RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ABCC8 (Homo sapiens)

Ensembl gene IDs: ENSG00000006071

Ensembl transcript IDs: ENST00000302539.9, ENST00000389817.8, ENST00000524561.2, ENST00000525022.1, ENST00000526002.2, ENST00000526168.5, ENST00000526921.5, ENST00000527905.5, ENST00000528202.6, ENST00000528374.2, ENST00000530147.5, ENST00000531642.5, ENST00000531891.1, ENST00000531911.1, ENST00000532220.2, ENST00000532728.6, ENST00000612903.2, ENST00000635881.1, ENST00000642271.1, ENST00000642579.1, ENST00000642611.2, ENST00000642902.1, ENST00000643260.1, ENST00000643562.1, ENST00000643925.1, ENST00000644057.2, ENST00000644447.1, ENST00000644472.1, ENST00000644484.1, ENST00000644542.1, ENST00000644649.1, ENST00000644675.1, ENST00000644757.1, ENST00000644772.1, ENST00000645004.2, ENST00000645076.1, ENST00000645417.1, ENST00000645744.1, ENST00000645760.1, ENST00000645884.1, ENST00000646003.1, ENST00000646207.1, ENST00000646276.1, ENST00000646592.1, ENST00000646737.1, ENST00000646902.1, ENST00000646993.1, ENST00000647013.1, ENST00000647015.1, ENST00000647086.1, ENST00000647158.1, ENST00000682051.1, ENST00000682053.1, ENST00000682091.1, ENST00000682110.1, ENST00000682140.1, ENST00000682185.1, ENST00000682199.1, ENST00000682204.1, ENST00000682215.1, ENST00000682288.1, ENST00000682442.1, ENST00000682528.1, ENST00000682673.1, ENST00000682805.1, ENST00000682863.1, ENST00000682965.1, ENST00000683066.1, ENST00000683093.1, ENST00000683136.1, ENST00000683153.1, ENST00000683253.1, ENST00000683365.1, ENST00000683377.1, ENST00000683456.1, ENST00000683522.1, ENST00000683531.1, ENST00000683562.1, ENST00000683693.1, ENST00000683725.1, ENST00000683808.1, ENST00000684010.1, ENST00000684014.1, ENST00000684157.1, ENST00000684221.1, ENST00000684253.1, ENST00000684288.1, ENST00000684313.1, ENST00000684332.1, ENST00000684371.1, ENST00000684404.1, ENST00000684442.1, ENST00000684555.1, ENST00000684571.1, ENST00000684593.1, ENST00000684614.1, ENST00000684711.1

Found 8473 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR CCA 90 bp CAGGCTCTGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTaGACGCTTGCGGTTCACAACCCTGAGGGGCACCGCCTGGTACTT +
Preference number: 1 (lower is better)
Translates to: QALQWAGEAPTILPG*TLAVHNPEGHRLVL
Trigger: AAGTACCAGGCGGTGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGCCTG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp ACACAGCAGTTGTCAGCATCGCCATCTGCACTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGC +
Preference number: 1 (lower is better)
Translates to: TQQLSASPSALGTRL*SGPVRPRQSSRAGR
Trigger: GCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGACAACTGCTGTGT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp CTGGATCTTCCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTaGTGGGGGCCGGGCTGGGCTCAGCCACCAGGCATGGGCCACAGC +
Preference number: 1 (lower is better)
Translates to: LDLPLVWPVLWDQRW*WGPGWAQPPGMGHS
Trigger: GCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CCA 90 bp TCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGGGGCTGGGGGTaGTTTGGAGGTGAGGACCCACTGGGCTGGGAGCTGTGTAGGGAA +
Preference number: 1 (lower is better)
Translates to: SRAGRLRFTTLRGWG*FGGEDPLGWELCRE
Trigger: TTCCCTACACAGCTCCCAGCCCAGTGGGTCCTCACCTCCAAACCACCCCCAGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000646592.1
3UTR CCA 90 bp CAATCCTCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGGGGCTaGGGGTGGTTTGGAGGTGAGGACCCACTGGGCTGGGAGCTGTGT +
Preference number: 1 (lower is better)
Translates to: QSSRAGRLRFTTLRG*GWFGGEDPLGWELC
Trigger: ACACAGCTCCCAGCCCAGTGGGTCCTCACCTCCAAACCACCCCCAGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000646592.1
3UTR TCA 90 bp CCTTCCGCTGGGCGTCAAAGGCCTCGCAGAGCCGTTGGTAGTTGGTaGGGGCCCTCATGGCGATGGGCAGCTTCCCGATGGCTCGCAAGT +
Preference number: 1 (lower is better)
Translates to: PSAGRQRPRRAVGSW*GPSWRWAASRWLAS
Trigger: ACTTGCGAGCCATCGGGAAGCTGCCCATCGCCATGAGGGCCCTCACCAACTACCAACGGCTCTGCGAGGCCTTTGACGCCCAGCGGAAGG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR CCA 90 bp GATCTGGATCTTCCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATaGTGCTGGGGGCCGGGCTGGGCTCAGCCACCAGGCATGGGCCAC +
Preference number: 1 (lower is better)
Translates to: DLDLPLVWPVLWDQR*CWGPGWAQPPGMGH
Trigger: GTGGCCCATGCCTGGTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGATC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CCA 90 bp AGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGG +
Preference number: 1 (lower is better)
Translates to: RPATTGAGCRRRTGT*RRLAMGSQHAGAAW
Trigger: CCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp GTCCAGCCTCCCTCCCCCACAGGCGGTGACTGGGAAGAGTGGAGCTaGCCCTCATCTCTTGGGGTGAAGCTTCAGGTAGTGTCCTGCGCC +
Preference number: 1 (lower is better)
Translates to: VQPPSPTGGDWEEWS*PSSLGVKLQVVSCA
Trigger: GGCGCAGGACACTACCTGAAGCTTCACCCCAAGAGATGAGGGCCAGCTCCACTCTTCCCAGTCACCGCCTGTGGGGGAGGGAGGCTGGAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR CCA 90 bp GTGAGCTGTGGCCTGGAGTCTCCCTTTCTGTGCGCCACCCCTAGATaGGAGGGGCAGACCACCAGGCTCTGCCTTCATGCCCTGTCCAGC +
Preference number: 1 (lower is better)
Translates to: VSCGLESPFLCATPR*EGQTTRLCLHALSS
Trigger: GCTGGACAGGGCATGAAGGCAGAGCCTGGTGGTCTGCCCCTCCCATCTAGGGGTGGCGCACAGAAAGGGAGACTCCAGGCCACAGCTCAC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR TCA 90 bp GGCCACGAGGAACACAGGTGTGACATAGGAGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGAGCGGCTCAGGCACTCCAGCGTGGA +
Preference number: 1 (lower is better)
Translates to: GHEEHRCDIGDDGQG*DTEQGGAAQALQRG
Trigger: TCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTCGTGGCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR TCA 90 bp AGTGCCCTAGGGAAAGCCCCTGACCATTCGCAGAGAGGGAGGCCCTaGCAAAGCCCGTGTGAGCTGGGGGAGTCCAGAGTGTCGGTCTCC +
Preference number: 1 (lower is better)
Translates to: SALGKAPDHSQRGRP*QSPCELGESRVSVS
Trigger: GGAGACCGACACTCTGGACTCCCCCAGCTCACACGGGCTTTGTCAGGGCCTCCCTCTCTGCGAATGGTCAGGGGCTTTCCCTAGGGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR TCA 90 bp GTCCCAGCCTGGCCAGGGGAGACGGGTACCTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGCGGTGCAGTCTCTTGGCCACCTTCA +
Preference number: 1 (lower is better)
Translates to: VPAWPGETGTSWGLG*SGLAGCGAVSWPPS
Trigger: TGAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGAGGTACCCGTCTCCCCTGGCCAGGCTGGGAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR GCA 90 bp GTAGCCTCCCATGATCTGGACACAGCAGTTGTCAGCATCGCCATCTaGACTGGGGACCAGGCTCTGCAGTGGGCCGGTGAGGCCCCGACA +
Preference number: 1 (lower is better)
Translates to: VASHDLDTAVVSIAI*TGDQALQWAGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGACAACTGCTGTGTCCAGATCATGGGAGGCTAC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp GGGTCCAGGTTAAATCGGATGGTGCCGCTGAAGAGGACGGGGTCCTaGAGGATGATGGAGAGGCGTGAGCGCAGGGTGTGCAGCGGCAGT +
Preference number: 1 (lower is better)
Translates to: GSRLNRMVPLKRTGS*RMMERRERRVCSGS
Trigger: ACTGCCGCTGCACACCCTGCGCTCACGCCTCTCCATCATCCTGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGATTTAACCTGGACCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp GAAAGTGCTGCTGAGGACCAGGCGCCTCCCGAAGGCATGGCTGAGTaGCTGCCAGATGGCCCGGGCACCTTGAGTGCCCTGAATGTCCTT +
Preference number: 1 (lower is better)
Translates to: ESAAEDQAPPEGMAE*LPDGPGTLSALNVL
Trigger: AAGGACATTCAGGGCACTCAAGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGCCTTCGGGAGGCGCCTGGTCCTCAGCAGCACTTTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000644542.1
ENST00000646737.1
3UTR CCA 90 bp GAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATaGGATCTCAGCACGCTGGTGCAGCATGGACGACAGGTTGTCATC +
Preference number: 1 (lower is better)
Translates to: EQDAGGGQVLGAGSP*DLSTLVQHGRQVVI
Trigger: GATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTC
63% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp CTTGGTGTGGGTCTGGGTGTGCCGGGTACTTGGCTGAAGGAGAGCTaGGGGGCAGTGGTGTGTCTCTATGGGCATGGGTGTGGCAGGAGG +
Preference number: 1 (lower is better)
Translates to: LGVGLGVPGTWLKES*GAVVCLYGHGCGRR
Trigger: CCTCCTGCCACACCCATGCCCATAGAGACACACCACTGCCCCCCAGCTCTCCTTCAGCCAAGTACCCGGCACACCCAGACCCACACCAAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR CCA 90 bp CACTGGACTGGGAGCCAGGAGACTGCCTCTGCCGCCTGCCAGCTGTaGCCAGCTCTGGGCAGGTCACAGCCTTTCTCAGGGCCTCAATTT +
Preference number: 1 (lower is better)
Translates to: HWTGSQETASAACQL*PALGRSQPFSGPQF
Trigger: AAATTGAGGCCCTGAGAAAGGCTGTGACCTGCCCAGAGCTGGCCACAGCTGGCAGGCGGCAGAGGCAGTCTCCTGGCTCCCAGTCCAGTG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR CCA 90 bp AGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGATCTCAGCACGCTTCCTCCTCTTCC +
Preference number: 1 (lower is better)
Translates to: RPATTGAGCRRRTGT*RRLAMGSQHASSSS
Trigger: GGAAGAGGAGGAAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000642902.1
3UTR GCA 90 bp GGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCACTTGTCTaGACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAG +
Preference number: 1 (lower is better)
Translates to: GPNVGWHLGSGRSLV*TDEGGEDAVLPAEQ
Trigger: CTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR GCA 90 bp CTGTCAGGAAGGCTGCTGCTCCAGAAGACAGCCCCTGAGACCTTCTaGATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAG +
Preference number: 1 (lower is better)
Translates to: LSGRLLLQKTAPETF*ISPSAARRSEDLPQ
Trigger: CTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGGAGCAGCAGCCTTCCTGACAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 11 transcripts:
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp GACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTaGAGCATGGACGACAGGTTGTCATCCTCCTCGCTCTCAGCTGCC +
Preference number: 1 (lower is better)
Translates to: DRYLAQARHGISARW*SMDDRLSSSSLSAA
Trigger: GGCAGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp GCTTACACAGGGACCGGCACGCAAGTGCAGGCATGGATGTCCATTTaGCTGGGCCTTGGTGTGGGTCTGGGTGTGCCGGGTACTTGGCTG +
Preference number: 1 (lower is better)
Translates to: AYTGTGTQVQAWMSI*LGLGVGLGVPGTWL
Trigger: CAGCCAAGTACCCGGCACACCCAGACCCACACCAAGGCCCAGGCAAATGGACATCCATGCCTGCACTTGCGTGCCGGTCCCTGTGTAAGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR GCA 90 bp TCGCTGTCAGGAAGGCTGCTCCAGAAGACAGCCCCTGAGACCTTCTaGATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAG +
Preference number: 1 (lower is better)
Translates to: SLSGRLLQKTAPETF*ISPSAARRSEDLPQ
Trigger: CTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGGAGCAGCCTTCCTGACAGCGA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000645760.1
ENST00000646993.1
3UTR CCA 90 bp GCTCAGGTTCTGGATCTGGATCTTCCCTTGGTCTGGCCAGTTCTTTaGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACCA +
Preference number: 1 (lower is better)
Translates to: AQVLDLDLPLVWPVL*DQRWCWGPGWAQPP
Trigger: TGGTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CCA 90 bp GTCGTAGCGCACGCTCAGGTTCTGGATCTGGATCTTCCCTTGGTCTaGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGG +
Preference number: 1 (lower is better)
Translates to: VVAHAQVLDLDLPLV*PVLWDQRWCWGPGW
Trigger: CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CCA 90 bp GCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTaGCAGGTCACTTGTCTGCACGGACGAAGGAGGCGAAGACGCTGT +
Preference number: 1 (lower is better)
Translates to: AGVWAGSECGMALGL*QVTCLHGRRRRRRC
Trigger: ACAGCGTCTTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CCA 90 bp AACCCAGGCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTaGGCTCTGGCAGGTCACTTGTCTGCACGGACGAAGGAGGCGAAG +
Preference number: 1 (lower is better)
Translates to: NPGRGMGRVRMWDGT*ALAGHLSARTKEAK
Trigger: CTTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCCTGGGTT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CCA 90 bp GATTCCTTTTGCTGCCATCCACTGCCTGCTCAGAGCAGCCCTCCCTaGAGGCACAGGGAGGGTCAGTCATGTGGCTCCCCAACCTCCACC +
Preference number: 1 (lower is better)
Translates to: DSFCCHPLPAQSSPP*RHREGQSCGSPTST
Trigger: GGTGGAGGTTGGGGAGCCACATGACTGACCCTCCCTGTGCCTCCAGGGAGGGCTGCTCTGAGCAGGCAGTGGATGGCAGCAAAAGGAATC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000643925.1
ENST00000645744.1
ENST00000646207.1
3UTR CCA 90 bp GACCGGCACGCAAGTGCAGGCATGGATGTCCATTTGCCTGGGCCTTaGTGTGGGTCTGGGTGTGCCGGGTACTTGGCTGAAGGAGAGCTG +
Preference number: 1 (lower is better)
Translates to: DRHASAGMDVHLPGP*CGSGCAGYLAEGEL
Trigger: CAGCTCTCCTTCAGCCAAGTACCCGGCACACCCAGACCCACACCAAGGCCCAGGCAAATGGACATCCATGCCTGCACTTGCGTGCCGGTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR CCA 90 bp ACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATaGACGACAGGTTGTCATCCTCCTCGCTCTCAGCTGCCTCCTCTG +
Preference number: 1 (lower is better)
Translates to: TWRRLAMGSQHAGAA*TTGCHPPRSQLPPL
Trigger: CAGAGGAGGCAGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645884.1
ENST00000646592.1
3UTR TCA 90 bp CAGCCAGTAGTCGATGGCCACCAGGACCATGTGCTTGAGCAGCTGTaGGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAG +
Preference number: 1 (lower is better)
Translates to: QPVVDGHQDHVLEQL*EDQQRQEQDAGGGQ
Trigger: CTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCTCAAGCACATGGTCCTGGTGGCCATCGACTACTGGCTG
61% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp TCCTCCTCGCTCTCAGCTGCCTCCTCTTCCTCCTCTTCCTCATCCTaGAGAAGGCCATCCCTCGAGGACATGGCACGAGATAGGCCCTGG +
Preference number: 1 (lower is better)
Translates to: SSSLSAASSSSSSSS*RRPSLEDMARDRPW
Trigger: CCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATGGCCTTCTGCAGGATGAGGAAGAGGAGGAAGAGGAGGCAGCTGAGAGCGAGGAGGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000643562.1
ENST00000644542.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp CCACACTCACTCATTACCACCTGCCACCGTGTCTGCCTCAGCAACTaGCCTGGTGCGAGGGCAGAGGAAGTGAAGGAGCACTGGACTGGG +
Preference number: 1 (lower is better)
Translates to: PHSLITTCHRVCLSN*PGARAEEVKEHWTG
Trigger: CCCAGTCCAGTGCTCCTTCACTTCCTCTGCCCTCGCACCAGGGCAGTTGCTGAGGCAGACACGGTGGCAGGTGGTAATGAGTGAGTGTGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR GCA 90 bp GGTGGCCATGTGCCACACTCACTCATTACCACCTGCCACCGTGTCTaGCTCAGCAACTGCCCTGGTGCGAGGGCAGAGGAAGTGAAGGAG +
Preference number: 1 (lower is better)
Translates to: GGHVPHSLITTCHRV*LSNCPGARAEEVKE
Trigger: CTCCTTCACTTCCTCTGCCCTCGCACCAGGGCAGTTGCTGAGGCAGACACGGTGGCAGGTGGTAATGAGTGAGTGTGGCACATGGCCACC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR CCA 90 bp ACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATaGACGACAGGTTGTCATCCTCCTCGCTCTCAGCTGCCTCCTCTT +
Preference number: 1 (lower is better)
Translates to: TWRRLAMGSQHAGAA*TTGCHPPRSQLPPL
Trigger: AAGAGGAGGCAGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000643562.1
ENST00000644542.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp GAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTaGTGCAGCATGGACGACAGGTTGTCATCCTCCTCGCTCTCAGCT +
Preference number: 1 (lower is better)
Translates to: EDRYLAQARHGISAR*CSMDDRLSSSSLSA
Trigger: AGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp AAAGCCCGTGTGAGCTGGGGGAGTCCAGAGTGTCGGTCTCCTTGGTaGATGAGTGAGAAGACAAGGCCTGAGGGCAGCACTGGGGGAAGG +
Preference number: 1 (lower is better)
Translates to: KARVSWGSPECRSPW*MSEKTRPEGSTGGR
Trigger: CCTTCCCCCAGTGCTGCCCTCAGGCCTTGTCTTCTCACTCATCCACCAAGGAGACCGACACTCTGGACTCCCCCAGCTCACACGGGCTTT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR CCA 90 bp GTCGTTCTCCTTCCCAAGGTGGTCCACGATCCCAAAGATGCACAGTaGCCCGGCGAAGCCCAGCAGGTCGGCCAAGATGCGGAAAGTGCT +
Preference number: 1 (lower is better)
Translates to: VVLLPKVVHDPKDAQ*PGEAQQVGQDAESA
Trigger: AGCACTTTCCGCATCTTGGCCGACCTGCTGGGCTTCGCCGGGCCACTGTGCATCTTTGGGATCGTGGACCACCTTGGGAAGGAGAACGAC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000644542.1
ENST00000646737.1
3UTR GCA 90 bp TGTCCACCATGCGGAAGAAGGCAAGAGAGAAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCCCGATCTGGAAAGAGAGAAGCAGGC +
Preference number: 1 (lower is better)
Translates to: CPPCGRRQERRRTSH*RCGRRSRSGKREAG
Trigger: GCCTGCTTCTCTCTTTCCAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCTCTCTTGCCTTCTTCCGCATGGTGGACA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR GCA 90 bp TGTCTCTCCTCTGGTAGGAGCCAGTTCATGCCCAGCTCCCACATCTaGCCTTTAGGGGGCTTCCTGGGGCACTTCTCCAGCTCTTGGTCC +
Preference number: 1 (lower is better)
Translates to: CLSSGRSQFMPSSHI*PLGGFLGHFSSSWS
Trigger: GGACCAAGAGCTGGAGAAGTGCCCCAGGAAGCCCCCTAAAGGGCAGATGTGGGAGCTGGGCATGAACTGGCTCCTACCAGAGGAGAGACA
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000646207.1
3UTR GCA 90 bp GACAGCAGATTCACGAAGGGCTGCAGGAAGCGTACCCCCAGGTCTTaGAGGTCCTCGGGAGGCTTCACCTCCCTCGGTGTCTTGAAGAAG +
Preference number: 1 (lower is better)
Translates to: DSRFTKGCRKRTPRS*RSSGGFTSLGVLKK
Trigger: CTTCTTCAAGACACCGAGGGAGGTGAAGCCTCCCGAGGACCTGCAAGACCTGGGGGTACGCTTCCTGCAGCCCTTCGTGAATCTGCTGTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR GCA 90 bp GGGTACCTCATGGGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTaGAGTCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACA +
Preference number: 1 (lower is better)
Translates to: GYLMGARMIRFSRLR*SLLATFSPVHSTVT
Trigger: TGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGAGGTACCC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR CCA 90 bp CTGACCATTCGCAGAGAGGGAGGCCCTGACAAAGCCCGTGTGAGCTaGGGGAGTCCAGAGTGTCGGTCTCCTTGGTGGATGAGTGAGAAG +
Preference number: 1 (lower is better)
Translates to: LTIRREGGPDKARVS*GSPECRSPWWMSEK
Trigger: CTTCTCACTCATCCACCAAGGAGACCGACACTCTGGACTCCCCCAGCTCACACGGGCTTTGTCAGGGCCTCCCTCTCTGCGAATGGTCAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR TCA 90 bp ACTTGTCTGCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTaGGCAGCTTCTCTGGCTTATCGAACTCAAGGATGGCACCCCGCT +
Preference number: 1 (lower is better)
Translates to: TCLHGRRRRRRCPSG*AASLAYRTQGWHPA
Trigger: AGCGGGGTGCCATCCTTGAGTTCGATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGCAGACAAGT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000526168.5
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR GCA 90 bp AGGACGGGGTCCTGCAGGATGATGGAGAGGCGTGAGCGCAGGGTGTaGAGCGGCAGTTTGGCGATGTCAATGCCATCAATGATGATGTGC +
Preference number: 1 (lower is better)
Translates to: RTGSCRMMERRERRV*SGSLAMSMPSMMMC
Trigger: GCACATCATCATTGATGGCATTGACATCGCCAAACTGCCGCTGCACACCCTGCGCTCACGCCTCTCCATCATCCTGCAGGACCCCGTCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp CTGGTGCAGCATGGACGACAGGTTGTCATCCTCCTCGCTCTCAGCTaGCTCCTCTGCAGGCCGCAAGAACCCACTCTGTGGCTACACATT +
Preference number: 1 (lower is better)
Translates to: LVQHGRQVVILLALS*LLCRPQEPTLWLHI
Trigger: AATGTGTAGCCACAGAGTGGGTTCTTGCGGCCTGCAGAGGAGGCAGCTGAGAGCGAGGAGGATGACAACCTGTCGTCCATGCTGCACCAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645884.1
ENST00000646592.1
3UTR CCA 90 bp GACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAGCTTCTCTaGCTTATCGAACTCAAGGATGGCACCCCGCTTCAGGACGATCAC +
Preference number: 1 (lower is better)
Translates to: DEGGEDAVLPAEQLL*LIELKDGTPLQDDH
Trigger: GTGATCGTCCTGAAGCGGGGTGCCATCCTTGAGTTCGATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000526168.5
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CCA 90 bp GTTAGAAAACCCAGGCAGGGGTATGGGCAGGGTCCGAATGTGGGATaGCACTTGGGCTCTGGCAGGTCACTTGTCTGCACGGACGAAGGA +
Preference number: 1 (lower is better)
Translates to: VRKPRQGYGQGPNVG*HLGSGRSLVCTDEG
Trigger: TCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCCTGGGTTTTCTAAC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000531642.5
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000646003.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CCA 90 bp TCCTGCAGAAGGCCATCCCTCGAGGACATGGCACGAGATAGGCCCTaGGGTGGCTCTGTGGCTTTTCTCTCTGTGACAGTCTCCTTCTCC +
Preference number: 1 (lower is better)
Translates to: SCRRPSLEDMARDRP*GGSVAFLSVTVSFS
Trigger: GGAGAAGGAGACTGTCACAGAGAGAAAAGCCACAGAGCCACCCCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATGGCCTTCTGCAGGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000645760.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR TCA 90 bp CAGCTTCAGCTGGGCGATTTCCAGGGCCTCCCACAGTGTGCTATCTaGGCACTTCCTCTCAGGGTCCAGGTTAAATCGGATGGTGCCGCT +
Preference number: 1 (lower is better)
Translates to: QLQLGDFQGLPQCAI*ALPLRVQVKSDGAA
Trigger: AGCGGCACCATCCGATTTAACCTGGACCCTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAATCGCCCAGCTGAAGCTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR TCA 90 bp CAGCTACTCCTTCCTTCCAGCTTCCCAGTACCTGCCAGGGTCCCATaGGACAGGGGTGTCACCTTCCTCAAGGCTGAAGACACAGAGGAC +
Preference number: 1 (lower is better)
Translates to: QLLLPSSFPVPARVP*DRGVTFLKAEDTED
Trigger: GTCCTCTGTGTCTTCAGCCTTGAGGAAGGTGACACCCCTGTCTCATGGGACCCTGGCAGGTACTGGGAAGCTGGAAGGAAGGAGTAGCTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR GCA 90 bp AGCAGAGAGCTCCCTGTGCAGGGAGTTGGAGATGGAGGTCACCGCTaGGATGAGCACCACACATGCACCGATGTACTCCATTCGGACTTC +
Preference number: 1 (lower is better)
Translates to: SRELPVQGVGDGGHR*DEHHTCTDVLHSDF
Trigger: GAAGTCCGAATGGAGTACATCGGTGCATGTGTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTCTGCT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644447.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR GCA 90 bp ATCGAACTCAAGGATGGCACCCCGCTTCAGGACGATCACCAGGTCTaGACTCAGGATGGTGTGCACTCGATGCGCGATGGTGACCACAGT +
Preference number: 1 (lower is better)
Translates to: IELKDGTPLQDDHQV*TQDGVHSMRDGDHS
Trigger: ACTGTGGTCACCATCGCGCATCGAGTGCACACCATCCTGAGTGCAGACCTGGTGATCGTCCTGAAGCGGGGTGCCATCCTTGAGTTCGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000526168.5
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR GCA 90 bp TGCTCCTCACGGATCTCTGCACTGGACAGGAACTCGCTTAGCTTTTaGACGCTGCTCGGGAAGCACAGAGACACCCCTCACCCTATGAGG +
Preference number: 1 (lower is better)
Translates to: CSSRISALDRNSLSF*TLLGKHRDTPHPMR
Trigger: CCTCATAGGGTGAGGGGTGTCTCTGTGCTTCCCGAGCAGCGTGCAAAAGCTAAGCGAGTTCCTGTCCAGTGCAGAGATCCGTGAGGAGCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000644757.1
3UTR CCA 90 bp TTACAGTTAGAAAACCCAGGCAGGGGTATGGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTGGCAGGTCACTTGTCTGCACGGACG +
Preference number: 1 (lower is better)
Translates to: LQLENPGRGMGRVRM*DGTWALAGHLSART
Trigger: CGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCCTGGGTTTTCTAACTGTAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000531642.5
ENST00000643562.1
ENST00000644484.1
ENST00000646003.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CCA 90 bp CACCATCCAGTTGAGGTAGTTGGAGACCTGTGGGGAGCAAGCCAGTaGCGCACACTCCATGGTCGCTTAGTTCTGTCCTCAGCCACCAGA +
Preference number: 1 (lower is better)
Translates to: HHPVEVVGDLWGASQ*RTLHGRLVLSSATR
Trigger: TCTGGTGGCTGAGGACAGAACTAAGCGACCATGGAGTGTGCGCCACTGGCTTGCTCCCCACAGGTCTCCAACTACCTCAACTGGATGGTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000643925.1
ENST00000645744.1
ENST00000646207.1
3UTR CCA 90 bp GTCTGCCAGGTTCCTCACCATCCAGTTGAGGTAGTTGGAGACCTGTaGGGAGCAAGCCAGTGGCGCACACTCCATGGTCGCTTAGTTCTG +
Preference number: 1 (lower is better)
Translates to: VCQVPHHPVEVVGDL*GASQWRTLHGRLVL
Trigger: CAGAACTAAGCGACCATGGAGTGTGCGCCACTGGCTTGCTCCCCACAGGTCTCCAACTACCTCAACTGGATGGTGAGGAACCTGGCAGAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000643925.1
ENST00000645744.1
ENST00000646207.1
3UTR CCA 90 bp AGAAATTGTGTCTTGGGCTGGAAGACGTCGTTCTCCTTCCCAAGGTaGTCCACGATCCCAAAGATGCACAGTGGCCCGGCGAAGCCCAGC +
Preference number: 1 (lower is better)
Translates to: RNCVLGWKTSFSFPR*STIPKMHSGPAKPS
Trigger: GCTGGGCTTCGCCGGGCCACTGTGCATCTTTGGGATCGTGGACCACCTTGGGAAGGAGAACGACGTCTTCCAGCCCAAGACACAATTTCT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000644542.1
ENST00000646737.1
3UTR TCA 90 bp GGTCAGCCTTCCTGCCCGCACTGTCCCTCTGGCATCAGATGCAAATaGAATTGGGGTAAGGCCTGGGAGTGTCTCATGTCTCCAGTGACG +
Preference number: 1 (lower is better)
Translates to: GQPSCPHCPSGIRCK*NWGKAWECLMSPVT
Trigger: CGTCACTGGAGACATGAGACACTCCCAGGCCTTACCCCAATTTCATTTGCATCTGATGCCAGAGGGACAGTGCGGGCAGGAAGGCTGACC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000643925.1
ENST00000645744.1
ENST00000646207.1
3UTR TCA 90 bp GTTCTCTGGCCATGGGTAAGGACAAGCCAGCCCTCCATAGAGGCATaGCAGGCTCTTGCTTTCAAGGAGGCAGAGCTACTTCAGAGGCCC +
Preference number: 1 (lower is better)
Translates to: VLWPWVRTSQPSIEA*QALAFKEAELLQRP
Trigger: GGGCCTCTGAAGTAGCTCTGCCTCCTTGAAAGCAAGAGCCTGTCATGCCTCTATGGAGGGCTGGCTTGTCCTTACCCATGGCCAGAGAAC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR TCA 90 bp GGTGAAGCTTCAGGTAGTGTCCTGCGCCCACCTTCAGCCAGAGCCTaGGCTGCCTCACTGAAAAGGCCTCTGCTACTCTGGTGTTCCATT +
Preference number: 1 (lower is better)
Translates to: GEASGSVLRPPSARA*AASLKRPLLLWCSI
Trigger: AATGGAACACCAGAGTAGCAGAGGCCTTTTCAGTGAGGCAGCTCAGGCTCTGGCTGAAGGTGGGCGCAGGACACTACCTGAAGCTTCACC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR TCA 90 bp GACAAGCCATCCCACCCTCAAGGCAAGGTTATTCTGGGGTGTAAGTaGGCTGTGGCCTGGAGTCTCCCTTTCTGTGCGCCACCCCTAGAT +
Preference number: 1 (lower is better)
Translates to: DKPSHPQGKVILGCK*AVAWSLPFCAPPLD
Trigger: ATCTAGGGGTGGCGCACAGAAAGGGAGACTCCAGGCCACAGCTCACTTACACCCCAGAATAACCTTGCCTTGAGGGTGGGATGGCTTGTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR GCA 90 bp AAAAACCTCATGGGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTaGAGTCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACA +
Preference number: 1 (lower is better)
Translates to: KNLMGARMIRFSRLR*SLLATFSPVHSTVT
Trigger: TGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGAGGTTTTT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp ACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGCCTaGATTAAGTGGTCACTCAGATGGATATCCAGAGCTGAGAAGGGG +
Preference number: 1 (lower is better)
Translates to: TTVLLSSRSSSRMPA*IKWSLRWISRAEKG
Trigger: CCCCTTCTCAGCTCTGGATATCCATCTGAGTGACCACTTAATGCAGGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp ATCGAACTCAAGGATGGCACCCCGCTTCAGGACGATCACCAGGTCTaGACTCAGGATGGTGTGCACTCGATGCGTGGCCATGTCAATGGA +
Preference number: 1 (lower is better)
Translates to: IELKDGTPLQDDHQV*TQDGVHSMRGHVNG
Trigger: TCCATTGACATGGCCACGCATCGAGTGCACACCATCCTGAGTGCAGACCTGGTGATCGTCCTGAAGCGGGGTGCCATCCTTGAGTTCGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000643925.1
3UTR CCA 90 bp AGCTGGCATTCAGACCTCTGGAAGTCCTTGAGGGTACCCTCCCTCTaGATGGTGCCATCCTTCATGGCAATGATCCAGTCTGCATGGGGC +
Preference number: 1 (lower is better)
Translates to: SWHSDLWKSLRVPSL*MVPSFMAMIQSAWG
Trigger: GCCCCATGCAGACTGGATCATTGCCATGAAGGATGGCACCATCCAGAGGGAGGGTACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp CTAGTTTCTCTTTGGACACCACAGGTTTGGGCTTGTTTCCTGCAGTaGGTCCAGAGAGGGCTTACACAGGGACCGGCACGCAAGTGCAGG +
Preference number: 1 (lower is better)
Translates to: LVSLWTPQVWACFLQ*VQRGLTQGPARKCR
Trigger: CCTGCACTTGCGTGCCGGTCCCTGTGTAAGCCCTCTCTGGACCCACTGCAGGAAACAAGCCCAAACCTGTGGTGTCCAAAGAGAAACTAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR CCA 90 bp GCTGGTCAGGGACTATGTGATGAGCACAGCACTGGAATGAGGAGGTaGCCATGTGCCACACTCACTCATTACCACCTGCCACCGTGTCTG +
Preference number: 1 (lower is better)
Translates to: AGQGLCDEHSTGMRR*PCATLTHYHLPPCL
Trigger: CAGACACGGTGGCAGGTGGTAATGAGTGAGTGTGGCACATGGCCACCTCCTCATTCCAGTGCTGTGCTCATCACATAGTCCCTGACCAGC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR TCA 90 bp CAGCTTCAGCTGGGCGATTTCCAGGGCCTCCCACAGTGTGCTATCTaGGCACTTCCTCTCAGGGTCCAGGTTAAATCTGGAAGTGGCACA +
Preference number: 1 (lower is better)
Translates to: QLQLGDFQGLPQCAI*ALPLRVQVKSGSGT
Trigger: TGTGCCACTTCCAGATTTAACCTGGACCCTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAATCGCCCAGCTGAAGCTG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000531642.5
3UTR TCA 90 bp GTCACACAGCTGGTCAGGGACTATGTGATGAGCACAGCACTGGAATaGGGAGGTGGCCATGTGCCACACTCACTCATTACCACCTGCCAC +
Preference number: 1 (lower is better)
Translates to: VTQLVRDYVMSTALE*GGGHVPHSLITTCH
Trigger: GTGGCAGGTGGTAATGAGTGAGTGTGGCACATGGCCACCTCCTCATTCCAGTGCTGTGCTCATCACATAGTCCCTGACCAGCTGTGTGAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR CCA 90 bp CTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGCCTGCATTAAGTaGTCACTCAGATGGATATCCAGAGCTGAGAAGGGGTCATCCAAG +
Preference number: 1 (lower is better)
Translates to: LLSSRSSSRMPACIK*SLRWISRAEKGSSK
Trigger: CTTGGATGACCCCTTCTCAGCTCTGGATATCCATCTGAGTGACCACTTAATGCAGGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp TCTTGGTCCTGTCGGTTCATGAGGGTCTTCCAGTGCTCAAAGAGCTaGCATTCAGACCTCTGGAAGTCCTTGAGGGTACCCTCCCTCTGG +
Preference number: 1 (lower is better)
Translates to: SWSCRFMRVFQCSKS*HSDLWKSLRVPSLW
Trigger: CCAGAGGGAGGGTACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGACAGGACCAAGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR TCA 90 bp ACCTGCCAGGGTCCCATGAGACAGGGGTGTCACCTTCCTCAAGGCTaGAGACACAGAGGACATTTGTTACTGACTGGTTCTCTGGCCATG +
Preference number: 1 (lower is better)
Translates to: TCQGPMRQGCHLPQG*RHRGHLLLTGSLAM
Trigger: CATGGCCAGAGAACCAGTCAGTAACAAATGTCCTCTGTGTCTTCAGCCTTGAGGAAGGTGACACCCCTGTCTCATGGGACCCTGGCAGGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR GCA 90 bp TCACTAAGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATaGCGGCCTGCATTAAGTGGTCACTCAGATGGATATCCAGAGCTG +
Preference number: 1 (lower is better)
Translates to: SLRPLSSCRPGAAQG*RPALSGHSDGYPEL
Trigger: CAGCTCTGGATATCCATCTGAGTGACCACTTAATGCAGGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp TCGGGGGATACGAATGGTGATGTTGGACAGTGTGGGGATTCCATCTaGGGTCCACGTGAAGTAGCCTCCCATGATCTGGACACAGCAGTT +
Preference number: 1 (lower is better)
Translates to: SGDTNGDVGQCGDSI*GPREVASHDLDTAV
Trigger: AACTGCTGTGTCCAGATCATGGGAGGCTACTTCACGTGGACCCCAGATGGAATCCCCACACTGTCCAACATCACCATTCGTATCCCCCGA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp TTCATGAGGGTCTTCCAGTGCTCAAAGAGCTGGCATTCAGACCTCTaGAAGTCCTTGAGGGTACCCTCCCTCTGGATGGTGCCATCCTTC +
Preference number: 1 (lower is better)
Translates to: FMRVFQCSKSWHSDL*KSLRVPSLWMVPSF
Trigger: GAAGGATGGCACCATCCAGAGGGAGGGTACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR TCA 90 bp TGCATGGATGTGTCTGTGTGCCCCGCCCTACAATGGAGCCACCTCTaGTCCCGTTGCTTCCTGGCACTTGGGTACCAACAGAAATTACAA +
Preference number: 1 (lower is better)
Translates to: CMDVSVCPALQWSHL*SRCFLALGYQQKLQ
Trigger: TTGTAATTTCTGTTGGTACCCAAGTGCCAGGAAGCAACGGGATCAGAGGTGGCTCCATTGTAGGGCGGGGCACACAGACACATCCATGCA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR TCA 90 bp GCGGCTATTCCTACCCTCTCCCCTGTCCAGATTTCCCTGTGGACCTaGGGAAGCACTGGAAGCTTCACTCTTCTAGTTCATTCTCTCCCA +
Preference number: 1 (lower is better)
Translates to: AAIPTLSPVQISLWT*GSTGSFTLLVHSLP
Trigger: TGGGAGAGAATGAACTAGAAGAGTGAAGCTTCCAGTGCTTCCTCAGGTCCACAGGGAAATCTGGACAGGGGAGAGGGTAGGAATAGCCGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR TCA 90 bp ATTTCACAGGTAAGGAAGCAGGCTTTTGCTCACACAGCTTCTGCCTaGTGTCAGAGCCAGGCTGGTTCTACTGAACCCACCATCCACCGC +
Preference number: 1 (lower is better)
Translates to: ISQVRKQAFAHTASA*CQSQAGSTEPTIHR
Trigger: GCGGTGGATGGTGGGTTCAGTAGAACCAGCCTGGCTCTGACATCAGGCAGAAGCTGTGTGAGCAAAAGCCTGCTTCCTTACCTGTGAAAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000643562.1
ENST00000644772.1
3UTR GCA 90 bp CCAATCTGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTaGAGAGAGCAGGCTTCAATGACCATCTTGTACCGTTGTTTGTTG +
Preference number: 1 (lower is better)
Translates to: PIWVWSPWGRMSMSG*REQASMTILYRCLL
Trigger: CAACAAACAACGGTACAAGATGGTCATTGAAGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCAGATTGG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp TCCTTCTCCAGCTCTTGGTCCTGTCGGTTCATGAGGGTCTTCCAGTaGTCAAAGAGCTGGCATTCAGACCTCTGGAAGTCCTTGAGGGTA +
Preference number: 1 (lower is better)
Translates to: SFSSSWSCRFMRVFQ*SKSWHSDLWKSLRV
Trigger: TACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGACAGGACCAAGAGCTGGAGAAGGA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000645760.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR GCA 90 bp CTCTTCTCCAGCTCTTGGTCCTGTCGGTTCATGAGGGTCTTCCAGTaGTCAAAGAGCTGGCATTCAGACCTCTGGAAGTCCTTGAGGGTA +
Preference number: 1 (lower is better)
Translates to: LFSSSWSCRFMRVFQ*SKSWHSDLWKSLRV
Trigger: TACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGACAGGACCAAGAGCTGGAGAAGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000645744.1
ENST00000646003.1
3UTR GCA 90 bp CACTTCTCCAGCTCTTGGTCCTGTCGGTTCATGAGGGTCTTCCAGTaGTCAAAGAGCTGGCATTCAGACCTCTGGAAGTCCTTGAGGGTA +
Preference number: 1 (lower is better)
Translates to: HFSSSWSCRFMRVFQ*SKSWHSDLWKSLRV
Trigger: TACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGACAGGACCAAGAGCTGGAGAAGTG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646207.1
3UTR GCA 90 bp AGAGCCAGGCTGGTTCTACTGAACCCACCATCCACCGCCAGCCCCTaGCCACCAGACTTAGGGCCTCTAGTAGGAAATAATCAAATCTAT +
Preference number: 1 (lower is better)
Translates to: RARLVLLNPPSTASP*PPDLGPLVGNNQIY
Trigger: ATAGATTTGATTATTTCCTACTAGAGGCCCTAAGTCTGGTGGGCAGGGGCTGGCGGTGGATGGTGGGTTCAGTAGAACCAGCCTGGCTCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000643562.1
ENST00000644772.1
3UTR CCA 90 bp TTCCCCAATCTGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTaGCTGCAGAGAGCAGGCTTCAATGACCATCTTGTACCGTTGTTT +
Preference number: 1 (lower is better)
Translates to: FPNLGLVSMGQDVDV*LQRAGFNDHLVPLF
Trigger: AAACAACGGTACAAGATGGTCATTGAAGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCAGATTGGGGAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CCA 90 bp CGGAGCAGCTCAAGGATGCCGGCCTGCATTAAGTGGTCACTCAGATaGATATCCAGAGCTGAGAAGGGGTCATCCAAGAAGACAACGTTG +
Preference number: 1 (lower is better)
Translates to: RSSSRMPACIKWSLR*ISRAEKGSSKKTTL
Trigger: CAACGTTGTCTTCTTGGATGACCCCTTCTCAGCTCTGGATATCCATCTGAGTGACCACTTAATGCAGGCCGGCATCCTTGAGCTGCTCCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR TCA 90 bp GGTGTCACCTTCCTCAAGGCTGAAGACACAGAGGACATTTGTTACTaGCTGGTTCTCTGGCCATGGGTAAGGACAAGCCAGCCCTCCATA +
Preference number: 1 (lower is better)
Translates to: GVTFLKAEDTEDICY*LVLWPWVRTSQPSI
Trigger: TATGGAGGGCTGGCTTGTCCTTACCCATGGCCAGAGAACCAGTCAGTAACAAATGTCCTCTGTGTCTTCAGCCTTGAGGAAGGTGACACC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR GCA 90 bp TACTTCTCCAGCTCTTGGTCCTGTCGGTTCATGAGGGTCTTCCAGTaGTCAAAGAGCTGGCATTCAGACCTCTGGAAGTCCTTGAGGGTA +
Preference number: 1 (lower is better)
Translates to: YFSSSWSCRFMRVFQ*SKSWHSDLWKSLRV
Trigger: TACCCTCAAGGACTTCCAGAGGTCTGAATGCCAGCTCTTTGAGCACTGGAAGACCCTCATGAACCGACAGGACCAAGAGCTGGAGAAGTA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644757.1
3UTR TCA 90 bp CCTGTTGTCTGGGGAAACCCAGTGGTCACATCCTCTGCAAATAGGTaGACTCCAGGAAGAGATCATGGAATCAGCAAGTGCACAGTTGGG +
Preference number: 1 (lower is better)
Translates to: PVVWGNPVVTSSANR*TPGRDHGISKCTVG
Trigger: CCCAACTGTGCACTTGCTGATTCCATGATCTCTTCCTGGAGTTCACCTATTTGCAGAGGATGTGACCACTGGGTTTCCCCAGACAACAGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR GCA 90 bp AAGAGGGAAGCAATGTTGTTGGAGTCTGTGTATTCGAGAAGCTTCTaGTGGAACCGGGCCTCATACCCCTGTAATCCCAGCACTTTGGGA +
Preference number: 1 (lower is better)
Translates to: KREAMLLESVYSRSF*WNRASYPCNPSTLG
Trigger: TCCCAAAGTGCTGGGATTACAGGGGTATGAGGCCCGGTTCCAGCAGAAGCTTCTCGAATACACAGACTCCAACAACATTGCTTCCCTCTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000644447.1
3UTR TCA 90 bp GTGCAGGTGTGGGAGGTCACAGGGTATCTTTTTGGCCTGGTTTTCTaGCTAGTTTCTCTTTGGACACCACAGGTTTGGGCTTGTTTCCTG +
Preference number: 1 (lower is better)
Translates to: VQVWEVTGYLFGLVF*LVSLWTPQVWACFL
Trigger: CAGGAAACAAGCCCAAACCTGTGGTGTCCAAAGAGAAACTAGTCAGAAAACCAGGCCAAAAAGATACCCTGTGACCTCCCACACCTGCAC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR TCA 90 bp CCCTATCAACACCAACATGGTCTAGATGGGGAAACTAAGGCCAGATaGTTGCTCAAGGTCACACAGCTGGTCAGGGACTATGTGATGAGC +
Preference number: 1 (lower is better)
Translates to: PYQHQHGLDGETKAR*LLKVTQLVRDYVMS
Trigger: GCTCATCACATAGTCCCTGACCAGCTGTGTGACCTTGAGCAATCATCTGGCCTTAGTTTCCCCATCTAGACCATGTTGGTGTTGATAGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR GCA 90 bp GTCTTAATGATACTGCCTTCTCTGGTCATTAAGAGAGATGGTCAGTaGTTGCAGAGTATGGGACAGGAGGGACCCAGAGGTACAGCCTGT +
Preference number: 1 (lower is better)
Translates to: VLMILPSLVIKRDGQ*LQSMGQEGPRGTAC
Trigger: ACAGGCTGTACCTCTGGGTCCCTCCTGTCCCATACTCTGCAAGCACTGACCATCTCTCTTAATGACCAGAGAAGGCAGTATCATTAAGAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR CCA 90 bp GATCAGTGCAACAGTTTTCAGGCAGGTGCAGCGTTCTTAAATCTGTaGTTTCTACACAGAATCATAGGGCTGGAGAGTGGGTGGTGGGAG +
Preference number: 1 (lower is better)
Translates to: DQCNSFQAGAAFLNL*FLHRIIGLESGWWE
Trigger: CTCCCACCACCCACTCTCCAGCCCTATGATTCTGTGTAGAAACCACAGATTTAAGAACGCTGCACCTGCCTGAAAACTGTTGCACTGATC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR CCA 90 bp GCAGTAGGAGGGCAAGGAACAGAAGCACAGCTAAGACGTAGGCATTaGCAAGGAACTCTTGGGATGAGACAAAGTAAACCCCGAGAAATT +
Preference number: 1 (lower is better)
Translates to: AVGGQGTEAQLRRRH*QGTLGMRQSKPREI
Trigger: AATTTCTCGGGGTTTACTTTGTCTCATCCCAAGAGTTCCTTGCCAATGCCTACGTCTTAGCTGTGCTTCTGTTCCTTGCCCTCCTACTGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000644542.1
ENST00000646737.1
3UTR TCA 90 bp GTGTTCCATTCCTGGAAACAGTGGGATCCAGAGTGTTTGAAAATATaGACGCTTTGGGATCAGTGCAACAGTTTTCAGGCAGGTGCAGCG +
Preference number: 1 (lower is better)
Translates to: VFHSWKQWDPECLKI*TLWDQCNSFQAGAA
Trigger: CGCTGCACCTGCCTGAAAACTGTTGCACTGATCCCAAAGCGTTCATATTTTCAAACACTCTGGATCCCACTGTTTCCAGGAATGGAACAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR TCA 90 bp ACCAACAGAAATTACAATACGGAGACAGATAGTGACATAGAAGGATaGGAGAGGCAGGGACAGAGGTACATCCCAAGGTCAGAGAATGAC +
Preference number: 1 (lower is better)
Translates to: TNRNYNTETDSDIEG*ERQGQRYIPRSEND
Trigger: GTCATTCTCTGACCTTGGGATGTACCTCTGTCCCTGCCTCTCTCATCCTTCTATGTCACTATCTGTCTCCGTATTGTAATTTCTGTTGGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR TCA 90 bp CTACTCTGGTGTTCCATTCCTGGAAACAGTGGGATCCAGAGTGTTTaGAAATATGAACGCTTTGGGATCAGTGCAACAGTTTTCAGGCAG +
Preference number: 1 (lower is better)
Translates to: LLWCSIPGNSGIQSV*KYERFGISATVFRQ
Trigger: CTGCCTGAAAACTGTTGCACTGATCCCAAAGCGTTCATATTTTCAAACACTCTGGATCCCACTGTTTCCAGGAATGGAACACCAGAGTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR GCA 90 bp GAAAATATGAACGCTTTGGGATCAGTGCAACAGTTTTCAGGCAGGTaGAGCGTTCTTAAATCTGTGGTTTCTACACAGAATCATAGGGCT +
Preference number: 1 (lower is better)
Translates to: ENMNALGSVQQFSGR*SVLKSVVSTQNHRA
Trigger: AGCCCTATGATTCTGTGTAGAAACCACAGATTTAAGAACGCTGCACCTGCCTGAAAACTGTTGCACTGATCCCAAAGCGTTCATATTTTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR-3UTR CCA 90 bp GCTCTGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: ALQWAGEAPTILPGWTLALRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...CGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: ATTGAGCRRRTGTWRRLALRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...GGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CAA 90 bp TGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTaGCGGTTCACAACCCTGAGGGGCACCGCCTGGTACTTGCTGGCT +
Preference number: 2 (lower is better)
Translates to: CSGPVRPRQSSRAGR*RFTTLRGTAWYLLA
Trigger: AGCCAGCAAGTACCAGGCGGTGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GTTCACAACCCTGAGGGGCACCGCCTGGTACTTGCTGGCTGGGCCCTGAGGTGTCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: VHNPEGHRLVLAGWALRCLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...ACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAGGGTTGTGAAC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GCTCTGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGGTCAGCATCGCCATCTaGACTGGGGACCAGGCTCTG +
Preference number: 2 (lower is better)
Translates to: ALQWAGEAPTILPGWTLAVSIAI*TGDQAL
Trigger: CAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGAC...CGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: GQFFGISDGAGGRAGLSHDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...GTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGGGGCTCGGGCCACACTaGTTCGCTGGCGTTGACCAC +
Preference number: 2 (lower is better)
Translates to: VWPVLWDQRWCWGPGWAQGLGPH*FAGVDH
Trigger: GTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCC...CTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGAC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 10 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGGGGCCGGGCTGGGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAAAGGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: GGRAGLSHQAWATASIRKVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...CTTTCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCCGGCCCCC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCGCATGGCTGAGTGCCTaGCAGATGGCCCGGGCACCT +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGAWLSA*QMARAP
Trigger: AGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGC...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR GCA 90 bp CAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGGAAGGCATGGCTGAGTaGCTGCCAGATGGCCCGGGC +
Preference number: 2 (lower is better)
Translates to: QQRQEQDAGGGQVLGAGSEGMAE*LPDGPG
Trigger: GCCCGGGCCATCTGGCAGGCACTCAGCCATGCCTTC...CGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR CCA 90 bp GCTGGGGGCCGGGCTGGGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: AGGRAGLSHQAWATASIRGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...TCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCCGGCCCCCAGC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646993.1
3UTR-3UTR CCA 90 bp AGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGGGGCCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: RPRQSSRAGRLRFTTLRGLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...GCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCTCTGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGACAATCCTCCCGGGCTaGACGCTTGCGGTTCACAAC +
Preference number: 2 (lower is better)
Translates to: ALQWAGEAPTILPGWTLATILPG*TLAVHN
Trigger: GTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGT...CGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGGCTGGGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAAAGTGCCACCGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: GLGSATRHGPQLVSESATDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...GGTGGCACTTTCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: RRTGTWRRLAMGSQHAGADQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...TGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGGTTCACAGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: SGPVRPRQSSRAGRLRFTGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...TGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CAA 90 bp CCTCCCGAAGGCATGGCTGAGTGCCTGCCAGATGGCCCGGGCACCTaGAGTGCCCTGAATGTCCTTCCGCTGCCCAGAGAGACCATGGCC +
Preference number: 2 (lower is better)
Translates to: PPEGMAECLPDGPGT*SALNVLPLPRETMA
Trigger: GGCCATGGTCTCTCTGGGCAGCGGAAGGACATTCAGGGCACTCAAGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGCCTTCGGGAGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR CAA 90 bp CCTCCCGAAGGCATGGCTGAGTGCCTGCCAGATGGCCCGGGCACCTaGAGTGCCCTGAATGTCCTTCCGCTGGGCGTCAAAGGCCTCGCA +
Preference number: 2 (lower is better)
Translates to: PPEGMAECLPDGPGT*SALNVLPLGVKGLA
Trigger: TGCGAGGCCTTTGACGCCCAGCGGAAGGACATTCAGGGCACTCAAGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGCCTTCGGGAGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR TCA 90 bp GGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: GAGCRRRTGTWRRLAMGSDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...AGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCTGGAGGGCCACGAGGTaGCTGCGAAGCCATCCAGCT +
Preference number: 2 (lower is better)
Translates to: EQDAGGGQVLGAGSPWDLWRATR*LRSHPA
Trigger: AGCTGGATGGCTTCGCAGTCACCTCGTGGCCCTCCA...GAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR TCA 90 bp TACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: YLAQARHGISARWCSMDDSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...GTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGGTGTCATCCAGCTGCTaGAGGTCCCTGGACGCCACC +
Preference number: 2 (lower is better)
Translates to: GGGQVLGAGSPWDLSTLVVSSSC*RSLDAT
Trigger: GGTGGCGTCCAGGGACCTGCAGCAGCTGGATGACAC...CACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACCCCCTCGTAGCTCTCTaGCTCGGTTTTCAGGAGCCC +
Preference number: 2 (lower is better)
Translates to: GQFFGISDGAGGRAGLSHPLVAL*LGFQEP
Trigger: GGGCTCCTGAAAACCGAGGCAGAGAGCTACGAGGGG...GTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCTGGGATCAGCGATGGTaGTGGGGGCCGGGCTGGGCT +
Preference number: 2 (lower is better)
Translates to: RDEAQHNAQAAEHREHHGWDQRW*WGPGWA
Trigger: AGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCA...GCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGGACGCTTGCGGTTCACAACCCTGAGGGGCACCGCCTGGTACTTGCTGGCTGGGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: WTLAVHNPEGHRLVLAGWAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...CCAGCCAGCAAGTACCAGGCGGTGCCCCTCAGGGTTGTGAACCGCAAGCGTCCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp ACAGAGCAGGGTGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: TEQGGAAQALQRGWDVLVAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...GACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTCTGT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGACCACCGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: VGVLVEGSGHTDSLALTTAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...GGTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAAC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: DRRDEAQHNAQAAEHREHLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...GTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp AGCTCCCTGTGCAGGGAGTTGGAGATGGAGGTCACCGCTGCGATGAGCACCACACTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: SSLCRELEMEVTAAMSTTLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...TGTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCTGCACAGGGAGCT
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATGGTGTTACCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: WSGSGTPAWMGCAGRWCYLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...GTAACACCATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCTGTCCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: PVHSTVTDVTRHSTMPRLLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...CAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CTTCAGCACCGGCTTCAGGGAGCTGTCGTAGCGCACGCTCAGGTTCTGGATCTGCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: LQHRLQGAVVAHAQVLDLLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...CAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTGAAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTGCAGAGAGCAGGCTCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: WVWSPWGRMSMSGCREQALGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...AGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACTTGCCGCAGCCCACCTaGCCCACGATCATAGTCAGC +
Preference number: 2 (lower is better)
Translates to: GQFFGISDGAGGRAGLSHLPQPT*PTIIVS
Trigger: GCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAA...GTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCC +
Preference number: 2 (lower is better)
Translates to: RRTGTWRRLAMGSQHAGARRTSH*RCGRRS
Trigger: GGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCT...TGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTCCTGGGCCCTGGGGCCTaGTGGTCAGCCTTCCTGCCC +
Preference number: 2 (lower is better)
Translates to: GFQEPMDALHSPQLELHVLGPGA*WSAFLP
Trigger: GGGCAGGAAGGCTGACCAGCAGGCCCCAGGGCCCAG...GACATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000643925.1
ENST00000645744.1
ENST00000646207.1
3UTR-3UTR GCA 90 bp CGGAAAGTGCTGCTGAGGACCAGGCGCCTCCCGAAGGCATGGCTGAGTGCCTGCGTCTGCCTCAGCAACTaGCCTGGTGCGAGGGCAGAG +
Preference number: 2 (lower is better)
Translates to: RKVLLRTRRLPKAWLSACVCLSN*PGARAE
Trigger: CTCTGCCCTCGCACCAGGGCAGTTGCTGAGGCAGAC...GCAGGCACTCAGCCATGCCTTCGGGAGGCGCCTGGTCCTCAGCAGCACTTTCCG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR-3UTR CCA 90 bp CTTGCCGCAGCCCACCTGCCCCACGATCATAGTCAGCTGGCCTCGGGGGATACGACCCAGGCAGGGGTATaGGCAGGGTCCGAATGTGGG +
Preference number: 2 (lower is better)
Translates to: LAAAHLPHDHSQLASGDTTQAGV*AGSECG
Trigger: CCCACATTCGGACCCTGCCCATACCCCTGCCTGGGT...CGTATCCCCCGAGGCCAGCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAAG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp AGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCGCTGCTGCAGGTCCCTaGACGCCACCCGGAAGTACT +
Preference number: 2 (lower is better)
Translates to: SNDRSRMPAEDRYLAQARAAAGP*TPPGST
Trigger: AGTACTTCCGGGTGGCGTCCAGGGACCTGCAGCAGC...GCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGGCCACAGCTAGTATCCGAAAGTGCCACCCCATCCCCAGGCTCCCTTGTGGCCCCCCAGGCTCCCTTGTaGCCCCCAACCCAGACACAC +
Preference number: 2 (lower is better)
Translates to: GPQLVSESATPSPGSLVAPQAPL*PPTQTH
Trigger: GTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGG...GGCCACAAGGGAGCCTGGGGATGGGGTGGCACTTTCGGATACTAGCTGTGGCCC
66% GC, longest homopolymer 6 nt, total homopolymer stretches 19 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TGGGCCCGTGCTCTGACCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCGATCAGCGATGGTGCTaGGGGCCGGGCTGGGCTCAG +
Preference number: 2 (lower is better)
Translates to: WARALTFCPGAMRALTCFDQRWC*GPGWAQ
Trigger: CTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATC...GAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGGTCAGAGCACGGGCCCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000527905.5
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp CTCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGGGGCACCGCCTGGTACTTCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: LPGWTLAVHNPEGHRLVLLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...AAGTACCAGGCGGTGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACAGCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: LGAGSPWDLSTLVQHGRQPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...CTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: GRGMGRVRMWDGTWALAGPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...ACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp CGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACAGGTTGTCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: RRLAMGSQHAGAAWTTGCLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...ACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTCTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: LCLGFQEPMDALHSPQLELRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...CTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAGAG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCCCCTGAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: APETFCISPSAARRSEDLLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...CAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTTCCTGATATCCAAGTCGGTCGCTGTCTCCCGCTCTGGGCTGGGGTCCTCTCCGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: LPDIQVGRCLPLWAGVLSDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...GGAGAGGACCCCAGCCCAGAGCGGGAGACAGCGACCGACTTGGATATCAGGAAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGCAGGGGCTCACCCTCAATACAAGGGTGGCCTCGCTGTCTGCCCCCAGGTCCCCATCGCCATCTGCACTaGGGACCAGGCTCTGCAGTG +
Preference number: 2 (lower is better)
Translates to: GRGSPSIQGWPRCLPPGPHRHLH*GPGSAV
Trigger: CACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATG...GGGACCTGGGGGCAGACAGCGAGGCCACCCTTGTATTGAGGGTGAGCCCCTGCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp GCTCTGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGTGTGGGGATTCCATCTaGGGTCCACGTGAAGTAGCC +
Preference number: 2 (lower is better)
Translates to: ALQWAGEAPTILPGWTLACGDSI*GPREVA
Trigger: GGCTACTTCACGTGGACCCCAGATGGAATCCCCACA...CGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
66% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: EQDAGGGQVLGAGSPWDLGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...GAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGCGCTGTCTCCCGCTCTaGGCTGGGGTCCTCTCCTAT +
Preference number: 2 (lower is better)
Translates to: PLVWPVLWDQRWCWGPGWRCLPL*AGVLSY
Trigger: ATAGGAGAGGACCCCAGCCCAGAGCGGGAGACAGCG...CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CAA 90 bp GAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTaGCCGCAGCCCACCTGCCCCACGATCATAGTCAGCTGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: ETFCISPSAARRSED*PQPTCPTIIVSWPR
Trigger: CCGAGGCCAGCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GCCTCGTCCATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGGGGTGCACTCCTGGCTaGGGGAGCAGTTCCTGGCTG +
Preference number: 2 (lower is better)
Translates to: ASSMMKMLVFLTKARARQGCTPG*GSSSWL
Trigger: CAGCCAGGAACTGCTCCCTCAGCCAGGAGTGCACCC...CTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGACGAGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGC +
Preference number: 2 (lower is better)
Translates to: AGGGQVLGAGSPWDLSTLSWGLG*SGLAGC
Trigger: GCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGA...CAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 17 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp TTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAGCCCACCGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: FCISPSAARRSEDLPQPTDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...GGTGGGCTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAA
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACCAAGGCCCGGATGGTGGTaGGTCCTTCTACGGTTTCGG +
Preference number: 2 (lower is better)
Translates to: PVLWDQRWCWGPGWAQPPRPGWW*VLLRFR
Trigger: CCGAAACCGTAGAAGGACTCACCACCATCCGGGCCT...TGGTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCCACTGCCGGTGCGGCCGCAGATCCCGATCTGGAAAGAGAGAAGCAGGCACCGAGGCCCGGATGGTGGTaGGTCCTTCTACGGTTTCGG +
Preference number: 2 (lower is better)
Translates to: PTAGAAADPDLEREKQAPRPGWW*VLLRFR
Trigger: CCGAAACCGTAGAAGGACTCACCACCATCCGGGCCT...CGGTGCCTGCTTCTCTCTTTCCAGATCGGGATCTGCGGCCGCACCGGCAGTGGG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR TCA 90 bp TCAGGGTCCAGGTTAAATCGGATGGTGCCGCTGAAGAGGACGGGGTCCTGCAGGTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: SGSRLNRMVPLKRTGSCRSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...CCTGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGATTTAACCTGGACCCTGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 10 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: VTDVTRHSTMPRLQSTVNSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...GTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCAC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CTGGGGTCCTCTCCTATCTCGCTGTCAGGAAGGCTGCTGCTCCAGAAGACAGCCTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: LGSSPISLSGRLLLQKTASAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...GGCTGTCTTCTGGAGCAGCAGCCTTCCTGACAGCGAGATAGGAGAGGACCCCAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCGCCTCTGTCCCTGGCTaGAATTCTCCCCGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGASVPG*NSPRLL
Trigger: CAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGC...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCCTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: PSPGSLVAPNPDTLLLGLLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...GAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGATGG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCGGGCTCGGGCCACACTaGTTCGCTGGCGTTGACCAC +
Preference number: 2 (lower is better)
Translates to: RPQIPIFCPGAMRALTCFGLGPH*FAGVDH
Trigger: GTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCC...GAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTGCGGCCG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAGCTTCTCTGGCATCGGATGGTGCCGCTaGAGAGGACGGGGTCCTGCA +
Preference number: 2 (lower is better)
Translates to: ARTKEAKTLSFRLSSFSGIGWCR*RGRGPA
Trigger: TGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGAT...GCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR TCA 90 bp GGCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTATCGGATGGTGCCGCTaGAGAGGACGGGGTCCTGCA +
Preference number: 2 (lower is better)
Translates to: GRGMGRVRMWDGTWALAGIGWCR*RGRGPA
Trigger: TGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGAT...ACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR TCA 90 bp GCTGGGGGCCGGGCTGGGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAGGCCCACGAAAGTTATaGGGACAGCTGCAATGGGGA +
Preference number: 2 (lower is better)
Translates to: AGGRAGLSHQAWATASIRGPRKL*GQLQWG
Trigger: TCCCCATTGCAGCTGTCCTCATAACTTTCGTGGGCC...TCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCCGGCCCCCAGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000645744.1
ENST00000645760.1
3UTR-3UTR TCA 90 bp GTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGACCACCAGACAGGGGGTGGTTTGGAGGTaGGGACCCACTGGGCTGGGA +
Preference number: 2 (lower is better)
Translates to: VLVEGSGHTDSLALTTRQGVVWR*GPTGLG
Trigger: TCCCAGCCCAGTGGGTCCTCACCTCCAAACCACCCC...CTGTCTGGTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000646592.1
3UTR-3UTR GCA 90 bp GGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACGCAGAGAGCTCCCTGTaGAGGGAGTTGGAGATGGAG +
Preference number: 2 (lower is better)
Translates to: GQFFGISDGAGGRAGLSHAESSL*RELEME
Trigger: CTCCATCTCCAACTCCCTGCACAGGGAGCTCTCTGC...GTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GAAGACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: EDNVGVLVEGSGHTDSLAAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...CGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTCTTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: DRYLAQARHGISARWCSMAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...CATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: QIPIFCPGAMRALTCFSTLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...GGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 10 transcripts:
ENST00000642902.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATGGTGTTACAGTCAGCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: GSGTPAWMGCAGRWCYSQLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...CTGACTGTAACACCATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAGCTTCTCTGGCCGTGAGCGCAGGGTGTaGAGCGGCAGTTTGGCGATG +
Preference number: 2 (lower is better)
Translates to: ARTKEAKTLSFRLSSFSGRERRV*SGSLAM
Trigger: CATCGCCAAACTGCCGCTGCACACCCTGCGCTCACG...GCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR GCA 90 bp TCCCAAGGTGGTCCACGATCCCAAAGATGCACAGTGGCCCGGCGAAGCCCAGCAGCATGGCTGAGTGCCTaGCAGATGGCCCGGGCACCT +
Preference number: 2 (lower is better)
Translates to: SQGGPRSQRCTVARRSPAAWLSA*QMARAP
Trigger: AGGTGCCCGGGCCATCTGGCAGGCACTCAGCCATGC...TGCTGGGCTTCGCCGGGCCACTGTGCATCTTTGGGATCGTGGACCACCTTGGGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000644542.1
ENST00000646737.1
3UTR-3UTR CCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCGGTCCGAATGTGGGATaGCACTTGGGCTCTGGCAGG +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGGPNVG*HLGSGR
Trigger: CCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACC...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp GGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGTCGAGGGTGCACTCCTaGCTGAGGGAGCAGTTCCTG +
Preference number: 2 (lower is better)
Translates to: GEAPTILPGWTLAVHNPESRVHS*LREQFL
Trigger: CAGGAACTGCTCCCTCAGCCAGGAGTGCACCCTCGA...CTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTTTCACAGCCCCCAGCTaGAGCTCCATGTCTGCCAGG +
Preference number: 2 (lower is better)
Translates to: GAGCRRRTGTWRRLAMGSFTAPS*SSMSAR
Trigger: CCTGGCAGACATGGAGCTCCAGCTGGGGGCTGTGAA...AGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATTCACAGCCCCCAGCTaGAGCTCCATGTCTGCCAGG +
Preference number: 2 (lower is better)
Translates to: QRQEQDAGGGQVLGAGSPFTAPS*SSMSAR
Trigger: CCTGGCAGACATGGAGCTCCAGCTGGGGGCTGTGAA...TGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACAGGTTGTCCCCAGGCTCCCTTGTaGCCCCCAACCCAGACACAC +
Preference number: 2 (lower is better)
Translates to: RRLAMGSQHAGAAWTTGCPQAPL*PPTQTH
Trigger: GTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGG...ACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 11 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCACTTTGGGATCAGCGATaGTGCTGGGGGCCGGGCTGG +
Preference number: 2 (lower is better)
Translates to: PRFSGAHGCASQPPAGAPLWDQR*CWGPGW
Trigger: CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAG...TGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACTTTGGGATCAGCGATaGTGCTGGGGGCCGGGCTGG +
Preference number: 2 (lower is better)
Translates to: QVLGAGSPWDLSTLVQHGLWDQR*CWGPGW
Trigger: CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAG...TCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: GRGMGRVRMWDGTWALAGLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...ACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp ACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: TSNDRSRMPAEDRYLAQALVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...AGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: SSCEKTSNDRSRMPAEDRPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...CCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: HSDRRDEAQHNAQAAEHRLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...ACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TCAGCACCGGCTTCAGGGAGCTGTCGTAGCGCACGCTCAGGTTCTGGATCTGGACTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: SAPASGSCRSARSGSGSGLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...TCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGTGCAGTCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: RCSLLATFSPVHSTVTDVLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...CACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTTCAGCACCGGCTTCAGGGAGCTGTCGTAGCGCACGCTCAGGTTCTGGATCTGGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: LQHRLQGAVVAHAQVLDLDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...CAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTGAAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGTAAGGCCTGGGAGTGTCTCATGTCTCCAGTGACGAAGGTGCTCCGGGAGTGCGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: GKAWECLMSPVTKVLRECDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...GCACTCCCGGAGCACCTTCGTCACTGGAGACATGAGACACTCCCAGGCCTTACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000645744.1
ENST00000646207.1
3UTR-3UTR CCA 90 bp CAGCACCGGCTTCAGGGAGCTGTCGTAGCGCACGCTCAGGTTCTGGATCTGGATGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: QHRLQGAVVAHAQVLDLDDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...ATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: DRRDEAQHNAQAAEHREHDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...GTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGGTCCTCTCCTATCTCGCTGTCAGGAAGGCTGCTGCTCCAGAAGACAGCCCCTGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: GSSPISLSGRLLLQKTAPDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...AGGGGCTGTCTTCTGGAGCAGCAGCCTTCCTGACAGCGAGATAGGAGAGGACCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAGCAGGGTGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: EQGGAAQALQRGWDVLVDSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...ATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCGGCGCAGGCTCGCCATaGGATCTCAGCACGCTGGTG +
Preference number: 2 (lower is better)
Translates to: RPQIPIFCPGAMRALTCFGAGSP*DLSTLV
Trigger: CACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCC...GAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTGCGGCCG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCCAGGGCCATAGGCAGGGGCTCACCCTCAATACAAGGGTGGCCTCGCTGTCTGCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGA +
Preference number: 2 (lower is better)
Translates to: ARAIGRGSPSIQGWPRCLRRTGT*RRLAMG
Trigger: TCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG...CAGACAGCGAGGCCACCCTTGTATTGAGGGTGAGCCCCTGCCTATGGCCCTGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp GCTTCAGCTGGGCGATTTCCAGGGCCTCCCACAGTGTGCTATCTGAGCACTTCCCACCTGTCTGGGGCCTaGGCCCTGGGGCCTGCTGGT +
Preference number: 2 (lower is better)
Translates to: ASAGRFPGPPTVCYLSTSHLSGA*ALGPAG
Trigger: ACCAGCAGGCCCCAGGGCCCAGGCCCCAGACAGGTG...GGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAATCGCCCAGCTGAAGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000643925.1
ENST00000645744.1
ENST00000646207.1
3UTR-3UTR CCA 90 bp GGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCACTGCACTCACCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: GVWAGSECGMALGLWQVTALTTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGGTGAGTGC...AGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000646592.1
3UTR-3UTR CCA 90 bp GCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCTGGGAAGAGTGGAGCTaGCCCTCATCTCTTGGGGTG +
Preference number: 2 (lower is better)
Translates to: ATTGAGCRRRTGTWRRLAWEEWS*PSSLGV
Trigger: CACCCCAAGAGATGAGGGCCAGCTCCACTCTTCCCA...GGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR-3UTR CCA 90 bp GCCCCTGAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGGGGTGGCCCAGGGTGTaGGTCCCTCCCACACTGGAA +
Preference number: 2 (lower is better)
Translates to: APETFCISPSAARRSEDLGWPRV*VPPTLE
Trigger: TTCCAGTGTGGGAGGGACCCACACCCTGGGCCACCC...CAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000646993.1
ENST00000647013.1
3UTR CAA 90 bp CGCTCAGGTTCTGGATCTGGATCTTCCCTTGGTCTGGCCAGTTCTTaGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACC +
Preference number: 2 (lower is better)
Translates to: RSGSGSGSSLGLASS*GSAMVLGAGLGSAT
Trigger: GGTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CAA 90 bp GGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCACTaGTCTGCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTG +
Preference number: 2 (lower is better)
Translates to: GRVRMWDGTWALAGH*SARTKEAKTLSFRL
Trigger: CAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CAA 90 bp AAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTaGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATG +
Preference number: 2 (lower is better)
Translates to: KTSNDRSRMPAEDRY*AQARHGISARWCSM
Trigger: CATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR CAA 90 bp GCCCTGAATGTCCTTCCGCTGGGCGTCAAAGGCCTCGCAGAGCCGTaGGTAGTTGGTGAGGGCCCTCATGGCGATGGGCAGCTTCCCGAT +
Preference number: 2 (lower is better)
Translates to: ALNVLPLGVKGLAEP*VVGEGPHGDGQLPD
Trigger: ATCGGGAAGCTGCCCATCGCCATGAGGGCCCTCACCAACTACCAACGGCTCTGCGAGGCCTTTGACGCCCAGCGGAAGGACATTCAGGGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR TCA 90 bp CCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCGGCTTGGGTGCACTCCTGGCTaGGGGAGCAGTTCCTGGCTG +
Preference number: 2 (lower is better)
Translates to: PDLLSRGDEGIDVLQHRLGCTPG*GSSSWL
Trigger: CAGCCAGGAACTGCTCCCTCAGCCAGGAGTGCACCC...AAGCCGGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CTCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGGGGCACCGCCTGGTACTTGGCTGCAGAGCACCGTaGACACCATGGCATAGACAG +
Preference number: 2 (lower is better)
Translates to: LPGWTLAVHNPEGHRLVLGCRAP*TPWHRQ
Trigger: CTGTCTATGCCATGGTGTTCACGGTGCTCTGCAGCC...AAGTACCAGGCGGTGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGGGCTGCAGAGCACCGTaGACACCATGGCATAGACAG +
Preference number: 2 (lower is better)
Translates to: VWPVLWDQRWCWGPGWAQGCRAP*TPWHRQ
Trigger: CTGTCTATGCCATGGTGTTCACGGTGCTCTGCAGCC...CTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGC +
Preference number: 2 (lower is better)
Translates to: EQDAGGGQVLGAGSPWDLSWGLG*SGLAGC
Trigger: GCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGA...GAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCTGGAGGGCCACGAGGTGACTGCGAAGCCATCCAGCTCCGTGCATGCCCCATCTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGC +
Preference number: 2 (lower is better)
Translates to: PGGPRGDCEAIQLRACPISWGLG*SGLAGC
Trigger: GCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGA...GATGGGGCATGCACGGAGCTGGATGGCTTCGCAGTCACCTCGTGGCCCTCCAGG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000527905.5
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR TCA 90 bp GAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAGGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: ETFCISPSAARRSEDLPQDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...CTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGCCTGCATTATCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: RPLSSCRPGAAQGCRPALSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...TAATGCAGGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATGGTGTTACAGTCAGTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: GSGTPAWMGCAGRWCYSQSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...CTGACTGTAACACCATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGGCTGGGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAAAGTGCCACCGCCTCTGTCCCTGGCTaGAATTCTCCCCGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: GLGSATRHGPQLVSESATASVPG*NSPRLL
Trigger: CAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGC...GGTGGCACTTTCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGCTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: SSCEKTSNDRSRMPAEDRLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...CCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCT
63% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CTGAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCCTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: LRPSASPPVRLEGARTCRLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...GCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCGGGGGATACGAATGGTaGTGTTGGACAGTGTGGGGA +
Preference number: 2 (lower is better)
Translates to: ATTGAGCRRRTGTWRRLAGGYEW*CWTVWG
Trigger: TCCCCACACTGTCCAACATCACCATTCGTATCCCCC...GGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CAGGGTGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATGGTCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: QGGAAQALQRGWDVLVDGPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...ACCATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGGGCCTCTCTTCCTGATATCCAAGTCGGTCGCTGTCTCCCGCTCTGGGCTGGGCGGGGCCTCTCTTCCTaGTATCCAAGTCGGTCGCTG +
Preference number: 2 (lower is better)
Translates to: GASLPDIQVGRCLPLWAGRGLSS*YPSRSL
Trigger: CAGCGACCGACTTGGATATCAGGAAGAGAGGCCCCG...CCCAGCCCAGAGCGGGAGACAGCGACCGACTTGGATATCAGGAAGAGAGGCCCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGACCACCAGACAGGTTaGTGCCCCGTTCCCCAATCT +
Preference number: 2 (lower is better)
Translates to: GLASSLGSAMVLGAGLGSDHQTG*CPVPQS
Trigger: AGATTGGGGAACGGGGCATCAACCTGTCTGGTGGTC...TGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 8 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGCAGGGGCTCACCCTCAATACAAGGGTGGCCTCGCTGTCTGCCCCCAGGTCCCCTGATTCGCTGGCGTTaGCCACCAGACAGGTTGATG +
Preference number: 2 (lower is better)
Translates to: GRGSPSIQGWPRCLPPGPLIRWR*PPDRLM
Trigger: CATCAACCTGTCTGGTGGTCAACGCCAGCGAATCAG...GGGACCTGGGGGCAGACAGCGAGGCCACCCTTGTATTGAGGGTGAGCCCCTGCC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR TCA 90 bp TTGAGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACGGGCTCGGGCCACACTaGTTCGCTGGCGTTGACCAC +
Preference number: 2 (lower is better)
Translates to: LSSCEKTSNDRSRMPAEDGLGPH*FAGVDH
Trigger: GTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCC...GTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCTCAA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCGGCTTCGGGGTCCTGCAGGATaGTGGAGAGGCGTGAGCGCA +
Preference number: 2 (lower is better)
Translates to: PDLLSRGDEGIDVLQHRLRGPAG*WRGVSA
Trigger: TGCGCTCACGCCTCTCCATCATCCTGCAGGACCCCG...AAGCCGGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCATCGGATGGTGCCGCTaGAGAGGACGGGGTCCTGCA +
Preference number: 2 (lower is better)
Translates to: RDEAQHNAQAAEHREHHGIGWCR*RGRGPA
Trigger: TGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGAT...GCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGACAGCTTCAGCAGCTTaGTGCCGCGGAGCATCTCGT +
Preference number: 2 (lower is better)
Translates to: GGGQVLGAGSPWDLSTLVTASAA*CRGASR
Trigger: ACGAGATGCTCCGCGGCATCAAGCTGCTGAAGCTGT...CACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR GCA 90 bp GCTCTGCAGTGGGCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGAAAATCTGTTCAGGATaGTCCCAAGGGGCGTGGTCT +
Preference number: 2 (lower is better)
Translates to: ALQWAGEAPTILPGWTLAKICSG*SQGAWS
Trigger: AGACCACGCCCCTTGGGAGCATCCTGAACAGATTTT...CGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGAGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GAGCTCCCTGTGCAGGGAGTTGGAGATGGAGGTCACCGCTGCGATGAGCACCACGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: ELPVQGVGDGGHRCDEHHVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...GTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCTGCACAGGGAGCTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp AGAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: RRRTSHCRCGRRSRSSVQVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...CTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCGCAGAGAGCTCCCTGTaGAGGGAGTTGGAGATGGAG +
Preference number: 2 (lower is better)
Translates to: EQDAGGGQVLGAGSPWDLAESSL*RELEME
Trigger: CTCCATCTCCAACTCCCTGCACAGGGAGCTCTCTGC...GAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGTGCCCCGCCCTACAATGGAGCCACCTCTGATCCCGTTGCTTCCTGGCACTTGGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: CAPPYNGATSDPVASWHLAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...CAAGTGCCAGGAAGCAACGGGATCAGAGGTGGCTCCATTGTAGGGCGGGGCACA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR GCA 90 bp GGACAGTGTGGGGATTCCATCTGGGGTCCACGTGAAGTAGCCTCCCATGATCTGCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: GQCGDSIWGPREVASHDLLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...CAGATCATGGGAGGCTACTTCACGTGGACCCCAGATGGAATCCCCACACTGTCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GTGTATTCGAGAAGCTTCTGCTGGAACCGGGCCTCATACCTGAAGGCCCGGATGCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: VYSRSFCWNRASYLKARMLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...CATCCGGGCCTTCAGGTATGAGGCCCGGTTCCAGCAGAAGCTTCTCGAATACAC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGACCACAGTGCGGTCTaGGAAGGCTGTCATCACCAC +
Preference number: 2 (lower is better)
Translates to: GCRRRTGTWRRLAMGSQHDHSAV*EGCHHH
Trigger: GTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTC...GTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGGACCACAGTGCGGTCTaGGAAGGCTGTCATCACCAC +
Preference number: 2 (lower is better)
Translates to: GGGQVLGAGSPWDLSTLVDHSAV*EGCHHH
Trigger: GTGGTGATGACAGCCTTCGCAGACCGCACTGTGGTC...CACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TCTCCCGCTCTGGGCTGGGGTCCTCTCCTATCTCGCTGTCAGGAAGGCTGCTGCTTGCCGCAGCCCACCTaGCCCACGATCATAGTCAGC +
Preference number: 2 (lower is better)
Translates to: SPALGWGPLLSRCQEGCCLPQPT*PTIIVS
Trigger: GCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAA...GCAGCAGCCTTCCTGACAGCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTTTGCCGCAGCCCACCTaGCCCACGATCATAGTCAGC +
Preference number: 2 (lower is better)
Translates to: GRGMGRVRMWDGTWALAGLPQPT*PTIIVS
Trigger: GCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAA...ACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR GCA 90 bp GACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGGCCCCTGAGACCTTCTaGATCTCCCCCAGTGCGGCT +
Preference number: 2 (lower is better)
Translates to: DNVGVLVEGSGHTDSLALAPETF*ISPSAA
Trigger: AGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGC...CAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGCCACCAGGACCATGTaGTTGAGCAGCTGTGAGAAG +
Preference number: 2 (lower is better)
Translates to: GGLPTAGAAADPDLLSRGATRTM*LSSCEK
Trigger: CTTCTCACAGCTGCTCAAGCACATGGTCCTGGTGGC...GCCCCTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTGCAGTCTCTTGGCCACCTTCGGAGCAGTTCCTGGCTaGAGGGGTCAGGGTCAGGGC +
Preference number: 2 (lower is better)
Translates to: GARMIRFSRLRCSLLATFGAVPG*RGQGQG
Trigger: GCCCTGACCCTGACCCCTGCAGCCAGGAACTGCTCC...GAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 19 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TCAGGGTCCAGGTTAAATCGGATGGTGCCGCTGAAGAGGACGGGGTCCTGCAGGAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCC +
Preference number: 2 (lower is better)
Translates to: SGSRLNRMVPLKRTGSCRRRTSH*RCGRRS
Trigger: GGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCT...CCTGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGATTTAACCTGGACCCTGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCACTTGAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCC +
Preference number: 2 (lower is better)
Translates to: GMGRVRMWDGTWALAGHLRRTSH*RCGRRS
Trigger: GGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCT...CAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR GCA 90 bp CGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCCGTGAGCGCAGGGTGTaGAGCGGCAGTTTGGCGATG +
Preference number: 2 (lower is better)
Translates to: RPQIPIFCPGAMRALTCFRERRV*SGSLAM
Trigger: CATCGCCAAACTGCCGCTGCACACCCTGCGCTCACG...GAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTGCGGCCG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTGGAAAGAGAGAAGCACCCAGGCAGGGGTATaGGCAGGGTCCGAATGTGGG +
Preference number: 2 (lower is better)
Translates to: EDFPLPVRPQIPIWKERSTQAGV*AGSECG
Trigger: CCCACATTCGGACCCTGCCCATACCCCTGCCTGGGT...GCTTCTCTCTTTCCAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000644484.1
3UTR-3UTR CCA 90 bp CTCTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGACCCAGGCAGGGGTATaGGCAGGGTCCGAATGTGGG +
Preference number: 2 (lower is better)
Translates to: LCLGFQEPMDALHSPQLETQAGV*AGSECG
Trigger: CCCACATTCGGACCCTGCCCATACCCCTGCCTGGGT...CTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAGAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp ACAATCCTCCCGGGCTGGACGCTTGCGGTTCACAACCCTGAGGGGCACCGCCTGGCACTCCAGCGTGGATaGGATGTGCTGGTCGATGGT +
Preference number: 2 (lower is better)
Translates to: TILPGWTLAVHNPEGHRLALQRG*DVLVDG
Trigger: ACCATCGACCAGCACATCCCATCCACGCTGGAGTGC...CAGGCGGTGCCCCTCAGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTGGAGGGCCACGAGGTGACTGCGAAGCCATCCAGCTCCGTGCATGCCCCATCGCACTCCAGCGTGGATaGGATGTGCTGGTCGATGGT +
Preference number: 2 (lower is better)
Translates to: PGGPRGDCEAIQLRACPIALQRG*DVLVDG
Trigger: ACCATCGACCAGCACATCCCATCCACGCTGGAGTGC...GATGGGGCATGCACGGAGCTGGATGGCTTCGCAGTCACCTCGTGGCCCTCCAGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000527905.5
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp GGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAAAGTGCCACCCCATCCGCTGCTGCAGGTCCCTaGACGCCACCCGGAAGTACT +
Preference number: 2 (lower is better)
Translates to: GSATRHGPQLVSESATPSAAAGP*TPPGST
Trigger: AGTACTTCCGGGTGGCGTCCAGGGACCTGCAGCAGC...GGATGGGGTGGCACTTTCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTGAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCGCTGCTGCAGGTCCCTaGACGCCACCCGGAAGTACT +
Preference number: 2 (lower is better)
Translates to: LRPSASPPVRLEGARTCRAAAGP*TPPGST
Trigger: AGTACTTCCGGGTGGCGTCCAGGGACCTGCAGCAGC...GCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGTTTTCAGGAGCCCATaGATGCGCTTCACAGCCCCC +
Preference number: 2 (lower is better)
Translates to: PLVWPVLWDQRWCWGPGWVFRSP*MRFTAP
Trigger: GGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAAC...CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCGTTTTCAGGAGCCCATaGATGCGCTTCACAGCCCCC +
Preference number: 2 (lower is better)
Translates to: EQDAGGGQVLGAGSPWDLVFRSP*MRFTAP
Trigger: GGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAAC...GAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTGCAGTCTCTTGGCCACCTTCCCCCAGGCTCCCTTGTaGCCCCCAACCCAGACACAC +
Preference number: 2 (lower is better)
Translates to: GARMIRFSRLRCSLLATFPQAPL*PPTQTH
Trigger: GTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGG...GAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp ATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCTTCCCCAGGCTCCCTTGTaGCCCCCAACCCAGACACAC +
Preference number: 2 (lower is better)
Translates to: IPRLPCGPQPRHTPPWTLPQAPL*PPTQTH
Trigger: GTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGG...AAGAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGAT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACAGGTTGTCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: RRLAMGSQHAGAAWTTGCLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...ACAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: DRYLAQARHGISARWCSMLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...CATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TCTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: SASVFRSPWMRFTAPSWSLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...GCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAGA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTGATATCCAAGTCGGTCGCTGTCTCCCGCTCTGGGCTGGGGTCCTCTCCTATCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: PDIQVGRCLPLWAGVLSYPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...ATAGGAGAGGACCCCAGCCCAGAGCGGGAGACAGCGACCGACTTGGATATCAGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: SVFRSPWMRFTAPSWSSMPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...CATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTGGACGCCACCCGGAAGTACTTCTGGATGAAGTAGCACACGATGGCCAGGGGCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: PGRHPEVLLDEVAHDGQGPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...CCCCTGGCCATCGTGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCGTCCAGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: LGFQEPMDALHSPQLELHPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...ATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GTCCATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: VHDEDAGLPHEGPGQAEQLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...CTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGAC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTCCCATGATCTGGACACAGCAGTTGTCAGCATCGCCATCTGCACTGGGGACCCTGAGGGGCACCGCCTaGTACTTGCTGGCTGGGCCC +
Preference number: 2 (lower is better)
Translates to: PPMIWTQQLSASPSALGTLRGTA*YLLAGP
Trigger: GGGCCCAGCCAGCAAGTACCAGGCGGTGCCCCTCAG...GGTCCCCAGTGCAGATGGCGATGCTGACAACTGCTGTGTCCAGATCATGGGAGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAGCTTCTCTGGCTTAGAAGCACCGAGGTGGTaGCAGTGGGTGGGGGACAGC +
Preference number: 2 (lower is better)
Translates to: RTKEAKTLSFRLSSFSGLEAPRW*QWVGDS
Trigger: GCTGTCCCCCACCCACTGCCACCACCTCGGTGCTTC...TAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000531642.5
3UTR-3UTR CCA 90 bp GCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAGCTTCTCTGGCACCACCAGCTTCAGCTaGGCGATTTCCAGGGCCTCC +
Preference number: 2 (lower is better)
Translates to: ARTKEAKTLSFRLSSFSGTTSFS*AISRAS
Trigger: GGAGGCCCTGGAAATCGCCCAGCTGAAGCTGGTGGT...GCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000526168.5
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp GCCAGGGCCATAGGCAGGGGCTCACCCTCAATACAAGGGTGGCCTCGCTGTCTGACCACCAGCTTCAGCTaGGCGATTTCCAGGGCCTCC +
Preference number: 2 (lower is better)
Translates to: ARAIGRGSPSIQGWPRCLTTSFS*AISRAS
Trigger: GGAGGCCCTGGAAATCGCCCAGCTGAAGCTGGTGGT...CAGACAGCGAGGCCACCCTTGTATTGAGGGTGAGCCCCTGCCTATGGCCCTGGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp GAGCAGGGTGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATACCACCAGCTTCAGCTaGGCGATTTCCAGGGCCTCC +
Preference number: 2 (lower is better)
Translates to: EQGGAAQALQRGWDVLVDTTSFS*AISRAS
Trigger: GGAGGCCCTGGAAATCGCCCAGCTGAAGCTGGTGGT...ATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: EDQQRQEQDAGGGQVLGAGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...TGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTC
63% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp ACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACAGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: TWRRLAMGSQHAGAAWTTGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...TGTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: RPQIPIFCPGAMRALTCFGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...GAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTGCGGCCG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: SSCEKTSNDRSRMPAEDRSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...CCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGCTGGGGTCCTCTCCTATCTCGCTGTCAGGAAGGCTGCTCCAGAAGACAGCCCTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: GWGPLLSRCQEGCSRRQPSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...GGGCTGTCTTCTGGAGCAGCCTTCCTGACAGCGAGATAGGAGAGGACCCCAGCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000645760.1
ENST00000646993.1
3UTR-3UTR CCA 90 bp CCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: PRFSGAHGCASQPPAGAPSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...TGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGGGGCAGGGTACCCTCCCTCTaGATGGTGCCATCCTTCATG +
Preference number: 2 (lower is better)
Translates to: GGLPTAGAAADPDLLSRGRVPSL*MVPSFM
Trigger: CATGAAGGATGGCACCATCCAGAGGGAGGGTACCCT...GCCCCTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGA +
Preference number: 2 (lower is better)
Translates to: RPQIPIFCPGAMRALTCFRRTGT*RRLAMG
Trigger: TCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG...GAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTGCGGCCG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACCCAGCCAGTAGTCGATaGCCACCAGGACCATGTGCT +
Preference number: 2 (lower is better)
Translates to: GCRRRTGTWRRLAMGSQHPASSR*PPGPCA
Trigger: AGCACATGGTCCTGGTGGCCATCGACTACTGGCTGG...GTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCCGCTGTCGGTCCACTTaGCCAGCCAGTAGTCGATGG +
Preference number: 2 (lower is better)
Translates to: PSPGSLVAPNPDTLLLGLRCRST*PASSRW
Trigger: CCATCGACTACTGGCTGGCCAAGTGGACCGACAGCG...GAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGATGG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 11 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGACGAGGCACAGCACATGCGCCACCCCTAGATaGGAGGGGCAGACCACCAGG +
Preference number: 2 (lower is better)
Translates to: ATFSPVHSTVTDVTRHSTCATPR*EGQTTR
Trigger: CCTGGTGGTCTGCCCCTCCCATCTAGGGGTGGCGCA...TGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR-3UTR CCA 90 bp CACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTCAAGTGAGGCCAGGGTaGCCCAGGGTGTGGGTCCCT +
Preference number: 2 (lower is better)
Translates to: HSDRRDEAQHNAQAAEHRQVRPG*PRVWVP
Trigger: AGGGACCCACACCCTGGGCCACCCTGGCCTCACTTG...ACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000646993.1
ENST00000647013.1
3UTR-3UTR CCA 90 bp CACACTCACTCATTACCACCTGCCACCGTGTCTGCCTCAGCAACTGCCCTGGTGGCCGCCTGCCAGCTGTaGCCAGCTCTGGGCAGGTCA +
Preference number: 2 (lower is better)
Translates to: HTHSLPPATVSASATALVAACQL*PALGRS
Trigger: TGACCTGCCCAGAGCTGGCCACAGCTGGCAGGCGGC...CACCAGGGCAGTTGCTGAGGCAGACACGGTGGCAGGTGGTAATGAGTGAGTGTG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR-3UTR CCA 90 bp CAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGGAACGCCATCCCGGCTaGCATGTACAGGTGCAGATG +
Preference number: 2 (lower is better)
Translates to: QQRQEQDAGGGQVLGAGSERHPG*HVQVQM
Trigger: CATCTGCACCTGTACATGCCAGCCGGGATGGCGTTC...CGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR CAA 90 bp GGCTTACACAGGGACCGGCACGCAAGTGCAGGCATGGATGTCCATTaGCCTGGGCCTTGGTGTGGGTCTGGGTGTGCCGGGTACTTGGCT +
Preference number: 2 (lower is better)
Translates to: GLHRDRHASAGMDVH*PGPWCGSGCAGYLA
Trigger: AGCCAAGTACCCGGCACACCCAGACCCACACCAAGGCCCAGGCAAATGGACATCCATGCCTGCACTTGCGTGCCGGTCCCTGTGTAAGCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR CAA 90 bp AAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTaGGCGCAGGCTCGCCATGGGATCTCAGCACGCTTCCTCCTCTTC +
Preference number: 2 (lower is better)
Translates to: KTSNDRSRMPAEDRY*AQARHGISARFLLF
Trigger: GAAGAGGAGGAAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000642902.1
3UTR-3UTR TCA 90 bp GCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCGGCTGCAGAGCACCGTaGACACCATGGCATAGACAG +
Preference number: 2 (lower is better)
Translates to: AGVWAGSECGMALGLWQVGCRAP*TPWHRQ
Trigger: CTGTCTATGCCATGGTGTTCACGGTGCTCTGCAGCC...GACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR TCA 90 bp TCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: SVFRSPWMRFTAPSWSSMDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...CATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: PLHSDRRDEAQHNAQAAEDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...CTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGACGAGGCACAGGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: LGHLQPCPLHSDRRDEAQDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...CTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp TGTGGGTCACTAAGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: CGSLRPLSSCRPGAAQGCSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...GCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGACCCACA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACCTCTGGAAGTCCTTGAGGGTACCCTCCCTCTGGATGGTGCCATCCTTCATGTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: DLWKSLRVPSLWMVPSFMSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...CATGAAGGATGGCACCATCCAGAGGGAGGGTACCCTCAAGGACTTCCAGAGGTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTTGGAGATGGAGGTCACCGCTGCGATGAGCACCACACATGCACCGATGTACTCTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: VGDGGHRCDEHHTCTDVLSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...GAGTACATCGGTGCATGTGTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp ACCCTCCCTCTGGATGGTGCCATCCTTCATGGCAATGATCCAGTCTGCATGGGGTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: TLPLDGAILHGNDPVCMGSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...CCCCATGCAGACTGGATCATTGCCATGAAGGATGGCACCATCCAGAGGGAGGGT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp ATTTCCAGGGCCTCCCACAGTGTGCTATCTGAGCACTTCCTCTCAGGGTCCAGGTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: ISRASHSVLSEHFLSGSRSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...CCTGGACCCTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTGGCCTCGTCCATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGGCCTCTGTCCCTGGCTaGAATTCTCCCCGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: VASSMMKMLVFLTKARARASVPG*NSPRLL
Trigger: CAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGC...CCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGACGAGGCCAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000526168.5
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCTGCCTCTGTCCCTGGCTaGAATTCTCCCCGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: HPQAPLWPPTQTHSSLDSASVPG*NSPRLL
Trigger: CAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGC...AGAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGATG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 10 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CGGTGCAGTCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGCTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: RCSLLATFSPVHSTVTDVLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...CACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CTCCCTGTGCAGGGAGTTGGAGATGGAGGTCACCGCTGCGATGAGCACCACACACTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: LPVQGVGDGGHRCDEHHTLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...TGTGTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCTGCACAGGGAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCTGGACGCCACCCGGAAGTACTTCTGGATGAAGTAGCACACGATGGCCAGGGGCTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: PGRHPEVLLDEVAHDGQGLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...CCCCTGGCCATCGTGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCGTCCAGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGGCTGGGGTCCTCTCCTATCTCGCTGTCAGGAAGGCTGCTCCAGAAGACAGCCCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: GLGSSPISLSGRLLQKTAPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...GGCTGTCTTCTGGAGCAGCCTTCCTGACAGCGAGATAGGAGAGGACCCCAGCCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000645760.1
ENST00000646993.1
3UTR-3UTR TCA 90 bp CTGAGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: LRPSASPPVRLEGARTCRPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...GCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCTCAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: DRYLAQARHGISARWCSMPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...CATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp TACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGCAGCATGGACGACCGGGGCCTCTCTTCCTaGTATCCAAGTCGGTCGCTG +
Preference number: 2 (lower is better)
Translates to: YLAQARHGISARWCSMDDRGLSS*YPSRSL
Trigger: CAGCGACCGACTTGGATATCAGGAAGAGAGGCCCCG...GTCGTCCATGCTGCACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCAATCTGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTGCAGAGAGGGGCTCGGGCCACACTaGTTCGCTGGCGTTGACCAC +
Preference number: 2 (lower is better)
Translates to: PIWVWSPWGRMSMSGCREGLGPH*FAGVDH
Trigger: GTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCC...CTCTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCAGATTGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp ATGTGCTTGAGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGGGCTCGGGCCACACTaGTTCGCTGGCGTTGACCAC +
Preference number: 2 (lower is better)
Translates to: MCLSSCEKTSNDRSRMPAGLGPH*FAGVDH
Trigger: GTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCC...CGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCTCAAGCACAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGGGTCCTGTCGGTTCATaGGGGTCTTCCAGTGCTCAA +
Preference number: 2 (lower is better)
Translates to: GGGQVLGAGSPWDLSTLVGPVGS*GSSSAQ
Trigger: TTGAGCACTGGAAGACCCTCATGAACCGACAGGACC...CACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CGGCTGAGCAGCTTCTCTGGCTTATCGAACTCAAGGATGGCACCCCGCTTCAGGCGGGGTCCTGCAGGATaGTGGAGAGGCGTGAGCGCA +
Preference number: 2 (lower is better)
Translates to: RLSSFSGLSNSRMAPRFRRGPAG*WRGVSA
Trigger: TGCGCTCACGCCTCTCCATCATCCTGCAGGACCCCG...CCTGAAGCGGGGTGCCATCCTTGAGTTCGATAAGCCAGAGAAGCTGCTCAGCCG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR TCA 90 bp GCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTATCGGATGGTGCCGCTaGAGAGGACGGGGTCCTGCA +
Preference number: 2 (lower is better)
Translates to: AVRRPATTGAGCRRRTGTIGWCR*RGRGPA
Trigger: TGCAGGACCCCGTCCTCTTCAGCGGCACCATCCGAT...AGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCCCCTGGTCAAGAAACTaGGTCAGCACAGCCGACTGT +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGPWSRN*VSTADC
Trigger: ACAGTCGGCTGTGCTGACTCAGTTTCTTGACCAGGG...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR-3UTR TCA 90 bp GGTATGGGCAGGGTCCGAATGTGGGATGGCACTTGGGCTCTGGCAGGTCACTTGCCACAAAGCCCACACTaGAGGGGGCAGACCAGTGGG +
Preference number: 2 (lower is better)
Translates to: GMGRVRMWDGTWALAGHLPQSPH*RGQTSG
Trigger: CCCACTGGTCTGCCCCCTTCAGTGTGGGCTTTGTGG...CAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR-3UTR TCA 90 bp GAGCAGGGTGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATACACCCCTCACCCTATaGGGACAGCTGCAATGGGGA +
Preference number: 2 (lower is better)
Translates to: EQGGAAQALQRGWDVLVDTPLTL*GQLQWG
Trigger: TCCCCATTGCAGCTGTCCTCATAGGGTGAGGGGTGT...ATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCACCCTGCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000644757.1
3UTR-3UTR TCA 90 bp CCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGTCACCAGCAGCCCTGTaGGGCAGAAGCGTAGCTGCG +
Preference number: 2 (lower is better)
Translates to: PLHSDRRDEAQHNAQAAESPAAL*GRSVAA
Trigger: CGCAGCTACGCTTCTGCCTCACAGGGCTGCTGGTGA...CTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR GCA 90 bp CCATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCTCCGGTTTAGCAGGCTaGGGTGCAGTCTCTTGGCCA +
Preference number: 2 (lower is better)
Translates to: PSPGSLVAPNPDTLLLGLSGLAG*GAVSWP
Trigger: TGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGA...GAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGATGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CTTCAGCACCGGCTTCAGGGAGCTGTCGTAGCGCACGCTCAGGTTCTGGATCTGGTGTCATCCAGCTGCTaGAGGTCCCTGGACGCCACC +
Preference number: 2 (lower is better)
Translates to: LQHRLQGAVVAHAQVLDLVSSSC*RSLDAT
Trigger: GGTGGCGTCCAGGGACCTGCAGCAGCTGGATGACAC...CAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCCCTGAAGCCGGTGCTGAAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCCCAATCTGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTGCAGAGGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: PQSGSGLHGAGCRCLAAEVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...CTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCAGATTGGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTCGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: GFQEPMDALHSPQLELHVVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...GACATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTGCAGTCTCTTGGCCACCTTCGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: GARMIRFSRLRCSLLATFVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...GAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCTGTCCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: PVHSTVTDVTRHSTMPRLVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...CAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp AGGTCACTTGTCTGCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: RSLVCTDEGGEDAVLPAEVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...CTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGCAGACAAGTGACCT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR GCA 90 bp TCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTGCTCACGCCTGTCCTaGAGCATTGGGTTGGGCCCG +
Preference number: 2 (lower is better)
Translates to: SVFRSPWMRFTAPSWSSMCSRLS*SIGLGP
Trigger: CGGGCCCAACCCAATGCTGCAGGACAGGCGTGAGCA...CATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000527905.5
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR GCA 90 bp ATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCTGCGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: MMKMLVFLTKARARQNSCAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...GCAGCTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCAT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GCTGGGCGATTTCCAGGGCCTCCCACAGTGTGCTATCTGAGCACTTCCTCTCAGGCACCGCCTGGTACTTaGTGGCTGGGCCCTGAGGTG +
Preference number: 2 (lower is better)
Translates to: AGRFPGPPTVCYLSTSSQAPPGT*WLGPEV
Trigger: CACCTCAGGGCCCAGCCAGCAAGTACCAGGCGGTGC...CTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGCCCTGGAAATCGCCCAGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp ATGTGCCCTTCGAACGTGTCCACCATGCGGAAGAAGGCAAGAGAGAAGGAGGACCTGGGGACCAGGCTCTaGAGTGGGCCGGTGAGGCCC +
Preference number: 2 (lower is better)
Translates to: MCPSNVSTMRKKAREKEDLGTRL*SGPVRP
Trigger: GGGCCTCACCGGCCCACTGCAGAGCCTGGTCCCCAG...GTCCTCCTTCTCTCTTGCCTTCTTCCGCATGGTGGACACGTTCGAAGGGCACAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTGTCAGCATCGCCATCTaGACTGGGGACCAGGCTCTG +
Preference number: 2 (lower is better)
Translates to: LPRFSGAHGCASQPPAGAVSIAI*TGDQAL
Trigger: CAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGAC...AGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCGTCAGCATCGCCATCTaGACTGGGGACCAGGCTCTG +
Preference number: 2 (lower is better)
Translates to: CLGFQEPMDALHSPQLELVSIAI*TGDQAL
Trigger: CAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGAC...GAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCTCATCCTGCAGAAGGCCATCCCTCGAGGACATGGCACGAGATAGGCCCTGGGGTCAGCATCGCCATCTaGACTGGGGACCAGGCTCTG +
Preference number: 2 (lower is better)
Translates to: PHPAEGHPSRTWHEIGPGVSIAI*TGDQAL
Trigger: CAGAGCCTGGTCCCCAGTGCAGATGGCGATGCTGAC...CCCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATGGCCTTCTGCAGGATGAGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGATGGTGTGCACTCGATaGGCGATGGTGACCACAGTG +
Preference number: 2 (lower is better)
Translates to: VWPVLWDQRWCWGPGWAQMVCTR*AMVTTV
Trigger: CACTGTGGTCACCATCGCGCATCGAGTGCACACCAT...CTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000643562.1
ENST00000644484.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGACGATCACCAGGTCTaGACTCAGGATGGTGTGCAC +
Preference number: 2 (lower is better)
Translates to: PLVWPVLWDQRWCWGPGWDDHQV*TQDGVH
Trigger: GTGCACACCATCCTGAGTGCAGACCTGGTGATCGTC...CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGCTGGTGGACGATCACCAGGTCTaGACTCAGGATGGTGTGCAC +
Preference number: 2 (lower is better)
Translates to: GGGQVLGAGSPWDLSTLVDDHQV*TQDGVH
Trigger: GTGCACACCATCCTGAGTGCAGACCTGGTGATCGTC...CACCAGCGTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GAAGACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGCCGCAGCCCACCTaGCCCACGATCATAGTCAGC +
Preference number: 2 (lower is better)
Translates to: EDNVGVLVEGSGHTDSLALPQPT*PTIIVS
Trigger: GCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAA...CGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTCTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCTTGCCGCAGCCCACCTaGCCCACGATCATAGTCAGC +
Preference number: 2 (lower is better)
Translates to: CLGFQEPMDALHSPQLELLPQPT*PTIIVS
Trigger: GCTGACTATGATCGTGGGGCAGGTGGGCTGCGGCAA...GAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGCCCCTGAGACCTTCTaGATCTCCCCCAGTGCGGCT +
Preference number: 2 (lower is better)
Translates to: HSDRRDEAQHNAQAAEHRAPETF*ISPSAA
Trigger: AGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGC...ACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGGAGCGGCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATGGTGTTACGCCCCTGAGACCTTCTaGATCTCCCCCAGTGCGGCT +
Preference number: 2 (lower is better)
Translates to: WSGSGTPAWMGCAGRWCYAPETF*ISPSAA
Trigger: AGCCGCACTGGGGGAGATGCAGAAGGTCTCAGGGGC...GTAACACCATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGCCGCTCCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCAGCACGGAGCAGCTCAAGGATaGCGGCCTGCATTAAGTGGT +
Preference number: 2 (lower is better)
Translates to: GCRRRTGTWRRLAMGSQHGAAQG*RPALSG
Trigger: ACCACTTAATGCAGGCCGGCATCCTTGAGCTGCTCC...GTGCTGAGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGGGAGCAGCTCAAGGATaGCGGCCTGCATTAAGTGGT +
Preference number: 2 (lower is better)
Translates to: VWPVLWDQRWCWGPGWAQGAAQG*RPALSG
Trigger: ACCACTTAATGCAGGCCGGCATCCTTGAGCTGCTCC...CTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 10 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACCAATCTCAGCACGCTGGTaGAGCATGGACGACAGGTTG +
Preference number: 2 (lower is better)
Translates to: PVLWDQRWCWGPGWAQPPISARW*SMDDRL
Trigger: CAACCTGTCGTCCATGCTGCACCAGCGTGCTGAGAT...TGGTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCCACCAGGACCATGTaGTTGAGCAGCTGTGAGAAG +
Preference number: 2 (lower is better)
Translates to: PLVWPVLWDQRWCWGPGWATRTM*LSSCEK
Trigger: CTTCTCACAGCTGCTCAAGCACATGGTCCTGGTGGC...CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp ATGTGCTTGAGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGGAGCAGTTCCTGGCTaGAGGGGTCAGGGTCAGGGC +
Preference number: 2 (lower is better)
Translates to: MCLSSCEKTSNDRSRMPAGAVPG*RGQGQG
Trigger: GCCCTGACCCTGACCCCTGCAGCCAGGAACTGCTCC...CGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCTCAAGCACAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp ATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCTGCCTCACTTCCCACTGCCGGTaGGGCCGCAGATCCCGATCT +
Preference number: 2 (lower is better)
Translates to: MKMLVFLTKARARQNSCLTSHCR*GRRSRS
Trigger: AGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGT...GAGGCAGCTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCAT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TCCATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCC +
Preference number: 2 (lower is better)
Translates to: SMMKMLVFLTKARARQNSRRTSH*RCGRRS
Trigger: GGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCT...GCTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp ATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCTGCAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCC +
Preference number: 2 (lower is better)
Translates to: MMKMLVFLTKARARQNSCRRTSH*RCGRRS
Trigger: GGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCT...GCAGCTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCAT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCAGGAGGACTTCCCACTaGCGGTGCGGCCGCAGATCC +
Preference number: 2 (lower is better)
Translates to: QIPIFCPGAMRALTCFSTRRTSH*RCGRRS
Trigger: GGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCT...GGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GCCTCCCACAGTGTGCTATCTGAGCACTTCCTCTCAGGGTCCAGGTTAAATCGGGGTGGCCTCGCTGTCTaGCCCCAGGTCCCTGCCCTG +
Preference number: 2 (lower is better)
Translates to: ASHSVLSEHFLSGSRLNRGGLAV*PQVPAL
Trigger: CAGGGCAGGGACCTGGGGGCAGACAGCGAGGCCACC...CCGATTTAACCTGGACCCTGAGAGGAAGTGCTCAGATAGCACACTGTGGGAGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000644484.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR GCA 90 bp GCCGGTGAGGCCCCGACAATCCTCCCGGGCTGGACGCTTGCGGTTCACAACCCTACGTATGAGGACAGCTaGAATGGGGATGGCCGTGTT +
Preference number: 2 (lower is better)
Translates to: AGEAPTILPGWTLAVHNPTYEDS*NGDGRV
Trigger: AACACGGCCATCCCCATTGCAGCTGTCCTCATACGT...AGGGTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGTCGGGGCCTCACCGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000646276.1
3UTR-3UTR GCA 90 bp ACACTCACTCATTACCACCTGCCACCGTGTCTGCCTCAGCAACTGCCCTGGTGCACTGCCTCTGCCGCCTaGCAGCTGTGGCCAGCTCTG +
Preference number: 2 (lower is better)
Translates to: TLTHYHLPPCLPQQLPWCTASAA*QLWPAL
Trigger: CAGAGCTGGCCACAGCTGGCAGGCGGCAGAGGCAGT...GCACCAGGGCAGTTGCTGAGGCAGACACGGTGGCAGGTGGTAATGAGTGAGTGT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000646737.1
3UTR-3UTR CCA 90 bp GGGCAAGAGGGCCACGAGGAACACAGGTGTGACATAGGAGATGACGGCCAGGGCGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: GQEGHEEHRCDIGDDGQGGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...GCCCTGGCCGTCATCTCCTATGTCACACCTGTGTTCCTCGTGGCCCTCTTGCCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp CATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCTGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: HPQAPLWPPTQTHSSLDSGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...AGAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGATG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646993.1
3UTR-3UTR CCA 90 bp GTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGACCACCAGACAGGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: VLVEGSGHTDSLALTTRQGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...CTGTCTGGTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCAC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp GAAGACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: EDNVGVLVEGSGHTDSLAGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...CGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTCTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp GTGGCCTCGTCCATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: VASSMMKMLVFLTKARARGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...CCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGACGAGGCCAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp GCGGCCGCAGATCCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTGGCAGGGTCCGAATGTaGGATGGCACTTGGGCTCTG +
Preference number: 2 (lower is better)
Translates to: AAADPDLLSRGDEGIDVLGRVRM*DGTWAL
Trigger: CAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCC...AAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGGATCTGCGGCCGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp CGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCTCGAGGGTGCACTCCTaGCTGAGGGAGCAGTTCCTG +
Preference number: 2 (lower is better)
Translates to: RDEAQHNAQAAEHREHHGSRVHS*LREQFL
Trigger: CAGGAACTGCTCCCTCAGCCAGGAGTGCACCCTCGA...GCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATCGAGGGTGCACTCCTaGCTGAGGGAGCAGTTCCTG +
Preference number: 2 (lower is better)
Translates to: PRFSGAHGCASQPPAGAPSRVHS*LREQFL
Trigger: CAGGAACTGCTCCCTCAGCCAGGAGTGCACCCTCGA...TGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTCGAGGGTGCACTCCTaGCTGAGGGAGCAGTTCCTG +
Preference number: 2 (lower is better)
Translates to: SSCEKTSNDRSRMPAEDRSRVHS*LREQFL
Trigger: CAGGAACTGCTCCCTCAGCCAGGAGTGCACCCTCGA...CCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp ATAGGCAGGGGCTCACCCTCAATACAAGGGTGGCCTCGCTGTCTGCCCCCAGGTTCGAGGGTGCACTCCTaGCTGAGGGAGCAGTTCCTG +
Preference number: 2 (lower is better)
Translates to: IGRGSPSIQGWPRCLPPGSRVHS*LREQFL
Trigger: CAGGAACTGCTCCCTCAGCCAGGAGTGCACCCTCGA...ACCTGGGGGCAGACAGCGAGGCCACCCTTGTATTGAGGGTGAGCCCCTGCCTAT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp CTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTTCGAGGGTGCACTCCTaGCTGAGGGAGCAGTTCCTG +
Preference number: 2 (lower is better)
Translates to: LPRFSGAHGCASQPPAGASRVHS*LREQFL
Trigger: CAGGAACTGCTCCCTCAGCCAGGAGTGCACCCTCGA...AGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCTGGGGGCCGGGCTGGGCTCAGCCACCAGGCATGGGCCACAGCTAGTATCCGAGTGGATGGGATGTGCTaGTCGATGGTGTTACAGTCA +
Preference number: 2 (lower is better)
Translates to: AGGRAGLSHQAWATASIRVDGMC*SMVLQS
Trigger: TGACTGTAACACCATCGACCAGCACATCCCATCCAC...TCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAGCCCAGCCCGGCCCCCAGC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGACCACCGCACTCCAGCGTGGATaGGATGTGCTGGTCGATGGT +
Preference number: 2 (lower is better)
Translates to: VGVLVEGSGHTDSLALTTALQRG*DVLVDG
Trigger: ACCATCGACCAGCACATCCCATCCACGCTGGAGTGC...GGTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAAC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGGGCACTCCAGCGTGGATaGGATGTGCTGGTCGATGGT +
Preference number: 2 (lower is better)
Translates to: EGGLPTAGAAADPDLLSRALQRG*DVLVDG
Trigger: ACCATCGACCAGCACATCCCATCCACGCTGGAGTGC...CCTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAGCCCACCGCACTCCAGCGTGGATaGGATGTGCTGGTCGATGGT +
Preference number: 2 (lower is better)
Translates to: FCISPSAARRSEDLPQPTALQRG*DVLVDG
Trigger: ACCATCGACCAGCACATCCCATCCACGCTGGAGTGC...GGTGGGCTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCGCTGCTGCAGGTCCCTaGACGCCACCCGGAAGTACT +
Preference number: 2 (lower is better)
Translates to: HSTVTDVTRHSTMPRLQSAAAGP*TPPGST
Trigger: AGTACTTCCGGGTGGCGTCCAGGGACCTGCAGCAGC...GCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCTGCTGCAGGTCCCTaGACGCCACCCGGAAGTACT +
Preference number: 2 (lower is better)
Translates to: DVTRHSTMPRLQSTVNTMAAAGP*TPPGST
Trigger: AGTACTTCCGGGTGGCGTCCAGGGACCTGCAGCAGC...CATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATGAAGTGGAAGCTGGGTaGTGTCATCCAGCTGCTGCA +
Preference number: 2 (lower is better)
Translates to: QEQDAGGGQVLGAGSPWDEVEAG*CHPAAA
Trigger: TGCAGCAGCTGGATGACACCACCCAGCTTCCACTTC...ATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTTCGAGAAGCTTCTGCTaGAACCGGGCCTCATACCTG +
Preference number: 2 (lower is better)
Translates to: GAGCRRRTGTWRRLAMGSSRSFC*NRASYL
Trigger: CAGGTATGAGGCCCGGTTCCAGCAGAAGCTTCTCGA...AGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCATCCCCAGGCTCCCTTGTGGCCCCCAACCCAGACACACTCCTCCTTGGACTCCTCAGCCACCAGGCATaGGCCACAGCTAGTATCCGA +
Preference number: 2 (lower is better)
Translates to: PSPGSLVAPNPDTLLLGLLSHQA*ATASIR
Trigger: TCGGATACTAGCTGTGGCCCATGCCTGGTGGCTGAG...GAGTCCAAGGAGGAGTGTGTCTGGGTTGGGGGCCACAAGGGAGCCTGGGGATGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CACCGCTGCGATGAGCACCACACATGCACCGATGTACTCCATTCGGACTTCCAGGATCAGCGATGGTGCTaGGGGCCGGGCTGGGCTCAG +
Preference number: 2 (lower is better)
Translates to: HRCDEHHTCTDVLHSDFQDQRWC*GPGWAQ
Trigger: CTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATC...CTGGAAGTCCGAATGGAGTACATCGGTGCATGTGTGGTGCTCATCGCAGCGGTG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTCTGCTTTGGGATCAGCGATaGTGCTGGGGGCCGGGCTGG +
Preference number: 2 (lower is better)
Translates to: FSGAHGCASQPPAGAPCLLWDQR*CWGPGW
Trigger: CCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAG...CAGACATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCCGCACGCTCAGGTTCTaGATCTGGATCTTCCCTTGG +
Preference number: 2 (lower is better)
Translates to: DQQRQEQDAGGGQVLGAGRTLRF*IWIFPW
Trigger: CCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCG...GCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCGCACGCTCAGGTTCTaGATCTGGATCTTCCCTTGG +
Preference number: 2 (lower is better)
Translates to: SNDRSRMPAEDRYLAQARRTLRF*IWIFPW
Trigger: CCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCG...GCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTGAGCAGCTTCTCTGGCTTACTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: RTKEAKTLSFRLSSFSGLLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...TAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp GTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: VTDVTRHSTMPRLQSTVNLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...GTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCAC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCCCACCTGCCCCACGATCATAGTCAGCTGGCCTCGGGGGATACGAATGGTGATCTGGTACTTGCTGGCTaGGCCCTGAGGTGTGGGCTC +
Preference number: 2 (lower is better)
Translates to: AHLPHDHSQLASGDTNGDLVLAG*ALRCGL
Trigger: GAGCCCACACCTCAGGGCCCAGCCAGCAAGTACCAG...ATCACCATTCGTATCCCCCGAGGCCAGCTGACTATGATCGTGGGGCAGGTGGGC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGTGTGAGCTGGGGGAGTCCAGAGTGTCGGTCTCCTTGGTGGATGAGTGAGAAGCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: RVSWGSPECRSPWWMSEKPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...CTTCTCACTCATCCACCAAGGAGACCGACACTCTGGACTCCCCCAGCTCACACG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000646276.1
3UTR-3UTR CCA 90 bp GACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCATACCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: DEAQHNAQAAEHREHHGIPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...TATGCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTCCCATGATCTGGACACAGCAGTTGTCAGCATCGCCATCTGCACTGGGGACCCCGCCTGGTACTTGCTaGCTGGGCCCTGAGGTGTGG +
Preference number: 2 (lower is better)
Translates to: PPMIWTQQLSASPSALGTPPGTC*LGPEVW
Trigger: CCACACCTCAGGGCCCAGCCAGCAAGTACCAGGCGG...GGTCCCCAGTGCAGATGGCGATGCTGACAACTGCTGTGTCCAGATCATGGGAGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000532728.6
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TCCAAGTCGGTCGCTGTCTCCCGCTCTGGGCTGGGGTCCTCTCCTATCTCGCTGACAATCCTCCCGGGCTaGACGCTTGCGGTTCACAAC +
Preference number: 2 (lower is better)
Translates to: SKSVAVSRSGLGSSPISLTILPG*TLAVHN
Trigger: GTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGT...CAGCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGACAGCGACCGACTTGGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGGACAATCCTCCCGGGCTaGACGCTTGCGGTTCACAAC +
Preference number: 2 (lower is better)
Translates to: EGGLPTAGAAADPDLLSRTILPG*TLAVHN
Trigger: GTTGTGAACCGCAAGCGTCCAGCCCGGGAGGATTGT...CCTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000642902.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GCTCAGGCACTCCAGCGTGGATGGGATGTGCTGGTCGATGGTGTTACAGTCAGAGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: AQALQRGWDVLVDGVTVRDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...TCTGACTGTAACACCATCGACCAGCACATCCCATCCACGCTGGAGTGCCTGAGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAGGGTACCCTCCCTCTGGATGGTGCCATCCTTCATGGCAATGATCCAGTCTGCGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: EGTLPLDGAILHGNDPVCDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...GCAGACTGGATCATTGCCATGAAGGATGGCACCATCCAGAGGGAGGGTACCCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TCAGGTTCTGGATCTGGATCTTCCCTTGGTCCAGGAGCCCCTCGTAGCTCTCTGGACCAGGCTCTGCAGTaGGCCGGTGAGGCCCCGACA +
Preference number: 2 (lower is better)
Translates to: SGSGSGSSLGPGAPRSSLDQALQ*AGEAPT
Trigger: TGTCGGGGCCTCACCGGCCCACTGCAGAGCCTGGTC...CAGAGAGCTACGAGGGGCTCCTGGACCAAGGGAAGATCCAGATCCAGAACCTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000647086.1
3UTR-3UTR CCA 90 bp AGAGAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCCATCGCCATCTGCACTaGGGACCAGGCTCTGCAGTG +
Preference number: 2 (lower is better)
Translates to: REGGLPTAGAAADPDLLSHRHLH*GPGSAV
Trigger: CACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATG...GGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCTCT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000642902.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATCGCCATCTGCACTaGGGACCAGGCTCTGCAGTG +
Preference number: 2 (lower is better)
Translates to: CLGFQEPMDALHSPQLELHRHLH*GPGSAV
Trigger: CACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATG...GAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCCATCGCCATCTGCACTaGGGACCAGGCTCTGCAGTG +
Preference number: 2 (lower is better)
Translates to: RDEAQHNAQAAEHREHHGHRHLH*GPGSAV
Trigger: CACTGCAGAGCCTGGTCCCCAGTGCAGATGGCGATG...GCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCTCATCCTGCAGAAGGCCATCCCTCGAGGACATGGCACGAGATAGGCCCTGGGACCACCAGCTTCAGCTaGGCGATTTCCAGGGCCTCC +
Preference number: 2 (lower is better)
Translates to: PHPAEGHPSRTWHEIGPGTTSFS*AISRAS
Trigger: GGAGGCCCTGGAAATCGCCCAGCTGAAGCTGGTGGT...CCCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATGGCCTTCTGCAGGATGAGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCGGCTTCGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: PIFCPGAMRALTCFSTGFGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...GAAGCCGGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645417.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTGCAGAGAGCAGGCTGGCATCGAGGCCTCCTaGCAGTGCCTTCACCACCAG +
Preference number: 2 (lower is better)
Translates to: WVWSPWGRMSMSGCREQAGIEAS*QCLHHQ
Trigger: CTGGTGGTGAAGGCACTGCCAGGAGGCCTCGATGCC...AGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp TTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAGCCCACCGGTCTGCACTCAGGATaGTGTGCACTCGATGCGCGA +
Preference number: 2 (lower is better)
Translates to: FCISPSAARRSEDLPQPTGLHSG*CALDAR
Trigger: TCGCGCATCGAGTGCACACCATCCTGAGTGCAGACC...GGTGGGCTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: DVTRHSTMPRLQSTVNTMSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...CATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCCCAATCTGGGTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTGCAGAGTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: PQSGSGLHGAGCRCLAAESPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...CTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGACCCAGATTGGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CGGTGCAGTCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: RCSLLATFSPVHSTVTDVSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...CACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp ATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCTGCCTCTCTCCCGCTCTGGGCTaGGGTCCTCTCCTATCTCGC +
Preference number: 2 (lower is better)
Translates to: MKMLVFLTKARARQNSCLSPALG*GPLLSR
Trigger: GCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGA...GAGGCAGCTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCAT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATCGCTGTCTCCCGCTCTaGGCTGGGGTCCTCTCCTAT +
Preference number: 2 (lower is better)
Translates to: LGFQEPMDALHSPQLELHRCLPL*AGVLSY
Trigger: ATAGGAGAGGACCCCAGCCCAGAGCGGGAGACAGCG...ATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GGAGCAGGATGCCGGCGGAGGACAGGTACTTGGCGCAGGCTCGCCATGGGATCTCCAAGAAGACAACGTTaGCGTGCTGGTAGAGGGCTC +
Preference number: 2 (lower is better)
Translates to: GAGCRRRTGTWRRLAMGSPRRQR*RAGRGL
Trigger: GAGCCCTCTACCAGCACGCCAACGTTGTCTTCTTGG...AGATCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCGCCGGCATCCTGCTCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGGGCCCCAGATTCCTTTTGCTGCCATCCACTGCCTGCTCAGAGCAGCCCTCCCCATCCCTCGAGGACATaGCACGAGATAGGCCCTGGG +
Preference number: 2 (lower is better)
Translates to: RAPDSFCCHPLPAQSSPPHPSRT*HEIGPG
Trigger: CCCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATG...GGGAGGGCTGCTCTGAGCAGGCAGTGGATGGCAGCAAAAGGAATCTGGGGCCCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000643925.1
ENST00000646207.1
3UTR-3UTR CCA 90 bp GGCAGGTCACTTGTCTGCACGGACGAAGGAGGCGAAGACGCTGTCCTTCCGGCTCATCCCTCGAGGACATaGCACGAGATAGGCCCTGGG +
Preference number: 2 (lower is better)
Translates to: GRSLVCTDEGGEDAVLPAHPSRT*HEIGPG
Trigger: CCCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATG...AGCCGGAAGGACAGCGTCTTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR CCA 90 bp CTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCATCCCTCGAGGACATaGCACGAGATAGGCCCTGGG +
Preference number: 2 (lower is better)
Translates to: LPRFSGAHGCASQPPAGAHPSRT*HEIGPG
Trigger: CCCAGGGCCTATCTCGTGCCATGTCCTCGAGGGATG...AGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCGGCTTCCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGA +
Preference number: 2 (lower is better)
Translates to: PIFCPGAMRALTCFSTGFRRTGT*RRLAMG
Trigger: TCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG...GAAGCCGGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp ATCTTCCCTTGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGA +
Preference number: 2 (lower is better)
Translates to: IFPWSGQFFGISDGAGGRRRTGT*RRLAMG
Trigger: TCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG...CCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGAT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp CTGCGGTGCAGTCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACCGGAGGACAGGTACTTaGCGCAGGCTCGCCATGGGA +
Preference number: 2 (lower is better)
Translates to: LRCSLLATFSPVHSTVTDRRTGT*RRLAMG
Trigger: TCCCATGGCGAGCCTGCGCCAAGTACCTGTCCTCCG...GTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGACTGCACCGCAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp AGAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGCGCTGTCGGTCCACTTaGCCAGCCAGTAGTCGATGG +
Preference number: 2 (lower is better)
Translates to: RRRTSHCRCGRRSRSSVQRCRST*PASSRW
Trigger: CCATCGACTACTGGCTGGCCAAGTGGACCGACAGCG...CTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR CCA 90 bp GAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCATAGACGGGCCCTCATGGCGATaGGCAGCTTCCCGATGGCTC +
Preference number: 2 (lower is better)
Translates to: EAQHNAQAAEHREHHGIDGPSWR*AASRWL
Trigger: GAGCCATCGGGAAGCTGCCCATCGCCATGAGGGCCC...GTCTATGCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR CAA 90 bp GGAGCTGTCGTAGCGCACGCTCAGGTTCTGGATCTGGATCTTCCCTaGGTCTGGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCG +
Preference number: 2 (lower is better)
Translates to: GAVVAHAQVLDLDLP*VWPVLWDQRWCWGP
Trigger: CGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCCAGACCAAGGGAAGATCCAGATCCAGAACCTGAGCGTGCGCTACGACAGCTCC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR CAA 90 bp AAACCCAGGCAGGGGTATGGGCAGGGTCCGAATGTGGGATGGCACTaGGGCTCTGGCAGGTCACTTGTCTGCACGGACGAAGGAGGCGAA +
Preference number: 2 (lower is better)
Translates to: KPRQGYGQGPNVGWH*GSGRSLVCTDEGGE
Trigger: TTCGCCTCCTTCGTCCGTGCAGACAAGTGACCTGCCAGAGCCCAAGTGCCATCCCACATTCGGACCCTGCCCATACCCCTGCCTGGGTTT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000531642.5
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR CAA 90 bp AGGGAGAGGGAGGCAAAGGCCACGGAGGGCGAGAAGTCGGCCTCTTaGAAGAAGCTGACGTGGCCCACGAAAGTCTGTGGACAGAGGCAC +
Preference number: 2 (lower is better)
Translates to: REREAKATEGEKSAS*KKLTWPTKVCGQRH
Trigger: GTGCCTCTGTCCACAGACTTTCGTGGGCCACGTCAGCTTCTTCAAAGAGGCCGACTTCTCGCCCTCCGTGGCCTTTGCCTCCCTCTCCCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000646993.1
ENST00000647013.1
3UTR CAA 90 bp AGACAGTCTGGTCGAGGGTGCACTCCTTCACAGGCAGAGAGTGATTaGGAGTTCCAGGGTGCCCATGGGCTCAGCCCTTCCCCCATCCCC +
Preference number: 2 (lower is better)
Translates to: RQSGRGCTPSQAESD*EFQGAHGLSPSPIP
Trigger: GGGGATGGGGGAAGGGCTGAGCCCATGGGCACCCTGGAACTCCAAATCACTCTCTGCCTGTGAAGGAGTGCACCCTCGACCAGACTGTCT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR TCA 90 bp GGAGATGGAGGTCACCGCTGCGATGAGCACCACACATGCACCGATGTACTCCATGGGTGCACTCCTGGCTaGGGGAGCAGTTCCTGGCTG +
Preference number: 2 (lower is better)
Translates to: GDGGHRCDEHHTCTDVLHGCTPG*GSSSWL
Trigger: CAGCCAGGAACTGCTCCCTCAGCCAGGAGTGCACCC...ATGGAGTACATCGGTGCATGTGTGGTGCTCATCGCAGCGGTGACCTCCATCTCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AGAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGGGCTGCAGAGCACCGTaGACACCATGGCATAGACAG +
Preference number: 2 (lower is better)
Translates to: RRRTSHCRCGRRSRSSVQGCRAP*TPWHRQ
Trigger: CTGTCTATGCCATGGTGTTCACGGTGCTCTGCAGCC...CTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTTGTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGC +
Preference number: 2 (lower is better)
Translates to: DNVGVLVEGSGHTDSLALSWGLG*SGLAGC
Trigger: GCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGA...CAACGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AGACCTTCTGCATCTCCCCCAGTGCGGCTAGAAGGAGCGAGGACTTGCCGCAGCTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGC +
Preference number: 2 (lower is better)
Translates to: RPSASPPVRLEGARTCRSSWGLG*SGLAGC
Trigger: GCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGA...GCTGCGGCAAGTCCTCGCTCCTTCTAGCCGCACTGGGGGAGATGCAGAAGGTCT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GAAGACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACACTGATTCGCTGGCGTCATGGGGGCTAGGATaGTCCGGTTTAGCAGGCTGC +
Preference number: 2 (lower is better)
Translates to: EDNVGVLVEGSGHTDSLASWGLG*SGLAGC
Trigger: GCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGA...CGCCAGCGAATCAGTGTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTCTTC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AGGGAGTTGGAGATGGAGGTCACCGCTGCGATGAGCACCACACATGCACCGATGGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: RELEMEVTAAMSTTHAPMDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...CATCGGTGCATGTGTGGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 18 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTCCATGATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGGATGACGGCCAGGGCTaGGACACAGAGCAGGGTGGA +
Preference number: 2 (lower is better)
Translates to: VHDEDAGLPHEGPGQAEQDDGQG*DTEQGG
Trigger: TCCACCCTGCTCTGTGTCTCAGCCCTGGCCGTCATC...CTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCATCATGGAC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGCCAGTTCTTTGGGATCAGCGATGGTGCTGGGGGCCGGGCTGGGCTCAGCCACGGAAGTACTTCTGGATaGAGTAGCACACGATGGCCA +
Preference number: 2 (lower is better)
Translates to: GQFFGISDGAGGRAGLSHGSTSG*SSTRWP
Trigger: TGGCCATCGTGTGCTACTTCATCCAGAAGTACTTCC...GTGGCTGAGCCCAGCCCGGCCCCCAGCACCATCGCTGATCCCAAAGAACTGGCC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000527905.5
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646276.1
ENST00000646993.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTCAGGCCCGGATGGTGGTaGGTCCTTCTACGGTTTCGG +
Preference number: 2 (lower is better)
Translates to: GFQEPMDALHSPQLELHVRPGWW*VLLRFR
Trigger: CCGAAACCGTAGAAGGACTCACCACCATCCGGGCCT...GACATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCTGTCCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGAGGCCCGGATGGTGGTaGGTCCTTCTACGGTTTCGG +
Preference number: 2 (lower is better)
Translates to: PVHSTVTDVTRHSTMPRLRPGWW*VLLRFR
Trigger: CCGAAACCGTAGAAGGACTCACCACCATCCGGGCCT...CAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CTCATGGGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTGCAGTCTCTTGGCCAGGCCCGGATGGTGGTaGGTCCTTCTACGGTTTCGG +
Preference number: 2 (lower is better)
Translates to: LMGARMIRFSRLRCSLLARPGWW*VLLRFR
Trigger: CCGAAACCGTAGAAGGACTCACCACCATCCGGGCCT...GGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCCCATGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGGGCTAGGATGATCCGGTTTAGCAGGCTGCGGTGCAGTCTCTTGGCCACCTTCAGGCCCGGATGGTGGTaGGTCCTTCTACGGTTTCGG +
Preference number: 2 (lower is better)
Translates to: GARMIRFSRLRCSLLATFRPGWW*VLLRFR
Trigger: CCGAAACCGTAGAAGGACTCACCACCATCCGGGCCT...GAAGGTGGCCAAGAGACTGCACCGCAGCCTGCTAAACCGGATCATCCTAGCCCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTCAGCCTTCCTGCCCGCACTGTCCCTCTGGCATCAGATGCAAATGAAATTGGGTCTGCAGTGGGCCGGTaGGGCCCCGACAATCCTCCC +
Preference number: 2 (lower is better)
Translates to: VSLPARTVPLASDANEIGSAVGR*GPDNPP
Trigger: GGGAGGATTGTCGGGGCCTCACCGGCCCACTGCAGA...CCCAATTTCATTTGCATCTGATGCCAGAGGGACAGTGCGGGCAGGAAGGCTGAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000645744.1
ENST00000646207.1
3UTR-3UTR TCA 90 bp GTCCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGGCCTCTGTCCCTGGCTaGAATTCTCCCCGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: VHSTVTDVTRHSTMPRLQASVPG*NSPRLL
Trigger: CAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGC...CTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GACAGACGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACGCCTCTGTCCCTGGCTaGAATTCTCCCCGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: DRRDEAQHNAQAAEHREHASVPG*NSPRLL
Trigger: CAGAAGGCGGGGAGAATTTCAGCCAGGGACAGAGGC...GTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACGTCTGTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGCCTGCATTACTCGATGCGCGATGGTaGCCACAGTGCGGTCTGCGA +
Preference number: 2 (lower is better)
Translates to: RPLSSCRPGAAQGCRPALLDARW*PQCGLR
Trigger: TCGCAGACCGCACTGTGGTCACCATCGCGCATCGAG...TAATGCAGGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CGTGACGAGGCACAGCACAATGCCCAGGCTGCAGAGCACCGTGAACACCATGGCCGCTGTCCTTCCGGCTaGGCAGCTTCTCTGGCTTAT +
Preference number: 2 (lower is better)
Translates to: RDEAQHNAQAAEHREHHGRCPSG*AASLAY
Trigger: ATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCG...GCCATGGTGTTCACGGTGCTCTGCAGCCTGGGCATTGTGCTGTGCCTCGTCACG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR TCA 90 bp ACCAGGCATGGGCCACAGCTAGTATCCGAAAGTGCCACCCCATCCCCAGGCTCCCGCTGTCCTTCCGGCTaGGCAGCTTCTCTGGCTTAT +
Preference number: 2 (lower is better)
Translates to: TRHGPQLVSESATPSPGSRCPSG*AASLAY
Trigger: ATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCG...GGAGCCTGGGGATGGGGTGGCACTTTCGGATACTAGCTGTGGCCCATGCCTGGT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646993.1
3UTR-3UTR TCA 90 bp AGAAGGAGGACTTCCCACTGCCGGTGCGGCCGCAGATCCCGATCTTCTGTCCAGCGCTGTCCTTCCGGCTaGGCAGCTTCTCTGGCTTAT +
Preference number: 2 (lower is better)
Translates to: RRRTSHCRCGRRSRSSVQRCPSG*AASLAY
Trigger: ATAAGCCAGAGAAGCTGCTCAGCCGGAAGGACAGCG...CTGGACAGAAGATCGGGATCTGCGGCCGCACCGGCAGTGGGAAGTCCTCCTTCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR TCA 90 bp TCCAAGTCGGTCGCTGTCTCCCGCTCTGGGCTGGGGTCCTCTCCTATCTCGCTGGGGGGATACGAATGGTaGTGTTGGACAGTGTGGGGA +
Preference number: 2 (lower is better)
Translates to: SKSVAVSRSGLGSSPISLGGYEW*CWTVWG
Trigger: TCCCCACACTGTCCAACATCACCATTCGTATCCCCC...CAGCGAGATAGGAGAGGACCCCAGCCCAGAGCGGGAGACAGCGACCGACTTGGA
61% GC, longest homopolymer 6 nt, total homopolymer stretches 14 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GTCACTAAGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGCCCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: VTKTTVLLSSRSSSRMPAPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...GGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644472.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACAGGTACTCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: AVRRPATTGAGCRRRTGTPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...AGTACCTGTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCCGATCTTCTGTCCAGGGGCGATGAGGGCATTGACGTGCTTCAGCACCGGCTTCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: PDLLSRGDEGIDVLQHRLPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...AAGCCGGTGCTGAAGCACGTCAATGCCCTCATCGCCCCTGGACAGAAGATCGGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644675.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CCTGGACGCCACCCGGAAGTACTTCTGGATGAAGTAGCACACGATGGCCAGGGGCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: PGRHPEVLLDEVAHDGQGPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...CCCCTGGCCATCGTGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCGTCCAGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGGTCCTCTCCTATCTCGCTGTCAGGAAGGCTGCTGCTCCAGAAGACAGCCCCTCCAGAAGACAGCCCCTaGGACCTTCTGCATCTCCCC +
Preference number: 2 (lower is better)
Translates to: GSSPISLSGRLLLQKTAPPEDSP*DLLHLP
Trigger: GGGGAGATGCAGAAGGTCTCAGGGGCTGTCTTCTGG...AGGGGCTGTCTTCTGGAGCAGCAGCCTTCCTGACAGCGAGATAGGAGAGGACCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp ATGAAGATGCTGGTCTTCCTCACGAAGGCCCGGGCCAGGCAGAACAGCTGCCTCCGGGGCCTCTCTTCCTaGTATCCAAGTCGGTCGCTG +
Preference number: 2 (lower is better)
Translates to: MKMLVFLTKARARQNSCLRGLSS*YPSRSL
Trigger: CAGCGACCGACTTGGATATCAGGAAGAGAGGCCCCG...GAGGCAGCTGTTCTGCCTGGCCCGGGCCTTCGTGAGGAAGACCAGCATCTTCAT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTCCGGGGCCTCTCTTCCTaGTATCCAAGTCGGTCGCTG +
Preference number: 2 (lower is better)
Translates to: GFQEPMDALHSPQLELHVRGLSS*YPSRSL
Trigger: CAGCGACCGACTTGGATATCAGGAAGAGAGGCCCCG...GACATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 15 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp GAGAGCTCCCTGTGCAGGGAGTTGGAGATGGAGGTCACCGCTGCGATGAGCACCGACCACCAGACAGGTTaGTGCCCCGTTCCCCAATCT +
Preference number: 2 (lower is better)
Translates to: ESSLCRELEMEVTAAMSTDHQTG*CPVPQS
Trigger: AGATTGGGGAACGGGGCATCAACCTGTCTGGTGGTC...GGTGCTCATCGCAGCGGTGACCTCCATCTCCAACTCCCTGCACAGGGAGCTCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp CACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGACGAGGCACAGCACAATGGGCTCGGGCCACACTaGTTCGCTGGCGTTGACCAC +
Preference number: 2 (lower is better)
Translates to: HLQPCPLHSDRRDEAQHNGLGPH*FAGVDH
Trigger: GTGGTCAACGCCAGCGAATCAGTGTGGCCCGAGCCC...ATTGTGCTGTGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 17 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644542.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR TCA 90 bp AAAGTGCTGCTGAGGACCAGGCGCCTCCCGAAGGCATGGCTGAGTGCCTGCCAGGGCCCACGAAAGTTATaGGGACAGCTGCAATGGGGA +
Preference number: 2 (lower is better)
Translates to: KVLLRTRRLPKAWLSACQGPRKL*GQLQWG
Trigger: TCCCCATTGCAGCTGTCCTCATAACTTTCGTGGGCC...CTGGCAGGCACTCAGCCATGCCTTCGGGAGGCGCCTGGTCCTCAGCAGCACTTT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR TCA 90 bp GTCTGGTCTCCATGGGGCAGGATGTCGATGTCTGGCTGCAGAGAGCAGGCTTCATGCGGTTCACAACCCTaGGGGGCTGGGGGTGGTTTG +
Preference number: 2 (lower is better)
Translates to: VWSPWGRMSMSGCREQASCGSQP*GAGGGL
Trigger: CAAACCACCCCCAGCCCCTCAGGGTTGTGAACCGCA...TGAAGCCTGCTCTCTGCAGCCAGACATCGACATCCTGCCCCATGGAGACCAGAC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000646592.1
3UTR-3UTR TCA 90 bp ACCATGTGCTTGAGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGTGCGGAAAGTGCTGCTaGGGACCAGGCGCCTCCCGA +
Preference number: 2 (lower is better)
Translates to: TMCLSSCEKTSNDRSRMPCGKCC*GPGASR
Trigger: TCGGGAGGCGCCTGGTCCTCAGCAGCACTTTCCGCA...CGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCTCAAGCACATGGT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000644542.1
3UTR-3UTR GCA 90 bp TTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTCCATGTCTGGTGTCATCCAGCTGCTaGAGGTCCCTGGACGCCACC +
Preference number: 2 (lower is better)
Translates to: FSGAHGCASQPPAGAPCLVSSSC*RSLDAT
Trigger: GGTGGCGTCCAGGGACCTGCAGCAGCTGGATGACAC...CAGACATGGAGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TGGGTCACTAAGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGTGTCATCCAGCTGCTaGAGGTCCCTGGACGCCACC +
Preference number: 2 (lower is better)
Translates to: WVTKTTVLLSSRSSSRMPVSSSC*RSLDAT
Trigger: GGTGGCGTCCAGGGACCTGCAGCAGCTGGATGACAC...CGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGACCCA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TCTCTTGGCCACCTTCAGCCCTGTCCACTCCACAGTGACAGACGTGACGAGGCAGTGTCATCCAGCTGCTaGAGGTCCCTGGACGCCACC +
Preference number: 2 (lower is better)
Translates to: SLGHLQPCPLHSDRRDEAVSSSC*RSLDAT
Trigger: GGTGGCGTCCAGGGACCTGCAGCAGCTGGATGACAC...TGCCTCGTCACGTCTGTCACTGTGGAGTGGACAGGGCTGAAGGTGGCCAAGAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TCGAACTCAAGGATGGCACCCCGCTTCAGGACGATCACCAGGTCTGCACTCAGGGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: SNSRMAPRFRTITRSALRVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...CCTGAGTGCAGACCTGGTGATCGTCCTGAAGCGGGGTGCCATCCTTGAGTTCGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000645076.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646592.1
ENST00000646993.1
ENST00000647086.1
3UTR-3UTR GCA 90 bp TCACTAAGACCACTGTCCTCTTGTCGTCCCGGAGCAGCTCAAGGATGCCGGCCTGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: SLRPLSSCRPGAAQGCRPVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...AGGCCGGCATCCTTGAGCTGCTCCGGGACGACAAGAGGACAGTGGTCTTAGTGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CTTCTGGATGAAGTAGCACACGATGGCCAGGGGCAAGAGGGCCACGAGGAACACGTGGTGTCATCCAGCTaGTGCAGGTCCCTGGACGCC +
Preference number: 2 (lower is better)
Translates to: LLDEVAHDGQGQEGHEEHVVSSS*CRSLDA
Trigger: GGCGTCCAGGGACCTGCAGCAGCTGGATGACACCAC...GTGTTCCTCGTGGCCCTCTTGCCCCTGGCCATCGTGTGCTACTTCATCCAGAAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CTGCCTCGGTTTTCAGGAGCCCATGGATGCGCTTCACAGCCCCCAGCTGGAGCTGCAGAGAGCTCCCTGTaGAGGGAGTTGGAGATGGAG +
Preference number: 2 (lower is better)
Translates to: LPRFSGAHGCASQPPAGAAESSL*RELEME
Trigger: CTCCATCTCCAACTCCCTGCACAGGGAGCTCTCTGC...AGCTCCAGCTGGGGGCTGTGAAGCGCATCCATGGGCTCCTGAAAACCGAGGCAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 21 transcripts:
ENST00000527905.5
ENST00000531891.1
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644447.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645417.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp TTGAGCAGCTGTGAGAAGACCAGCAACGACAGGAGCAGGATGCCGGCGGAGGACCCCCTCGTAGCTCTCTaGCTCGGTTTTCAGGAGCCC +
Preference number: 2 (lower is better)
Translates to: LSSCEKTSNDRSRMPAEDPLVAL*LGFQEP
Trigger: GGGCTCCTGAAAACCGAGGCAGAGAGCTACGAGGGG...GTCCTCCGCCGGCATCCTGCTCCTGTCGTTGCTGGTCTTCTCACAGCTGCTCAA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 18 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp CCTGGACGCCACCCGGAAGTACTTCTGGATGAAGTAGCACACGATGGCCAGGGGCCCCTCGTAGCTCTCTaGCTCGGTTTTCAGGAGCCC +
Preference number: 2 (lower is better)
Translates to: PGRHPEVLLDEVAHDGQGPLVAL*LGFQEP
Trigger: GGGCTCCTGAAAACCGAGGCAGAGAGCTACGAGGGG...CCCCTGGCCATCGTGTGCTACTTCATCCAGAAGTACTTCCGGGTGGCGTCCAGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 19 transcripts:
ENST00000527905.5
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645076.1
ENST00000645744.1
ENST00000645760.1
ENST00000645884.1
ENST00000646003.1
ENST00000646207.1
ENST00000646276.1
ENST00000646592.1
ENST00000646993.1
ENST00000647013.1
ENST00000647086.1
ENST00000647158.1
3UTR-3UTR GCA 90 bp GAAGGGGTCATCCAAGAAGACAACGTTGGCGTGCTGGTAGAGGGCTCGGGCCACCCCCTCGTAGCTCTCTaGCTCGGTTTTCAGGAGCCC +
Preference number: 2 (lower is better)
Translates to: EGVIQEDNVGVLVEGSGHPLVAL*LGFQEP
Trigger: GGGCTCCTGAAAACCGAGGCAGAGAGCTACGAGGGG...GTGGCCCGAGCCCTCTACCAGCACGCCAACGTTGTCTTCTTGGATGACCCCTTC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 16 transcripts:
ENST00000642902.1
ENST00000643562.1
ENST00000643925.1
ENST00000644484.1
ENST00000644675.1
ENST00000644757.1
ENST00000645744.1
ENST00000645760.1
ENST00000646003.1