQLESSLWVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...CCACAGAGAACTCTCCAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp TCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: SEPFHCDNFHQRSLDFVFVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...AAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp TTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: LAGNTDPAFVLSEIDEFPSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp CTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: LTSDSWMYVVVLRLIKGRSHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp AAAAATCTCACACATGTCCAAAATTCAGAGGAGCCCTATGAGCTCACTTGCTGTGGGAGTCCAAGATTATaGATATCCTTACCCAGTAAA +
Preference number: 2 (lower is better)
Translates to: KNLTHVQNSEEPYELTCCGSPRL*ISLPSK
Trigger: TTTACTGGGTAAGGATATGCATAATCTTGGACTCCC...ACAGCAAGTGAGCTCATAGGGCTCCTCTGAATTTTGGACATGTGTGAGATTTTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR GCA 90 bp TTTCACTTTGTACTTCCGCTAAGCTGGACCGGGTGTTCGAACGTTCAATTATTGCAATTATTGCTCTCTTaGTGGGATTATTTAGGACAG +
Preference number: 2 (lower is better)
Translates to: FHFVLPLSWTGCSNVQLLQLLLS*WDYLGQ
Trigger: CTGTCCTAAATAATCCCAGCAAGAGAGCAATAATTG...CAATAATTGAACGTTCGAACACCCGGTCCAGCTTAGCGGAAGTACAAAGTGAAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636390.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR GCA 90 bp ACAGACCTCTTAGCAAGAGAAATGTCAGCTGTCACTCTCGTTATTGAAATCCTCTCAAGAACAACCAGTTaGAAAGATCTTGCCAACTCA +
Preference number: 2 (lower is better)
Translates to: TDLLAREMSAVTLVIEILSRTTS*KDLANS
Trigger: TGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGA...GAGGATTTCAATAACGAGAGTGACAGCTGACATTTCTCTTGCTAAGAGGTCTGT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000635904.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR GCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTATGCTCCGTCACTTTTTaGTTCTGTTTTGCTGTTGAT +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVCSVTF*FCFAVD
Trigger: ATCAACAGCAAAACAGAAGCAAAAAGTGACGGAGCA...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR-3UTR CCA 90 bp GTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAAGGTTCCAACTGGAACTaGTCATTTGGAATTTCCAGC +
Preference number: 2 (lower is better)
Translates to: VYKLVPTGTGHLEFPAWEGSNWN*SFGISS
Trigger: GCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACC...TTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAAC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000397327.7
ENST00000439467.6
ENST00000534999.6
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637284.1
ENST00000637309.1
ENST00000637312.1
ENST00000637418.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TCACATAACCAGCTATGCTTGGGCCTCTCTTTACTATTCTCTCTCACTGCTGAATACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: SHNQLCLGLSLLFSLTAEYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...TTCAGCAGTGAGAGAGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAGTGTTTAGCATTGCACTCGGGAGGATTGGTACCACATCCTTACTATCTGACTTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: KCLALHSGGLVPHPYYLTYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...AGTCAGATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCAATGCTAAACACTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AGCGGTTCCTACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: SGSYSSEPFHCDNFHQRSYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...TGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTAGGAACCGCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTATAACCAGCTATGCTTaGGCCTCTCTTTACTATTCT +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPITSYA*ASLYYS
Trigger: AGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTAT...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAGCAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGATAACCAGCTATGCTTaGGCCTCTCTTTACTATTCT +
Preference number: 2 (lower is better)
Translates to: KQWKDTQSCWQEIQTLRLITSYA*ASLYYS
Trigger: AGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTAT...CAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTGCTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATATAACCAGCTATGCTTaGGCCTCTCTTTACTATTCT +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYITSYA*ASLYYS
Trigger: AGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTAT...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp ATCAGTAATGTGGAACTTATTTCCATGGTCAAGAAGATTACTGAACTGGTGCATTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: ISNVELISMVKKITELVHCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...ATGCACCAGTTCAGTAATCTTCTTGACCATGGAAATAAGTTCCACATTACTGAT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TTTTATATTTCACATAACCAGCTATGCTTGGGCCTCTCTTTACTATTCTCTCTCTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: FYISHNQLCLGLSLLFSLCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...GAGAGAGAATAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGAAATATAAAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AAATTCCAACAGGAATTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGTTGGAGAGTTCTCTGTaGAGTGGTTGCTGTGCCTCA +
Preference number: 2 (lower is better)
Translates to: KFQQELVYKLVPTGTGHLLESSL*SGCCAS
Trigger: TGAGGCACAGCAACCACTCCACAGAGAACTCTCCAA...CAAATGACCAGTTCCAGTTGGAACCAATTTATAAACCAATTCCTGTTGGAATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR CCA 90 bp CCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGCTATGTCGGGAGTCATaGCTATATCCCCCAGGTGAT +
Preference number: 2 (lower is better)
Translates to: PFHCDNFHQRSLDFVFQLLCRES*LYPPGD
Trigger: ATCACCTGGGGGATATAGCCATGACTCCCGACATAG...CAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGAAACATCAAACATTTCTaGGGGGCATTGTGCAAGTTT +
Preference number: 2 (lower is better)
Translates to: PHPYYLTSDSWMYVVVLRNIKHF*GALCKF
Trigger: AAACTTGCACAATGCCCCCCAGAAATGTTTGATGTT...TCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp AAAGGGAGAACAACACCCCATTTTATATTTCACATAACCAGCTATGCTTGGGCCCAATCTGAGTGGACTTaGAATGAAGCCAATTTCACA +
Preference number: 2 (lower is better)
Translates to: KGRTTPHFIFHITSYAWAQSEWT*NEANFT
Trigger: TGTGAAATTGGCTTCATTCCAAGTCCACTCAGATTG...GGCCCAAGCATAGCTGGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR-3UTR TCA 90 bp CAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: QWKDTQSCWQEIQTLRLCPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...ACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTACCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCACCTCCCAGATTTTTCAGTTaGTTACAACATGCTCAAGTA +
Preference number: 2 (lower is better)
Translates to: AGNTDPAFVLSEIDEFPPPRFFS*LQHAQV
Trigger: TACTTGAGCATGTTGTAATCAACTGAAAAATCTGGG...AGGTGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGAAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: LTSDSWMYVVVLRLIKGRKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...TCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATAGATGAATTCCCATTTGCCAACTTCAAATaGGCTAACAGTACTGACCAA +
Preference number: 2 (lower is better)
Translates to: LAGNTDPAFVLSEIDEFPFANFK*ANSTDQ
Trigger: TTGGTCAGTACTGTTAGCTCATTTGAAGTTGGCAAA...TGGGAATTCATCTATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: TSLLSDFRFLDVCSCAQIHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...AATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGT
40% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAACACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: VYKLVPTGTGHLEFPAWEHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...TTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAAC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TTGCACACAAAGGCAATTCCCTTGCAGTTTGTTTTGTTCCCTATGATGACTTATCACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: LHTKAIPLQFVLFPMMTYHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...ATAAGTCATCATAGGGAACAAAACAAACTGCAAGGGAATTGCCTTTGTGTGCAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636617.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp TCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATTAAAGGGAGAACAACACACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: SDSWMYVVVLRLIKGRTTHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...TGTTGTTCTCCCTTTAATCAATCTGAGCACAACTACATACATCCAGGAATCTGA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp AACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATATACACATCCTTACTATCTaGCTTCAGATTCCTGGATGT +
Preference number: 2 (lower is better)
Translates to: NINAGGCGEVVMGFKIYIHILTI*LQIPGC
Trigger: ACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTG...TATATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTACCACTGGAAAAACTGTaGAGACTTAATAAGATGAAG +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVPLEKL*RLNKMK
Trigger: CTTCATCTTATTAAGTCTTCACAGTTTTTCCAGTGG...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTCCACTGGAAAAACTGTaGAGACTTAATAAGATGAAG +
Preference number: 2 (lower is better)
Translates to: QWKDTQSCWQEIQTLRLCPLEKL*RLNKMK
Trigger: CTTCATCTTATTAAGTCTTCACAGTTTTTCCAGTGG...ACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CTGAACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATCCACTGGAAAAACTGTaGAGACTTAATAAGATGAAG +
Preference number: 2 (lower is better)
Translates to: LNINAGGCGEVVMGFKIYPLEKL*RLNKMK
Trigger: CTTCATCTTATTAAGTCTTCACAGTTTTTCCAGTGG...ATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTTCAG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp CATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATAAGCTTCACTAGATaGCAGAAGAATCTCACAAGC +
Preference number: 2 (lower is better)
Translates to: HPYYLTSDSWMYVVVLRLISFTR*QKNLTS
Trigger: GCTTGTGAGATTCTTCTGTCATCTAGTGAAGCTTAT...CAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATG
40% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637547.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp TACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCTGTCACTCTCGTTATTaGAATCCTCCCATCAAACCT +
Preference number: 2 (lower is better)
Translates to: YSSEPFHCDNFHQRSLDFCHSRY*NPPIKP
Trigger: AGGTTTGATGGGAGGATTTCAATAACGAGAGTGACA...GAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000635904.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
3UTR-3UTR TCA 90 bp TTGCACACAAAGGCAATTCCCTTGCAGTTTGTTTTGTTCCCTATGATGACTTATTCAGCTGCCACCAGTTaGACATTCAAGTGTTTACTT +
Preference number: 2 (lower is better)
Translates to: LHTKAIPLQFVLFPMMTYSAATS*TFKCLL
Trigger: AAGTAAACACTTGAATGTTCAACTGGTGGCAGCTGA...ATAAGTCATCATAGGGAACAAAACAAACTGCAAGGGAATTGCCTTTGTGTGCAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000635738.1
3UTR-3UTR GCA 90 bp GTTCATAATGGGGTACAAACACTGAACATAAATGCAGGGGGATGTGGTGAGGTTCAGTTGATTACAACATaGTCAAGTAGACTTTCTAGT +
Preference number: 2 (lower is better)
Translates to: VHNGVQTLNINAGGCGEVQLITT*SSRLSS
Trigger: ACTAGAAAGTCTACTTGAGCATGTTGTAATCAACTG...AACCTCACCACATCCCCCTGCATTTATGTTCAGTGTTTGTACCCCATTATGAAC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp AACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATATATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: NINAGGCGEVVMGFKIYISHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TATATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp TACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATATCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: YSILLAGNTDPAFVLSEISHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...TATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp GTGCTCAGATTGATTAAAGGGAGAACAACACCCCATTTTATATTTCACATAACCGGTGCATGCTTTGAGTaGCTGAATACTGAAAGGCTT +
Preference number: 2 (lower is better)
Translates to: VLRLIKGRTTPHFIFHITGACFE*LNTERL
Trigger: AAGCCTTTCAGTATTCAGGCACTCAAAGCATGCACC...GGTTATGTGAAATATAAAATGGGGTGTTGTTCTCCCTTTAATCAATCTGAGCAC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp GATGGTGTCTGCATCAAGAACAACCAGTTGCAAAGATCTTGCCAACTCAAAGATCAATTATTGCTCTCTTaGTGGGATTATTTAGGACAG +
Preference number: 2 (lower is better)
Translates to: DGVCIKNNQLQRSCQLKDQLLLS*WDYLGQ
Trigger: CTGTCCTAAATAATCCCAGCAAGAGAGCAATAATTG...ATCTTTGAGTTGGCAAGATCTTTGCAACTGGTTGTTCTTGATGCAGACACCATC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000636390.1
ENST00000636507.1
ENST00000636762.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CAATGGAAAGATACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTTACCAAAGCTGGATTTaGCTTCTATTGGTATTTCGA +
Preference number: 2 (lower is better)
Translates to: QWKDTQSCWQEIQTLRLCYQSWI*LLLVFR
Trigger: TCGAAATACCAATAGAAGCCAAATCCAGCTTTGGTA...ACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATCTTTCCATTG
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GAACAAAACATGCAGCACTGTACACATTTGCATAGTATATTTTACCCAGCATGCCTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: EQNMQHCTHLHSIFYPACLTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...GCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTTTTGTTC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp AACATAAATGCAGGGGGATGTGGTGAGGTTGTAATGGGGTTCAAGATATATATACTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: NINAGGCGEVVMGFKIYILTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...TATATATATCTTGAACCCCATTACAACCTCACCACATCCCCCTGCATTTATGTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp TACTCAATCTTGTTGGCAGGAAATACAGACCCTGCGTTTGTGTTAAGTGAAATACTGACTTCAGATTCCTaGATGTATGTAGTTGTGCTC +
Preference number: 2 (lower is better)
Translates to: YSILLAGNTDPAFVLSEILTSDS*MYVVVL
Trigger: GAGCACAACTACATACATCCAGGAATCTGAAGTCAG...TATTTCACTTAACACAAACGCAGGGTCTGTATTTCCTGCCAACAAGATTGAGTA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp AGAACTACATTTCCACATTGTCACATGAGTCCACATTATTATATGTCTGTGACTTGCACTCGGGAGGATTaGTACCACATCCTTACTATC +
Preference number: 2 (lower is better)
Translates to: RTTFPHCHMSPHYYMSVTCTRED*YHILTI
Trigger: GATAGTAAGGATGTGGTACCAATCCTCCCGAGTGCA...AGTCACAGACATATAATAATGTGGACTCATGTGACAATGTGGAAATGTAGTTCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636617.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp ACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGATACTCAATCTTGTTaGCAGGAAATACAGACCCTG +
Preference number: 2 (lower is better)
Translates to: TSLLSDFRFLDVCSCAQIDTQSC*QEIQTL
Trigger: CAGGGTCTGTATTTCCTGCCAACAAGATTGAGTATC...AATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GGAGGATTGGTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTATATGGCTGGACTTATTaGGGTTTTAGAAAATGCATG +
Preference number: 2 (lower is better)
Translates to: GGLVPHPYYLTSDSWMYVYGWTY*GFRKCM
Trigger: CATGCATTTTCTAAAACCCCAATAAGTCCAGCCATA...TACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTACCAATCCTCC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GTTCATAATGGGGTACAAACACTGAACATAAATGCAGGGGGATGTGGTGAGGTTAACTCATCAGTAATGTaGAACTTATTTCCATGGTCA +
Preference number: 2 (lower is better)
Translates to: VHNGVQTLNINAGGCGEVNSSVM*NLFPWS
Trigger: TGACCATGGAAATAAGTTCCACATTACTGATGAGTT...AACCTCACCACATCCCCCTGCATTTATGTTCAGTGTTTGTACCCCATTATGAAC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 24 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR CCA 90 bp GATATAGCAATAGCCTGGGATTTCAACAGCCCTCAGAATAGTAGGAAAAATCTTCTAAGTCATGCTCTGTaGAAGTCAAGGACCAACAAA +
Preference number: 2 (lower is better)
Translates to: DIAIAWDFNSPQNSRKNLLSHAL*KSRTNK
Trigger: TTTGTTGGTCCTTGACTTCCACAGAGCATGACTTAG...AAGATTTTTCCTACTATTCTGAGGGCTGTTGAAATCCCAGGCTATTGCTATATC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR CCA 90 bp TACTCTTCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCACTTCGTCTTTCAATTaGAGAGTTCTCTGTGGAGTG +
Preference number: 2 (lower is better)
Translates to: YSSEPFHCDNFHQRSLDFTSSFN*RVLCGV
Trigger: CACTCCACAGAGAACTCTCCAATTGAAAGACGAAGT...GAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGAAGAGTA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR CCA 90 bp CATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCAGATTGAACATCAAACATTTCTaGGGGGCATTGTGCAAGTTT +
Preference number: 2 (lower is better)
Translates to: HPYYLTSDSWMYVVVLRLNIKHF*GALCKF
Trigger: AAACTTGCACAATGCCCCCCAGAAATGTTTGATGTT...CAATCTGAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000635738.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637312.1
ENST00000637436.1
3UTR-3UTR CCA 90 bp TTGGTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGCAAATGCTACAGGTTTaGACTTTGCTCTCTCAAGCT +
Preference number: 2 (lower is better)
Translates to: LVYKLVPTGTGHLEFPAWQMLQV*TLLSQA
Trigger: AGCTTGAGAGAGCAAAGTCCAAACCTGTAGCATTTG...CCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAACCAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637436.1
3UTR-3UTR CCA 90 bp TCCGAGCCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTGTTCTCCAATCTGAGTaGACTTGGAATGAAGCCAAT +
Preference number: 2 (lower is better)
Translates to: SEPFHCDNFHQRSLDFVFVLQSE*TWNEAN
Trigger: ATTGGCTTCATTCCAAGTCCACTCAGATTGGAGAAC...AAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGGCTCGGA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000637330.1
ENST00000637436.1
3UTR CAA 90 bp TTTCTTATCAAAGTCTCCACATACACTCAACCAAGGAACTCCTTATaGTTCATTCTGCTGCCTGGCCTCTTAATATTTGAAATCAAGTCC +
Preference number: 2 (lower is better)
Translates to: FLIKVSTYTQPRNSL*FILLPGLLIFEIKS
Trigger: GGACTTGATTTCAAATATTAAGAGGCCAGGCAGCAGAATGAACAATAAGGAGTTCCTTGGTTGAGTGTATGTGGAGACTTTGATAAGAAA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636947.1
3UTR-3UTR TCA 90 bp GTTTATAAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAAAAAAGCAAAACACTTTaGATACAACAGCTGTGCCAG +
Preference number: 2 (lower is better)
Translates to: VYKLVPTGTGHLEFPAWEKSKTL*IQQLCQ
Trigger: CTGGCACAGCTGTTGTATTCAAAGTGTTTTGCTTTT...TTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTTATAAAC
39% GC, longest homopolymer 6 nt, total homopolymer stretches 10 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR TCA 90 bp ACAAAGGCAATTCCCTTGCAGTTTGTTTTGTTCCCTATGATGACTTATTTGTTAGGTCAAGAAGATTACTaGACTGGTGCATGCTTTGAG +
Preference number: 2 (lower is better)
Translates to: TKAIPLQFVLFPMMTYLLGQEDY*TGACFE
Trigger: CTCAAAGCATGCACCAGTTCAGTAATCTTCTTGACC...TAACAAATAAGTCATCATAGGGAACAAAACAAACTGCAAGGGAATTGCCTTTGT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636617.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp AACATGCAGCACTGTACACATTTGCATAGTATATTTTACCCAGCATGCCTTGTAATAAGCTTCACTAGATaGCAGAAGAATCTCACAAGC +
Preference number: 2 (lower is better)
Translates to: NMQHCTHLHSIFYPACLVISFTR*QKNLTS
Trigger: GCTTGTGAGATTCTTCTGTCATCTAGTGAAGCTTAT...TACAAGGCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp AACATGCAGCACTGTACACATTTGCATAGTATATTTTACCCAGCATGCCTTGTACCCATAGACACAGCTTaGGTAAGTAACTTACTAACA +
Preference number: 2 (lower is better)
Translates to: NMQHCTHLHSIFYPACLVPIDTA*VSNLLT
Trigger: TGTTAGTAAGTTACTTACTCAAGCTGTGTCTATGGG...TACAAGGCATGCTGGGTAAAATATACTATGCAAATGTGTACAGTGCTGCATGTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000636130.1
ENST00000636350.1
ENST00000636598.1
ENST00000636901.1
ENST00000637217.1
ENST00000637309.1
ENST00000637547.1
3UTR-3UTR TCA 90 bp CCCTTTCATTGTGATAATTTTCATCAGAGGTCATTAGACTTCGTCTTTCAATTGGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: PFHCDNFHQRSLDFVFQLVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...CAATTGAAAGACGAAGTCTAATGACCTCTGATGAAAATTATCACAATGAAAGGG
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000635738.1
ENST00000635904.1
ENST00000635930.1
ENST00000636507.1
ENST00000636664.1
ENST00000636762.1
ENST00000637007.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637330.1
ENST00000637436.1
ENST00000637491.1
ENST00000637535.1
ENST00000637550.1
ENST00000637828.1
ENST00000637956.1
ENST00000638150.1
3UTR-3UTR TCA 90 bp TCCTCATTATCAGCTAAACAGGTTCATAATGGGGTACAAACACTGAACATAAATGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: SSLSAKQVHNGVQTLNINVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...ATTTATGTTCAGTGTTTGTACCCCATTATGAACCTGTTTAGCTGATAATGAGGA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR TCA 90 bp CACTCCAACTTTAAGTGTAAATTTAGCTTCCAGCAAATAAATACCAAAGCTGGAGTAAGTGTCCTGGTATaGGTCAGGGTAATCTTCTTC +
Preference number: 2 (lower is better)
Translates to: HSNFKCKFSFQQINTKAGVSVLV*VRVIFF
Trigger: GAAGAAGATTACCCTGACTCATACCAGGACACTTAC...TCCAGCTTTGGTATTTATTTGCTGGAAGCTAAATTTACACTTAAAGTTGGAGTG
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636507.1
ENST00000636762.1
ENST00000637132.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637550.1
3UTR-3UTR GCA 90 bp GTACCACATCCTTACTATCTGACTTCAGATTCCTGGATGTATGTAGTTGTGCTCCAGTTGATTACAACATaGTCAAGTAGACTTTCTAGT +
Preference number: 2 (lower is better)
Translates to: VPHPYYLTSDSWMYVVVLQLITT*SSRLSS
Trigger: ACTAGAAAGTCTACTTGAGCATGTTGTAATCAACTG...GAGCACAACTACATACATCCAGGAATCTGAAGTCAGATAGTAAGGATGTGGTAC
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1
ENST00000636130.1
ENST00000636350.1
ENST00000636442.1
ENST00000636507.1
ENST00000636598.1
ENST00000636617.1
ENST00000636762.1
ENST00000636773.1
ENST00000636785.1
ENST00000636901.1
ENST00000637132.1
ENST00000637217.1
ENST00000637232.1
ENST00000637309.1
ENST00000637312.1
ENST00000637436.1
ENST00000637547.1
ENST00000637550.1
ENST00000637762.1
ENST00000638005.1
ENST00000638091.1
3UTR-3UTR GCA 90 bp AAATTGGTTCCAACTGGAACTGGTCATTTGGAATTTCCAGCATGGGAAATTATTTCACATAACCAGCTATaGTTGGGCCTCTCTTTACTA +
Preference number: 2 (lower is better)
Translates to: KLVPTGTGHLEFPAWEIISHNQL*LGLSLL
Trigger: TAGTAAAGAGAGGCCCAAGCATAGCTGGTTATGTGA...AATAATTTCCCATGCTGGAAATTCCAAATGACCAGTTCCAGTTGGAACCAATTT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 25 transcripts:
ENST00000539935.7
ENST00000635738.1
ENST00000635890.1
ENST00000635930.1