RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for FRYL (Mus musculus)

Ensembl gene IDs: ENSMUSG00000070733

Ensembl transcript IDs: ENSMUST00000094700.11, ENSMUST00000101127.12, ENSMUST00000152631.2, ENSMUST00000153903.3, ENSMUST00000176910.3, ENSMUST00000201277.2, ENSMUST00000202381.4, ENSMUST00000202697.4, ENSMUST00000202806.4

Found 929 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR CCA 90 bp AAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTaGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGG +
Preference number: 1 (lower is better)
Translates to: KSKWLCRRRSSAKRS*SHPSLTSPCPATSW
Trigger: CCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 90 bp AAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTaGAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGC +
Preference number: 1 (lower is better)
Translates to: KCQLCVDGGWKSKWL*RRRSSAKRSWSHPS
Trigger: GCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 90 bp TGTTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTaGGAGTCGGTCTTCAGGCTTCCTGTCTGTGTCCCCCATATCCCC +
Preference number: 1 (lower is better)
Translates to: CYVTDLDSGEGHCVV*ESVFRLPVCVPHIP
Trigger: GGGGATATGGGGGACACAGACAGGAAGCCTGAAGACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAACA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 90 bp GGAATCATAACTACGTCAGCAGTCCGACGGCGTGCACAGTGGCCTTaGTTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATG +
Preference number: 1 (lower is better)
Translates to: GIITTSAVRRRAQWP*LMHLSIITFLSGAM
Trigger: CATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAATCAAGGCCACTGTGCACGCCGTCGGACTGCTGACGTAGTTATGATTCC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTaGCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAAT +
Preference number: 1 (lower is better)
Translates to: SSAKRSWSHPSLTSP*PATSWGHYCKHPWN
Trigger: ATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 90 bp TTTGAGTCCTGCGTAAACACACAAGTTCATTTGCATCTCTTCTCTTaGAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATCA +
Preference number: 1 (lower is better)
Translates to: FESCVNTQVHLHLFS*SPQPFRARRTYTPS
Trigger: TGATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGATGCAAATGAACTTGTGTGTTTACGCAGGACTCAAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 90 bp AGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTaGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTTTTCTCCA +
Preference number: 1 (lower is better)
Translates to: SWSHPSLTSPCPATS*GHYCKHPWNFFFSP
Trigger: TGGAGAAAAGAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 90 bp GCCCCCAAAGTTATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTaGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGGT +
Preference number: 1 (lower is better)
Translates to: APKVINEAQGFLKGA*LAVLIIFSLLPLEG
Trigger: ACCCTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGATAACTTTGGGGGC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 90 bp AAGAAGAAGACAGGATCCCGTTTGTTATGTTACAGACTTAGACAGTaGAGAAGGACATTGTGTGGTCTGGGAGTCGGTCTTCAGGCTTCC +
Preference number: 1 (lower is better)
Translates to: KKKTGSRLLCYRLRQ*RRTLCGLGVGLQAS
Trigger: GGAAGCCTGAAGACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAACAAACGGGATCCTGTCTTCTTCTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 90 bp CTGTGTCCCCCATATCCCCAAGGTTCCTTTAGCCTGAAACAAGTTTaGGTCCTGCGTAAACACACAAGTTCATTTGCATCTCTTCTCTTG +
Preference number: 1 (lower is better)
Translates to: LCPPYPQGSFSLKQV*VLRKHTSSFASLLL
Trigger: CAAGAGAAGAGATGCAAATGAACTTGTGTGTTTACGCAGGACTCAAACTTGTTTCAGGCTAAAGGAACCTTGGGGATATGGGGGACACAG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 90 bp TCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTaGTGTAACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTT +
Preference number: 1 (lower is better)
Translates to: SISDHNFSFSFGHVL*CNSVWRERTRKYRF
Trigger: AAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 90 bp ATGGAGTTTTACAGGAATCATAACTACGTCAGCAGTCCGACGGCGTaGACAGTGGCCTTGATTAATGCACTTGAGCATAATTACATTTCT +
Preference number: 1 (lower is better)
Translates to: MEFYRNHNYVSSPTA*TVALINALEHNYIS
Trigger: AGAAATGTAATTATGCTCAAGTGCATTAATCAAGGCCACTGTGCACGCCGTCGGACTGCTGACGTAGTTATGATTCCTGTAAAACTCCAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 90 bp TTTTTGCAAAAAGTCTGTGTTATCTGTCTGACTGGGTGGTCAAGTTaGTCATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCA +
Preference number: 1 (lower is better)
Translates to: FLQKVCVICLTGWSS*SLSVNSVLMVAGNP
Trigger: TGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATAACACAGACTTTTTGCAAAAA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACACTTCACCCTGCCCTaGAACATCTTGGGGCCATTA +
Preference number: 2 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSHFTLP*NILGPL
Trigger: TAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 90 bp GGATCCCGTTTGTTATGTTACAGACTTAGACAGTGGAGAAGGACATaGTGTGGTCTGGGAGTCGGTCTTCAGGCTTCCTGTCTGTGTCCC +
Preference number: 2 (lower is better)
Translates to: GSRLLCYRLRQWRRT*CGLGVGLQASCLCP
Trigger: GGGACACAGACAGGAAGCCTGAAGACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAACAAACGGGATCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCCCAAAGTTATCAATaGAGCACAAGGGTTCCTAAA +
Preference number: 2 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCPQSYQ*STRVPK
Trigger: TTTAGGAACCCTTGTGCTTCATTGATAACTTTGGGG...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 90 bp GAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTaGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTTTTCTCC +
Preference number: 2 (lower is better)
Translates to: ELVPSQPHFTLPCNI*GPLLQTSLEFLLFS
Trigger: GGAGAAAAGAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTCTTGGGGCCATTATTaGAAACATCCTTGGAATTTC +
Preference number: 2 (lower is better)
Translates to: GLQLKGVGPIPASLHPALSWGHY*KHPWNF
Trigger: GAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATAAATCCAAGTGGCTCTaGAGGCGCAGGTCTTCAGCT +
Preference number: 2 (lower is better)
Translates to: ACGANVQENTGFSLGGVYKSKWL*RRRSSA
Trigger: AGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTT...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTGCCCTGCAACATCTTaGGGCCATTATTGCAAACAT +
Preference number: 2 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHCPATS*GHYCKH
Trigger: ATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGGGCTGGAAATCCAAGTaGCTCTGCAGGCGCAGGTCT +
Preference number: 2 (lower is better)
Translates to: HLLWLVINIDTSTDQRAEGWKSK*LCRRRS
Trigger: AGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCC...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 90 bp AGGAATCATAACTACGTCAGCAGTCCGACGGCGTGCACAGTGGCCTaGATTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCAT +
Preference number: 2 (lower is better)
Translates to: RNHNYVSSPTACTVA*INALEHNYISVGGH
Trigger: ATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAATCAAGGCCACTGTGCACGCCGTCGGACTGCTGACGTAGTTATGATTCCT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATCCCCAAAGTTATCAATaGAGCACAAGGGTTCCTAAA +
Preference number: 2 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHPQSYQ*STRVPK
Trigger: TTTAGGAACCCTTGTGCTTCATTGATAACTTTGGGG...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTTTGCATCTCTTCTCTTaGAGTCCGCAGCCCTTCAGG +
Preference number: 2 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGLHLFS*SPQPFR
Trigger: CCTGAAGGGCTGCGGACTTCAAGAGAAGAGATGCAA...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATCTTGGGGCCATTATTaGAAACATCCTTGGAATTTC +
Preference number: 2 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPASWGHY*KHPWNF
Trigger: GAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGAGCCTCACTTCACCCTaGCCTGCAACATCTTGGGGC +
Preference number: 2 (lower is better)
Translates to: SKIILQCSFRHALRSCHQSLTSP*PATSWG
Trigger: GCCCCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCT...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAAGTGTCAACTCTGTGTTaGTGGTGGCTGGAAATCCAA +
Preference number: 2 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKVSTLC*WWLEIQ
Trigger: TTGGATTTCCAGCCACCATCAACACAGAGTTGACAC...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTCTTGGGGCCATTATTaGAAACATCCTTGGAATTTC +
Preference number: 2 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHSWGHY*KHPWNF
Trigger: GAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCACTTCACCCTGCCCTaGAACATCTTGGGGCCATTA +
Preference number: 2 (lower is better)
Translates to: HLLWLVINIDTSTDQRAEHFTLP*NILGPL
Trigger: TAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTG...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTCTTTTAGGCATGCTCTaGGAAGCTGTCACCAGACAT +
Preference number: 2 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGLLGML*EAVTRH
Trigger: ATGTCTGGTGACAGCTTCTCAGAGCATGCCTAAAAG...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTGCCCTGCAACATCTTaGGGCCATTATTGCAAACAT +
Preference number: 2 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRCPATS*GHYCKH
Trigger: ATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATTCAGCTAAAAGGAGTTaGTCCCATCCCAGCCTCACT +
Preference number: 2 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHSAKRS*SHPSLT
Trigger: AGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGA...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGTCAGCTAAAAGGAGTTaGTCCCATCCCAGCCTCACT +
Preference number: 2 (lower is better)
Translates to: SVTTTFPLALDMFSDVTASAKRS*SHPSLT
Trigger: AGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGA...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTGTTATCTGTCTGACTaGGTGGTCAAGTTGATCATT +
Preference number: 2 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSCYLSD*VVKLII
Trigger: AATGATCAACTTGACCACCCAGTCAGACAGATAACA...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCAAAATAATCTTGCAGTaGTCTTTTAGGCATGCTCTG +
Preference number: 2 (lower is better)
Translates to: TACGANVQENTGFSLGGVKIILQ*SFRHAL
Trigger: CAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTT...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACTGTTATCTGTCTGACTaGGTGGTCAAGTTGATCATT +
Preference number: 2 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHCYLSD*VVKLII
Trigger: AATGATCAACTTGACCACCCAGTCAGACAGATAACA...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCCCCAAAGTTATCAATaGAGCACAAGGGTTCCTAAA +
Preference number: 2 (lower is better)
Translates to: SKIILQCSFRHALRSCHQPQSYQ*STRVPK
Trigger: TTTAGGAACCCTTGTGCTTCATTGATAACTTTGGGG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR TCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACACCCCAAAGTTATCAATaGAGCACAAGGGTTCCTAAA +
Preference number: 2 (lower is better)
Translates to: KVFLSNQRRWEATFISFTPQSYQ*STRVPK
Trigger: TTTAGGAACCCTTGTGCTTCATTGATAACTTTGGGG...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACACACACAAGTTCATTTaGATCTCTTCTCTTGAAGTC +
Preference number: 2 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHTHKFI*ISSLEV
Trigger: GACTTCAAGAGAAGAGATGCAAATGAACTTGTGTGT...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGAAAATAATCTTGCAGTaGTCTTTTAGGCATGCTCTG +
Preference number: 2 (lower is better)
Translates to: SVTTTFPLALDMFSDVTAKIILQ*SFRHAL
Trigger: CAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTT...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR GCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAAAAATAATCTTGCAGTaGTCTTTTAGGCATGCTCTG +
Preference number: 2 (lower is better)
Translates to: KVFLSNQRRWEATFISFTKIILQ*SFRHAL
Trigger: CAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTT...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 72 bp TGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTaGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCA +
Preference number: 3 (lower is better)
Translates to: WLCRRRSSAKRS*SHPSLTSPCPA
Trigger: TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 72 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTaGAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCC +
Preference number: 3 (lower is better)
Translates to: LCVDGGWKSKWL*RRRSSAKRSWS
Trigger: GGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGCTTGGCTAGCAGTCTaGATCATCTTCAGCTTACTC +
Preference number: 3 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCAWLAV*IIFSLL
Trigger: GAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 72 bp AAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTaGCCTGCAACATCTTGGGGCCATTATTGCAAACAT +
Preference number: 3 (lower is better)
Translates to: KRSWSHPSLTSP*PATSWGHYCKH
Trigger: ATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 72 bp TGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTaGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGT +
Preference number: 3 (lower is better)
Translates to: CQLCVDGGWKSK*LCRRRSSAKRS
Trigger: ACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 72 bp CATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTaGGGCCATTATTGCAAACATCCTTGGAATTTCTTC +
Preference number: 3 (lower is better)
Translates to: HPSLTSPCPATS*GHYCKHPWNFF
Trigger: GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCGCTTGGCTAGCAGTCTaGATCATCTTCAGCTTACTC +
Preference number: 3 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSAWLAV*IIFSLL
Trigger: GAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGC...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAATCTTGGGGCCATTATaGCAAACATCCTTGGAATTT +
Preference number: 3 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAILGPL*QTSLEF
Trigger: AAATTCCAAGGATGTTTGCAATAATGGCCCCAAGAT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATCTGCCCTGCAACATCTaGGGGCCATTATTGCAAACA +
Preference number: 3 (lower is better)
Translates to: ACGANVQENTGFSLGGVYLPCNI*GPLLQT
Trigger: TGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAG...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 72 bp ACTACGTCAGCAGTCCGACGGCGTGCACAGTGGCCTTaGTTAATGCACTTGAGCATAATTACATTTCTGTCG +
Preference number: 3 (lower is better)
Translates to: TTSAVRRRAQWP*LMHLSIITFLS
Trigger: CGACAGAAATGTAATTATGCTCAAGTGCATTAATCAAGGCCACTGTGCACGCCGTCGGACTGCTGACGTAGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATGCTTGGCTAGCAGTCTaGATCATCTTCAGCTTACTC +
Preference number: 3 (lower is better)
Translates to: ACGANVQENTGFSLGGVYAWLAV*IIFSLL
Trigger: GAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGC...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCTGCCCTGCAACATCTaGGGGCCATTATTGCAAACA +
Preference number: 3 (lower is better)
Translates to: HLLWLVINIDTSTDQRAELPCNI*GPLLQT
Trigger: TGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAG...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTAGTGTCAACTCTGTGTaGATGGTGGCTGGAAATCCA +
Preference number: 3 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGSVNSV*MVAGNP
Trigger: TGGATTTCCAGCCACCATCAACACAGAGTTGACACT...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAGACTGGGTGGTCAAGTaGATCATTAAGTGTCAACTC +
Preference number: 3 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLDWVVK*IIKCQL
Trigger: GAGTTGACACTTAATGATCAACTTGACCACCCAGTC...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 72 bp TACAGGAATCATAACTACGTCAGCAGTCCGACGGCGTaGACAGTGGCCTTGATTAATGCACTTGAGCATAAT +
Preference number: 3 (lower is better)
Translates to: YRNHNYVSSPTA*TVALINALEHN
Trigger: ATTATGCTCAAGTGCATTAATCAAGGCCACTGTGCACGCCGTCGGACTGCTGACGTAGTTATGATTCCTGTA
47% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 72 bp ACAGGATCCCGTTTGTTATGTTACAGACTTAGACAGTaGAGAAGGACATTGTGTGGTCTGGGAGTCGGTCTT +
Preference number: 3 (lower is better)
Translates to: TGSRLLCYRLRQ*RRTLCGLGVGL
Trigger: AAGACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAACAAACGGGATCCTGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCATCTTGGGGCCATTATaGCAAACATCCTTGGAATTT +
Preference number: 3 (lower is better)
Translates to: TACGANVQENTGFSLGGVILGPL*QTSLEF
Trigger: AAATTCCAAGGATGTTTGCAATAATGGCCCCAAGAT...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGAGTGTCAACTCTGTGTaGATGGTGGCTGGAAATCCA +
Preference number: 3 (lower is better)
Translates to: HLLWLVINIDTSTDQRAESVNSV*MVAGNP
Trigger: TGGATTTCCAGCCACCATCAACACAGAGTTGACACT...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTGACTGGGTGGTCAAGTaGATCATTAAGTGTCAACTC +
Preference number: 3 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGDWVVK*IIKCQL
Trigger: GAGTTGACACTTAATGATCAACTTGACCACCCAGTC...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 72 bp ACTTCACCCTGCCCTGCAACATCTTGGGGCCATTATTaGAAACATCCTTGGAATTTCTTCTTTTCTCCAGAG +
Preference number: 3 (lower is better)
Translates to: TSPCPATSWGHY*KHPWNFFFSPE
Trigger: CTCTGGAGAAAAGAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 72 bp GACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTaGTGTAACAGCGTGTGGCGCGAACGTACAAGAAAA +
Preference number: 3 (lower is better)
Translates to: DHNFSFSFGHVL*CNSVWRERTRK
Trigger: TTTTCTTGTACGTTCGCGCCACACGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CCA 72 bp GTTATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTaGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCT +
Preference number: 3 (lower is better)
Translates to: VINEAQGFLKGA*LAVLIIFSLLP
Trigger: AGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGATAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR TCA 72 bp CCATATCCCCAAGGTTCCTTTAGCCTGAAACAAGTTTaGGTCCTGCGTAAACACACAAGTTCATTTGCATCT +
Preference number: 3 (lower is better)
Translates to: PYPQGSFSLKQV*VLRKHTSSFAS
Trigger: AGATGCAAATGAACTTGTGTGTTTACGCAGGACTCAAACTTGTTTCAGGCTAAAGGAACCTTGGGGATATGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR-3UTR CAA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTACTGCAGGCATCTGCTTaGGTTAGTTATCAACATCGA +
Preference number: 3 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVLQASA*VSYQHR
Trigger: TCGATGTTGATAACTAACCAAAGCAGATGCCTGCAG...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR GCA 72 bp TTCCAACACATGATTCCTTACAGAGACTATCACAAATaGACCAAGAGTAATCAAAGCTGTGCTATTTACCGT +
Preference number: 3 (lower is better)
Translates to: FQHMIPYRDYHK*TKSNQSCAIYR
Trigger: ACGGTAAATAGCACAGCTTTGATTACTCTTGGTGCATTTGTGATAGTCTCTGTAAGGAATCATGTGTTGGAA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000152631.2
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGGAGCCTGCGGGTGCTaGTGGGGACGGGGAGGTGGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLGACGC*WGRGGG
Trigger: GCCACCTCCCCGTCCCCATCAGCACCCGCAGGCTCC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGGACGGGGAGGTGGCTaGGCTGCAGCAGAGGACCAG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALGRGGG*AAAEDQ
Trigger: CTGGTCCTCTGCTGCAGCGCAGCCACCTCCCCGTCC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTCCATCCTGCTCCACTaGGAGGTCCACCTCGCCGAG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALSILLH*EVHLAE
Trigger: CTCGGCGAGGTGGACCTCTCAGTGGAGCAGGATGGA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAGCCACTGTCAGGGGTaGACGCCAGCGTCTCGGGAG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPSHCQG*TPASRE
Trigger: CTCCCGAGACGCTGGCGTCCACCCCTGACAGTGGCT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACATGGCGGTGGCCTGTaGGGAGCCCCAGCCTTCTCC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKHGGGL*GAPAFS
Trigger: GGAGAAGGCTGGGGCTCCCCACAGGCCACCGCCATG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCTCGTCAGGGTCAGGCTaGGGGTGCTGCTGGAACACG +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCSSGSG*GCCWNT
Trigger: CGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGA...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGTGCGTGACAGGATCTaGCTTGCGGTGAGGGCGGCT +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCVRDRI*LAVRAA
Trigger: AGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCAC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCACTGGAGCTAAGCCCTaGGTCGGTCATAGGGGACGG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPTGAKP*VGHRGR
Trigger: CCGTCCCCTATGACCGACTCAGGGCTTAGCTCCAGT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCCATCCTGCTCCACTaGGAGGTCCACCTCGCCGAG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSILLH*EVHLAE
Trigger: CTCGGCGAGGTGGACCTCTCAGTGGAGCAGGATGGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATCCATCCTGCTCCACTaGGAGGTCCACCTCGCCGAG +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKSILLH*EVHLAE
Trigger: CTCGGCGAGGTGGACCTCTCAGTGGAGCAGGATGGA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCGGCGGCTTCTTCCTCTaGGGACTCGTCGGTATCCTC +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPGGFFL*GLVGIL
Trigger: GAGGATACCGACGAGTCCTCAGAGGAAGAAGCCGCC...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCTGCTAGCAGAATCCTaGGACTGCAGCAGGTCCTGG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALLLAES*DCSRSW
Trigger: CCAGGACCTGCTGCAGTCTCAGGATTCTGCTAGCAG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGTGTCCGACAGCGTCTaGTTGACATGGCAACGCCAC +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCVSDSV*LTWQRH
Trigger: GTGGCGTTGCCATGTCAATCAGACGCTGTCGGACAC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCGGGTCTCCATCCTTCTaGTGCAGGCTGTCCGCGATG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPGSPSF*CRLSAM
Trigger: CATCGCGGACAGCCTGCAGCAGAAGGATGGAGACCC...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAAGCAGGCGCTTGCAGTaGTCGTACACCTCAGGGTGG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPASRRLQ*SYTSGW
Trigger: CCACCCTGAGGTGTACGAGCACTGCAAGCGCCTGCT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTCAGGCTGGGGGTGCTaGTGGAACACGGGTACTCCT +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPSGWGC*WNTGTP
Trigger: AGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCAAGCTGATGACGCTCTaGACCACGTGTGGGCTCTGC +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCKLMTL*TTCGLC
Trigger: GCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCCACGTAATCCACCAGTaGCGACCAGCAGCCTCCAGC +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPHVIHQ*RPAASS
Trigger: GCTGGAGGCTGCTGGTCGCCACTGGTGGATTACGTG...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACCGAGGAGGGTGGTGTaGAGGTGTGAAATGGCAGCG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAPRRVV*RCEMAA
Trigger: CGCTGCCATTTCACACCTCCACACCACCCTCCTCGG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGTGCGTGACAGGATCTaGCTTGCGGTGAGGGCGGCT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLVRDRI*LAVRAA
Trigger: AGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCAC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TGTGAGGGGGATGGGAAGTGTGGTGTGTCTCCGGACACCATCCCTGTGCCTGCCCATCCACAAAGACAGTaGGGCATTCAGAACAGGCCA +
Preference number: 4 (lower is better)
Translates to: CEGDGKCGVSPDTIPVPAHPQRQ*GIQNRP
Trigger: TGGCCTGTTCTGAATGCCCCACTGTCTTTGTGGATG...GGCAGGCACAGGGATGGTGTCCGGAGACACACCACACTTCCCATCCCCCTCACA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGAACGAGGGACTCTGTaGTCTCCATGCTCTCAGAGC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALERGTL*SPCSQS
Trigger: GCTCTGAGAGCATGGAGATCACAGAGTCCCTCGTTC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACGTTGGCAATGGCTTTaGAGCAGCCGGCTGCTACTC +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPARWQWL*SSRLLL
Trigger: GAGTAGCAGCCGGCTGCTTCAAAGCCATTGCCAACG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAATCCTGCCGCCTCCCTaGAGGCAGAGGTTTGAGGTC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKILPPP*RQRFEV
Trigger: GACCTCAAACCTCTGCCTTCAGGGAGGCGGCAGGAT...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGAGACGGAAATGAGCTaGCTGAGGAGGTGCACGGTC +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSETEMS*LRRCTV
Trigger: GACCGTGCACCTCCTCAGTCAGCTCATTTCCGTCTC...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TGTGAGGGGGATGGGAAGTGTGGTGTGTCTCCGGACACCATCCCTGTGCCTGCCCTTTCAAAGCCAAGGTaGCATCCTCTTCACAGATGG +
Preference number: 4 (lower is better)
Translates to: CEGDGKCGVSPDTIPVPALSKPR*HPLHRW
Trigger: CCATCTGTGAAGAGGATGTCACCTTGGCTTTGAAAG...GGCAGGCACAGGGATGGTGTCCGGAGACACACCACACTTCCCATCCCCCTCACA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGGGTCTCCATCCTTCTaGTGCAGGCTGTCCGCGATG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLGSPSF*CRLSAM
Trigger: CATCGCGGACAGCCTGCAGCAGAAGGATGGAGACCC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCAGCAGCAACGTGACTaGTTCACAGCCCAACTGGTG +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCQQQRD*FTAQLV
Trigger: CACCAGTTGGGCTGTGAAGCAGTCACGTTGCTGCTG...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAGGGGACGACAAGACTTaGAGAGCGAGACACCACCAG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAGDDKT*RARHHQ
Trigger: CTGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCC...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACGTGCTCCTGGTGACTaGGATCACCTTTGCCTTCCC +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPARAPGD*DHLCLP
Trigger: GGGAAGGCAAAGGTGATCGCAGTCACCAGGAGCACG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATGTCTCCTTTGTCAATaGTGTCCAGCGAGCGCCGGC +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSCLLCQ*CPASAG
Trigger: GCCGGCGCTCGCTGGACAGCATTGACAAAGGAGACA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACCGCCGCTTGCACTGTaGCTAATGACACCAGCATCC +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSPPLAL*LMTPAS
Trigger: GGATGCTGGTGTCATTAGCCACAGTGCAAGCGGCGG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACAGGAACTAGGGCGTTaGATGTGGAGCCAGAGGAGG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSQELGR*MWSQRR
Trigger: CCTCCTCTGGCTCCACATCCAACGCCCTAGTTCCTG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCCAGGAACTAGGGCGTTaGATGTGGAGCCAGAGGAGG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPQELGR*MWSQRR
Trigger: CCTCCTCTGGCTCCACATCCAACGCCCTAGTTCCTG...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCAACGGAGGGATTCTTaGGGAGGCCAGATTCGGGGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLQRRDS*GGQIRG
Trigger: GCCCCGAATCTGGCCTCCCCAAGAATCCCTCCGTTG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATTCCTGAGGGAAGAATaGCTCCTGTGGTGGGCATGG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAFLREE*LLWWAW
Trigger: CCATGCCCACCACAGGAGTCATTCTTCCCTCAGGAA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGGGAGCCTGCGGGTGCTaGTGGGGACGGGGAGGTGGC +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQGACGC*WGRGGG
Trigger: GCCACCTCCCCGTCCCCATCAGCACCCGCAGGCTCC...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGCTCCAGCAGCAACGTaGCTGCTTCACAGCCCAACT +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLAPAAT*LLHSPT
Trigger: AGTTGGGCTGTGAAGCAGTCACGTTGCTGCTGGAGC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTACATCAGGCTGCTCTaGTCAGGGTTCAGCTCCAGC +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPYIRLL*SGFSSS
Trigger: GCTGGAGCTGAACCCTGATCAGAGCAGCCTGATGTA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGAGAATATGGCGAGAGTaGGCTCTGGATATGCTCGGG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALRIWRE*ALDMLG
Trigger: CCCGAGCATATCCAGAGCTCACTCTCGCCATATTCT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCAGAATATGGCGAGAGTaGGCTCTGGATATGCTCGGG +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCRIWRE*ALDMLG
Trigger: CCCGAGCATATCCAGAGCTCACTCTCGCCATATTCT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAGAGACGGAAATGAGCTaGCTGAGGAGGTGCACGGTC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKETEMS*LRRCTV
Trigger: GACCGTGCACCTCCTCAGTCAGCTCATTTCCGTCTC...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGGGATCTGGCTTGCGGTaGGGGCGGCTTCTTCCTCTG +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTGSGLR*GRLLPL
Trigger: CAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCC...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATCTGCTAGCAGAATCCTaGGACTGCAGCAGGTCCTGG +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHLLAES*DCSRSW
Trigger: CCAGGACCTGCTGCAGTCTCAGGATTCTGCTAGCAG...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGAACAGAAGCAGCAGCTaGAAGTGCAGCCGGTACAAC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALNRSSS*KCSRYN
Trigger: GTTGTACCGGCTGCACTTTCAGCTGCTGCTTCTGTT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp TGTGAGGGGGATGGGAAGTGTGGTGTGTCTCCGGACACCATCCCTGTGCCTGCCGTTTCGATCAGAGAGTaGATGGCAGTTTCTATCGTG +
Preference number: 4 (lower is better)
Translates to: CEGDGKCGVSPDTIPVPAVSIRE*MAVSIV
Trigger: CACGATAGAAACTGCCATTCACTCTCTGATCGAAAC...GGCAGGCACAGGGATGGTGTCCGGAGACACACCACACTTCCCATCCCCCTCACA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCCATTAGCAATGCCGTaGTGGGAGTCCTGGGTCCTG +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLPLAMP*WESWVL
Trigger: CAGGACCCAGGACTCCCAGCACGGCATTGCTAATGG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACTTTGGCCAGCCGTCTaGAAGGGTGGTCCACACATT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSLWPAV*KGGPHI
Trigger: AATGTGTGGACCACCCTTGCAGACGGCTGGCCAAAG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCCTTTGGCCAGCCGTCTaGAAGGGTGGTCCACACATT +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPLWPAV*KGGPHI
Trigger: AATGTGTGGACCACCCTTGCAGACGGCTGGCCAAAG...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAATCGGAGAGTGTGTCTaGAGACAGGGGCTGCTTCAG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAIGECV*RQGLLQ
Trigger: CTGAAGCAGCCCCTGTCTGCAGACACACTCTCCGAT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGATCTCCAGATTAAACTaGTTGACCGGGGCCGCAGAC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALISRLN*LTGAAD
Trigger: GTCTGCGGCCCCGGTCAAGCAGTTTAATCTGGAGAT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGGGGACGACAAGACTTaGAGAGCGAGACACCACCAG +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLGDDKT*RARHHQ
Trigger: CTGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCGTGCTCCTGGTGACTaGGATCACCTTTGCCTTCCC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLRAPGD*DHLCLP
Trigger: GGGAAGGCAAAGGTGATCGCAGTCACCAGGAGCACG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGTCTCCTTTGTCAATaGTGTCCAGCGAGCGCCGGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLCLLCQ*CPASAG
Trigger: GCCGGCGCTCGCTGGACAGCATTGACAAAGGAGACA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACTGCCAGTCTTCTCGTaGCAGGCCGACTGCTACAGA +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKLPVFS*QADCYR
Trigger: TCTGTAGCAGTCGGCCTGCCACGAGAAGACTGGCAG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCGGCCCCCGTGAGGTaGATGAAGCTCTCCAGAATG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSAPVR*MKLSRM
Trigger: CATTCTGGAGAGCTTCATCCACCTCACGGGGGCCGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCATGGCGGTGGCCTGTaGGGAGCCCCAGCCTTCTCC +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEHGGGL*GAPAFS
Trigger: GGAGAAGGCTGGGGCTCCCCACAGGCCACCGCCATG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAAGCCGTCTGCAAGGGTaGTCCACACATTCTCCACCT +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPASRLQG*STHSPP
Trigger: AGGTGGAGAATGTGTGGACCACCCTTGCAGACGGCT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCGGCTGGGGGTGCTGCTaGAACACGGGTACTCCTGGA +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVGWGCC*NTGTPG
Trigger: TCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCC...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGTCGTCAGGGTCAGGCTaGGGGTGCTGCTGGAACACG +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTSSGSG*GCCWNT
Trigger: CGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGA...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTTCCTGAGGGAAGAATaGCTCCTGTGGTGGGCATGG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLFLREE*LLWWAW
Trigger: CCATGCCCACCACAGGAGTCATTCTTCCCTCAGGAA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGAACGAGGGACTCTGTaGTCTCCATGCTCTCAGAGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLERGTL*SPCSQS
Trigger: GCTCTGAGAGCATGGAGATCACAGAGTCCCTCGTTC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGTGTTGTTGAGGAAGTaGGTTTCGCTATCAAGGCCG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALVLLRK*VSLSRP
Trigger: CGGCCTTGATAGCGAAACTCACTTCCTCAACAACAC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGACTTGTGCTTAGATTaGGCTGGCCAGTGCTTTTCC +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCDLCLD*AGQCFS
Trigger: GGAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAGTTAAGAGGAAAGCCTaGCACCTGGGACGGATCCAC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKVKRKA*HLGRIH
Trigger: GTGGATCCGTCCCAGGTGTCAGGCTTTCCTCTTAAC...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGTTAAGAGGAAAGCCTaGCACCTGGGACGGATCCAC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLVKRKA*HLGRIH
Trigger: GTGGATCCGTCCCAGGTGTCAGGCTTTCCTCTTAAC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTACAAACTCATCATGTaGGCCAGGTTCACCAGCGTC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALYKLIM*ARFTSV
Trigger: GACGCTGGTGAACCTGGCTCACATGATGAGTTTGTA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCCAGCTTCAGGATGTTaGGGGCTTCCTTCCAGTACG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLPASGC*GLPSST
Trigger: CGTACTGGAAGGAAGCCCTCAACATCCTGAAGCTGG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGGATCTGGCTTGCGGTaGGGGCGGCTTCTTCCTCTG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRGSGLR*GRLLPL
Trigger: CAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAACAGAAGCAGCAGCTaGAAGTGCAGCCGGTACAAC +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPNRSSS*KCSRYN
Trigger: GTTGTACCGGCTGCACTTTCAGCTGCTGCTTCTGTT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCTGGGCAAGTTCTTCTaGCATGTTGATGACCTCTGC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALLGKFF*HVDDLC
Trigger: GCAGAGGTCATCAACATGTCAGAAGAACTTGCCCAG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACTGCAGCCTGGTGTATaGGAACATCCACGCATAGCT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSLQPGV*EHPRIA
Trigger: AGCTATGCGTGGATGTTCGCATACACCAGGCTGCAG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTCTGCTGGGGAAAGATaGTTCTCCTCTGGTGCACCG +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHSAGER*FSSGAP
Trigger: CGGTGCACCAGAGGAGAAGCATCTTTCCCCAGCAGA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAAGACCCTCCGGAGCTaGTACTGTATCGGGACTCCA +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLKTLRS*YCIGTP
Trigger: TGGAGTCCCGATACAGTAGCAGCTCCGGAGGGTCTT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGGCTCTCCTTGGTTGTaGTCCATCACTTTCAGGCGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLGSPWL*SITFRR
Trigger: GCGCCTGAAAGTGATGGAGCACAACCAAGGAGAGCC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACAGGGGCTGCTTCAGTaGCCTGAAAATCTGGAAGGA +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAQGLLQ*PENLEG
Trigger: TCCTTCCAGATTTTCAGGGCACTGAAGCAGCCCCTG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACAGGGGCTGCTTCAGTaGCCTGAAAATCTGGAAGGA +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSQGLLQ*PENLEG
Trigger: TCCTTCCAGATTTTCAGGGCACTGAAGCAGCCCCTG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGAAAATCTAAGGTCTTaGCGGGCAGCTCCTTCGAGA +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCENLRS*RAAPSR
Trigger: TCTCGAAGGAGCTGCCCGGCAAGACCTTAGATTTTC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTCAAGAAGGGTGGGGTaGACATCAGTCACTTCACGA +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALSRRVG*TSVTSR
Trigger: TCGTGAAGTGACTGATGTCCACCCCACCCTTCTTGA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACACAGAATAGAGATGTaGCAGCGGGGACAGCTGACT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSHRIEM*QRGQLT
Trigger: AGTCAGCTGTCCCCGCTGCCACATCTCTATTCTGTG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACAGGGTTGCCATCTGTaGGAGCGACCATTGTATTGC +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSQGCHL*ERPLYC
Trigger: GCAATACAATGGTCGCTCCCACAGATGGCAACCCTG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAGAAGAAACGTCCTCATaGTTCCAAAGGGGCCCTCGT +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAEETSS*FQRGPR
Trigger: ACGAGGGCCCCTTTGGAACCATGAGGACGTTTCTTC...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TGTGAGGGGGATGGGAAGTGTGGTGTGTCTCCGGACACCATCCCTGTGCCTGCCGGTCATAGTGCTTCATaGTTTCAGCCAAGGTATCAA +
Preference number: 4 (lower is better)
Translates to: CEGDGKCGVSPDTIPVPAGHSAS*FQPRYQ
Trigger: TTGATACCTTGGCTGAAACCATGAAGCACTATGACC...GGCAGGCACAGGGATGGTGTCCGGAGACACACCACACTTCCCATCCCCCTCACA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATGGCTGGGGGTGCTGCTaGAACACGGGTACTCCTGGA +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYGWGCC*NTGTPG
Trigger: TCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCC...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCAGATCTTCACCCCTCTaGAGAGATCTGGATAACAGC +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCRSSPL*RDLDNS
Trigger: GCTGTTATCCAGATCTCTTCAGAGGGGTGAAGATCT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATCCATGTGGATTGTaGGCCTTGCTAACAGCTCAA +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALHPCGL*ALLTAQ
Trigger: TTGAGCTGTTAGCAAGGCTCACAATCCACATGGATG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATCGTTGGCAATGGCTTTaGAGCAGCCGGCTGCTACTC +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDRWQWL*SSRLLL
Trigger: GAGTAGCAGCCGGCTGCTTCAAAGCCATTGCCAACG...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATCTGGATCCGCTGGCTaGTCTCTGAGAATATGGCGA +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKSGSAG*SLRIWR
Trigger: TCGCCATATTCTCAGAGATCAGCCAGCGGATCCAGA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCACTGGAGCTAAGCCCTaGGTCGGTCATAGGGGACGG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFTGAKP*VGHRGR
Trigger: CCGTCCCCTATGACCGACTCAGGGCTTAGCTCCAGT...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGTTTGCTCAGAAGCCTaGGAGCCAGGAGGTATTCAT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSVCSEA*EPGGIH
Trigger: ATGAATACCTCCTGGCTCTCAGGCTTCTGAGCAAAC...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATGGCGGCTTCTTCCTCTaGGGACTCGTCGGTATCCTC +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYGGFFL*GLVGIL
Trigger: GAGGATACCGACGAGTCCTCAGAGGAAGAAGCCGCC...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCCAAGACGCCAAACTTaGGTGTTTCCAGCAAGCCAC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLPRRQT*VFPASH
Trigger: GTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACCAAGACGCCAAACTTaGGTGTTTCCAGCAAGCCAC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKPRRQT*VFPASH
Trigger: GTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAACAGAAGCAGCAGCTaGAAGTGCAGCCGGTACAAC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLNRSSS*KCSRYN
Trigger: GTTGTACCGGCTGCACTTTCAGCTGCTGCTTCTGTT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACACTCCCGGGTTGGTCCTaGCGAGGCCTAGAACGAGGG +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTLPGWS*RGLERG
Trigger: CCCTCGTTCTAGGCCTCGGCAGGACCAACCCGGGAG...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGAAATGTCTCGACGCCTaGGCCGTTTCATATTCTCTG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALKCLDA*AVSYSL
Trigger: CAGAGAATATGAAACGGCGCAGGCGTCGAGACATTT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGTCCTTCTCGTTTTCTaGTTCCAGAAGTTGTCGCGT +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALVLLVF*FQKLSR
Trigger: ACGCGACAACTTCTGGAAGCAGAAAACGAGAAGGAC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACCCAGTACATCAGGCTaGTCTGATCAGGGTTCAGCT +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKPSTSG*SDQGSA
Trigger: AGCTGAACCCTGATCAGAGCAGCCTGATGTACTGGG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATAGCAGGCGCTTGCAGTaGTCGTACACCTCAGGGTGG +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYSRRLQ*SYTSGW
Trigger: CCACCCTGAGGTGTACGAGCACTGCAAGCGCCTGCT...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAATCACTATCAGTAAGTaGAGCAGCAGGCGCTTGCAG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAITISK*SSRRLQ
Trigger: CTGCAAGCGCCTGCTGCTGCACTTACTGATAGTGAT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTTGACTTTTCCATCCTaGTCCACTGAGAGGTCCACC +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPLTFPS*STERST
Trigger: GGTGGACCTCTCAGTGGAGCAGGATGGAAAAGTCAA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATCTGCAGACAGGGGCTaGTTCAGTGCCCTGAAAATC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKSADRG*FSALKI
Trigger: GATTTTCAGGGCACTGAAGCAGCCCCTGTCTGCAGA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCGCCGCCGGTCACCTCTaGGGTCACCAACTAGACTTA +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVAAGHL*GHQLDL
Trigger: TAAGTCTAGTTGGTGACCGCAGAGGTGACCGGCGGC...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAAAGACGCCAAACTGCTaGTCACTGCTGTTGTCTTCG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSKTPNC*SLLLSS
Trigger: CGAAGACAACAGCAGTGAGCAGCAGTTTGGCGTCTT...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAAAGACGCCAAACTGCTaGTCACTGCTGTTGTCTTCG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAKTPNC*SLLLSS
Trigger: CGAAGACAACAGCAGTGAGCAGCAGTTTGGCGTCTT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTATCCTCGCGCCAGTCTaGGAAATCAAGCATCAGAGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLILAPV*EIKHQS
Trigger: GCTCTGATGCTTGATTTCCCAGACTGGCGCGAGGAT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAGCTCTCCAGAATGGATaGGCTCAGTCTGTCCATCAC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKALQNG*AQSVHH
Trigger: GTGATGGACAGACTGAGCCCATCCATTCTGGAGAGC...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATAGCCACTGTCAGGGGTaGACGCCAGCGTCTCGGGAG +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHSHCQG*TPASRE
Trigger: CTCCCGAGACGCTGGCGTCCACCCCTGACAGTGGCT...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGCCGCCGCTTGCACTGTaGCTAATGACACCAGCATCC +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTPPLAL*LMTPAS
Trigger: GGATGCTGGTGTCATTAGCCACAGTGCAAGCGGCGG...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
53% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGGCAGTGGCTCTCCTTaGTTGTGCTCCATCACTTTC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLGSGSP*LCSITF
Trigger: GAAAGTGATGGAGCACAACCAAGGAGAGCCACTGCC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCACGTAATCCACCAGTaGCGACCAGCAGCCTCCAGC +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPHVIHQ*RPAASS
Trigger: GCTGGAGGCTGCTGGTCGCCACTGGTGGATTACGTG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTTGGTGGAGATCAAGCTaGTCTGTTGGTCCCCGACTT +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLWWRSS*SVGPRL
Trigger: AAGTCGGGGACCAACAGACCAGCTTGATCTCCACCA...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTGGTGGAGATCAAGCTaGTCTGTTGGTCCCCGACTT +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHWWRSS*SVGPRL
Trigger: AAGTCGGGGACCAACAGACCAGCTTGATCTCCACCA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGGCTGGGGGTGCTGCTaGAACACGGGTACTCCTGGA +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEGWGCC*NTGTPG
Trigger: TCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCC...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTGTGCGTGACAGGATCTaGCTTGCGGTGAGGGCGGCT +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFVRDRI*LAVRAA
Trigger: AGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCAC...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACATCCTCTTCACAGATaGACTCGGGGTAGCTTTCAG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSHPLHR*TRGSFQ
Trigger: CTGAAAGCTACCCCGAGTCCATCTGTGAAGAGGATG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCGGAAAGCTGCTATTATaGCAGACAGAAAGGGGGTCG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPGKLLL*QTERGS
Trigger: CGACCCCCTTTCTGTCTGCCATAATAGCAGCTTTCC...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACATCCACAAAGACAGTaGGGCATTCAGAACAGGCCA +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSHPQRQ*GIQNRP
Trigger: TGGCCTGTTCTGAATGCCCCACTGTCTTTGTGGATG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATCTTCACAAATATATTaGGAGGGGTGTCACGGGGGA +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPASSQIY*EGCHGG
Trigger: TCCCCCGTGACACCCCTCTCAATATATTTGTGAAGA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACGAAGAGTGTTTCCTaGGGGAAGAATGACTCCTGT +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPATKSVS*GKNDSC
Trigger: ACAGGAGTCATTCTTCCCTCAGGAAACACTCTTCGT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATTGCTAACAGCTCAATaGGGTCCGTTCTGCTCATAC +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPALLTAQ*GPFCSY
Trigger: GTATGAGCAGAACGGACCTCATTGAGCTGTTAGCAA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGAAAATATACAAAGCCTaGAAGCACATCCTCGCGCCA +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALKIYKA*KHILAP
Trigger: TGGCGCGAGGATGTGCTTTCAGGCTTTGTATATTTT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAAATGTGTGAGGGGCTaGTCACATCAAACTGGTGGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLKCVRG*SHQTGG
Trigger: GCCACCAGTTTGATGTGATCAGCCCCTCACACATTT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGTGTTGTTGAGGAAGTaGGTTTCGCTATCAAGGCCG +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLVLLRK*VSLSRP
Trigger: CGGCCTTGATAGCGAAACTCACTTCCTCAACAACAC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCGCCACTAAGGCACTaGAATGGCATCGGATATCCT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSPLRH*NGIGYP
Trigger: AGGATATCCGATGCCATTTCAGTGCCTTAGTGGCGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTGCACCGGAACATTCTaGATGATATTCGCCACTAAG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALCTGTF*MIFATK
Trigger: CTTAGTGGCGAATATCATTCAGAATGTTCCGGTGCA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATCACAGCCCAACTGGTaGACCTTTTTATCCAGAGAG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSSQPNW*TFLSRE
Trigger: CTCTCTGGATAAAAAGGTTCACCAGTTGGGCTGTGA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATGCTCCAGCAGCAACGTaGCTGCTTCACAGCCCAACT +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYAPAAT*LLHSPT
Trigger: AGTTGGGCTGTGAAGCAGTCACGTTGCTGCTGGAGC...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGCCTGCTGGTCACCATaGGCTCTCGGTCTTTCAAGG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRACWSP*ALGLSR
Trigger: CCTTGAAAGACCGAGAGCTCATGGTGACCAGCAGGC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCTCGCTGTCATGTACATaGGATTGTTCAACACCATGG +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCSLSCT*DCSTPW
Trigger: CCATGGTGTTGAACAATCTCATGTACATGACAGCGA...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGTGAACGTGTAATCTaGGTGTGCCGTCTGCTTGAC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLCERVI*VCRLLD
Trigger: GTCAAGCAGACGGCACACTCAGATTACACGTTCACA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGACTTGTGCTTAGATTaGGCTGGCCAGTGCTTTTCC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLDLCLD*AGQCFS
Trigger: GGAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGGATCTGGCTTGCGGTaGGGGCGGCTTCTTCCTCTG +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIGSGLR*GRLLPL
Trigger: CAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGTGGGGGTCTCGTCTCTaGTCTGCAGTACGTCTTCTG +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTWGSRL*SAVRLL
Trigger: CAGAAGACGTACTGCAGATCAGAGACGAGACCCCCA...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTGTTCATCTTCCTCTTaGCTGGACAACCCTGAGAAG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPCSSSS*LDNPEK
Trigger: CTTCTCAGGGTTGTCCAGTCAAGAGGAAGATGAACA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCGTGTCCGACAGCGTCTaGTTGACATGGCAACGCCAC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFVSDSV*LTWQRH
Trigger: GTGGCGTTGCCATGTCAATCAGACGCTGTCGGACAC...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCTGGGCAAGTTCTTCTaGCATGTTGATGACCTCTGC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLLGKFF*HVDDLC
Trigger: GCAGAGGTCATCAACATGTCAGAAGAACTTGCCCAG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGTTTCGATCAGAGAGTaGATGGCAGTTTCTATCGTG +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALVSIRE*MAVSIV
Trigger: CACGATAGAAACTGCCATTCACTCTCTGATCGAAAC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCCATTAGCAATGCCGTaGTGGGAGTCCTGGGTCCTG +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPPLAMP*WESWVL
Trigger: CAGGACCCAGGACTCCCAGCACGGCATTGCTAATGG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAGGACGGGGAGGTGGCTaGGCTGCAGCAGAGGACCAG +
Preference number: 4 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVGRGGG*AAAEDQ
Trigger: CTGGTCCTCTGCTGCAGCGCAGCCACCTCCCCGTCC...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCTCCCGGGTTGGTCCTaGCGAGGCCTAGAACGAGGG +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQLPGWS*RGLERG
Trigger: CCCTCGTTCTAGGCCTCGGCAGGACCAACCCGGGAG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCATCAAGGCCGCCGCTTaGACTGTGGCTAATGACACC +
Preference number: 4 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSIKAAA*TVANDT
Trigger: GGTGTCATTAGCCACAGTGCAAGCGGCGGCCTTGAT...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAATCACTATCAGTAAGTaGAGCAGCAGGCGCTTGCAG +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKITISK*SSRRLQ
Trigger: CTGCAAGCGCCTGCTGCTGCACTTACTGATAGTGAT...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTTGACTTTTCCATCCTaGTCCACTGAGAGGTCCACC +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHLTFPS*STERST
Trigger: GGTGGACCTCTCAGTGGAGCAGGATGGAAAAGTCAA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGCCGCCGGTCACCTCTaGGGTCACCAACTAGACTTA +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRAAGHL*GHQLDL
Trigger: TAAGTCTAGTTGGTGACCGCAGAGGTGACCGGCGGC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGGGGACGACAAGACTTaGAGAGCGAGACACCACCAG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRGDDKT*RARHHQ
Trigger: CTGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
52% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGAAAATCTAAGGTCTTaGCGGGCAGCTCCTTCGAGA +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLENLRS*RAAPSR
Trigger: TCTCGAAGGAGCTGCCCGGCAAGACCTTAGATTTTC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTGTCTCCTTTGTCAATaGTGTCCAGCGAGCGCCGGC +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPCLLCQ*CPASAG
Trigger: GCCGGCGCTCGCTGGACAGCATTGACAAAGGAGACA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTACTGCGGGAGCCCTTTaGGAAAAGAGCAGACACTAT +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLTAGAL*EKSRHY
Trigger: ATAGTGTCTGCTCTTTTCCCAAAGGGCTCCCGCAGT...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACGTTATCAAGAAGGGTaGGGTGGACATCAGTCACTT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSRYQEG*GGHQSL
Trigger: AAGTGACTGATGTCCACCCCACCCTTCTTGATAACG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAGAACACAGTGGAATATaGGTTCCTTTCCAGAGGAGG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAEHSGI*VPFQRR
Trigger: CCTCCTCTGGAAAGGAACCCATATTCCACTGTGTTC...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCCACATGGAACACAGTaGAATATGGGTTCCTTTCCA +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALPHGTQ*NMGSFP
Trigger: TGGAAAGGAACCCATATTCCACTGTGTTCCATGTGG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAAGCCTTCGACCACATaGAACACAGTGGAATATGGG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPKPSTT*NTVEYG
Trigger: CCCATATTCCACTGTGTTCCATGTGGTCGAAGGCTT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAGAGACTTATAATCCATaGGTCTTGGCCTTGGGTCAC +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAETYNP*VLALGH
Trigger: GTGACCCAAGGCCAAGACCCATGGATTATAAGTCTC...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAGTAAGGCAAGAGGCTTaGTTCGCTATTCACTCCGCA +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKVRQEA*FAIHSA
Trigger: TGCGGAGTGAATAGCGAACCAAGCCTCTTGCCTTAC...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGTGCTTAGATTGAGCTaGCCAGTGCTTTTCCTGTTA +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALVLRLS*PVLFLL
Trigger: TAACAGGAAAAGCACTGGCCAGCTCAATCTAAGCAC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCCCGCGGCACTGTGTTaGCCTCCATACTTGTTCCCA +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFPAALC*PPYLFP
Trigger: TGGGAACAAGTATGGAGGCCAACACAGTGCCGCGGG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCAACGGAGGGATTCTTaGGGAGGCCAGATTCGGGGC +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHQRRDS*GGQIRG
Trigger: GCCCCGAATCTGGCCTCCCCAAGAATCCCTCCGTTG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGTACTCCTGGAGGGATaGTGTGTCTCCTTTGTCAAT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSVLLEG*CVSFVN
Trigger: ATTGACAAAGGAGACACACCATCCCTCCAGGAGTAC...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGTACCCTCAGGCAGCTaGCTGCTAGCATTATCTAGA +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLVPSGS*LLALSR
Trigger: TCTAGATAATGCTAGCAGCCAGCTGCCTGAGGGTAC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGTACCCTCAGGCAGCTaGCTGCTAGCATTATCTAGA +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLVPSGS*LLALSR
Trigger: TCTAGATAATGCTAGCAGCCAGCTGCCTGAGGGTAC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACATCCTCTTCACAGATaGACTCGGGGTAGCTTTCAG +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKHPLHR*TRGSFQ
Trigger: CTGAAAGCTACCCCGAGTCCATCTGTGAAGAGGATG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALCICLR*HRMSSC
Trigger: GCAAGAGGACATTCGGTGCCAACGAAGACATATACA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTACGAAGAGTGTTTCCTaGGGGAAGAATGACTCCTGT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLTKSVS*GKNDSC
Trigger: ACAGGAGTCATTCTTCCCTCAGGAAACACTCTTCGT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAAAATATACAAAGCCTaGAAGCACATCCTCGCGCCA +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPKIYKA*KHILAP
Trigger: TGGCGCGAGGATGTGCTTTCAGGCTTTGTATATTTT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCGACTGCTACAGAGGATaGCCAGGGCAAAGCCTTCGA +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPDCYRG*PGQSLR
Trigger: TCGAAGGCTTTGCCCTGGTCATCCTCTGTAGCAGTC...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACATCAAACTGGTGGCTaGTGGGAGAAGAGTTCCAAT +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKHQTGG*WEKSSN
Trigger: ATTGGAACTCTTCTCCCATCAGCCACCAGTTTGATG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCCCAAGAGAGTGTTGTTaGGGAAGTGAGTTTCGCTAT +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPPRECC*GSEFRY
Trigger: ATAGCGAAACTCACTTCCTCAACAACACTCTCTTGG...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGAACATGAACAGGCTGTaGCGCAGGCTCTGCTGGGGA +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLENMNRL*RRLCWG
Trigger: TCCCCAGCAGAGCCTGCGTCACAGCCTGTTCATGTT...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTACATCAGGCTGCTCTaGTCAGGGTTCAGCTCCAGC +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRYIRLL*SGFSSS
Trigger: GCTGGAGCTGAACCCTGATCAGAGCAGCCTGATGTA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATCGCTGTCATGTACATaGGATTGTTCAACACCATGG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSSLSCT*DCSTPW
Trigger: CCATGGTGTTGAACAATCTCATGTACATGACAGCGA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCTTGCAGATTCCAAGGTaGGAAGCAGTTCAATCACAA +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCLQIPR*EAVQSQ
Trigger: TTGTGATTGAACTGCTTCTCACCTTGGAATCTGCAA...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCTCTTGGGTAGACACTaGGGTAAAGCCCTTAAGGAA +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLLLGRH*GKALKE
Trigger: TTCCTTAAGGGCTTTACCTCAGTGTCTACCCAAGAG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGAGACGGAAATGAGCTaGCTGAGGAGGTGCACGGTC +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEETEMS*LRRCTV
Trigger: GACCGTGCACCTCCTCAGTCAGCTCATTTCCGTCTC...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAGTCTCTTTGCAAAACTaGGTTGGGCTGTCAAAATGC +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAVSLQN*VGLSKC
Trigger: GCATTTTGACAGCCCAACTCAGTTTTGCAAAGAGAC...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTGGGGGTCTCGTCTCTaGTCTGCAGTACGTCTTCTG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFWGSRL*SAVRLL
Trigger: CAGAAGACGTACTGCAGATCAGAGACGAGACCCCCA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCTTTCAAAGCCAAGGTaGCATCCTCTTCACAGATGG +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLLSKPR*HPLHRW
Trigger: CCATCTGTGAAGAGGATGTCACCTTGGCTTTGAAAG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATAAATGTCTCGACGCCTaGGCCGTTTCATATTCTCTG +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHKCLDA*AVSYSL
Trigger: CAGAGAATATGAAACGGCGCAGGCGTCGAGACATTT...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCATCAAGGCCGCCGCTTaGACTGTGGCTAATGACACC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFIKAAA*TVANDT
Trigger: GGTGTCATTAGCCACAGTGCAAGCGGCGGCCTTGAT...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGTCCTTCTCGTTTTCTaGTTCCAGAAGTTGTCGCGT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLVLLVF*FQKLSR
Trigger: ACGCGACAACTTCTGGAAGCAGAAAACGAGAAGGAC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTCTGCTGGGGAAAGATaGTTCTCCTCTGGTGCACCG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFSAGER*FSSGAP
Trigger: CGGTGCACCAGAGGAGAAGCATCTTTCCCCAGCAGA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTCTTCATCTTCATCCTaGCGCCTCCCTGAAGGCAGA +
Preference number: 4 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSSSSSS*RLPEGR
Trigger: TCTGCCTTCAGGGAGGCGGCAGGATGAAGATGAAGA...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAAAGACCCTCCGGAGCTaGTACTGTATCGGGACTCCA +
Preference number: 4 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLKTLRS*YCIGTP
Trigger: TGGAGTCCCGATACAGTAGCAGCTCCGGAGGGTCTT...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAGGCAATCCAGGAGATaGTGTTTCAGGCACGTAATC +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLRQSRR*CFRHVI
Trigger: GATTACGTGCCTGAAACAGCATCTCCTGGATTGCCT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCATCGGAGAGTGTGTCTaGAGACAGGGGCTGCTTCAG +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPIGECV*RQGLLQ
Trigger: CTGAAGCAGCCCCTGTCTGCAGACACACTCTCCGAT...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGCTTTTCCTGTTAGCTaGATACTTGTTTCCCATGAC +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCAFPVS*ILVSHD
Trigger: GTCATGGGAAACAAGTATGCAGCTAACAGGAAAAGC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATATCTGTAGCAACGACTaGTGCATGCTGGACAGTCCC +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDICSND*CMLDSP
Trigger: GGGACTGTCCAGCATGCAGCAGTCGTTGCTACAGAT...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATTCAGGCTGGGGGTGCTaGTGGAACACGGGTACTCCT +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHSGWGC*WNTGTP
Trigger: AGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGA...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATTGTTCAGCATCTGGGTaGGTGACAGGATCTGGCTTG +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDCSASG*VTGSGL
Trigger: CAAGCCAGATCCTGTCACGCACCCAGATGCTGAACA...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCGTCGGTTCCGTTCTaGCGTCGGTACCAGTCAAAC +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPSSVPF*RRYQSN
Trigger: GTTTGACTGGTACCGACGCCAGAACGGAACCGACGA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATGGACATCTGCACACTaGTCATACACATTGGTCTCC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKWTSAH*SYTLVS
Trigger: GGAGACCAATGTGTATGACCAGTGTGCAGATGTCCA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCATCCTCGCGCCAGTCTaGGAAATCAAGCATCAGAGC +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVILAPV*EIKHQS
Trigger: GCTCTGATGCTTGATTTCCCAGACTGGCGCGAGGAT...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACGTTATCAAGAAGGGTaGGGTGGACATCAGTCACTT +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKRYQEG*GGHQSL
Trigger: AAGTGACTGATGTCCACCCCACCCTTCTTGATAACG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACCACATGGAACACAGTaGAATATGGGTTCCTTTCCA +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAPHGTQ*NMGSFP
Trigger: TGGAAAGGAACCCATATTCCACTGTGTTCCATGTGG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTCTGCCAGTCTTCTCGTaGCAGGCCGACTGCTACAGA +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFLPVFS*QADCYR
Trigger: TCTGTAGCAGTCGGCCTGCCACGAGAAGACTGGCAG...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTGTCCATCACATCTATaGCTAACTCATCATCACCCT +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALCPSHL*LTHHHP
Trigger: AGGGTGATGATGAGTTAGCCATAGATGTGATGGACA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCTCAGAGCGCATCATTaGAACTATGTGCTTAAACAG +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCLRAHH*NYVLKQ
Trigger: CTGTTTAAGCACATAGTTCCAATGATGCGCTCTGAG...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCCGAGGAGGGTGGTGTaGAGGTGTGAAATGGCAGCG +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIPRRVV*RCEMAA
Trigger: CGCTGCCATTTCACACCTCCACACCACCCTCCTCGG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGCACGGTCATCTCTTaGGTAGACACTGAGGTAAAG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLCTVIS*VDTEVK
Trigger: CTTTACCTCAGTGTCTACCCAAGAGATGACCGTGCA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAAGTTGGAACAGTCTCTaGAGTAGGTATGTGTGCTGT +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPASWNSL*SRYVCC
Trigger: ACAGCACACATACCTACTCCAGAGACTGTTCCAACT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCCCTTGGGGATGTCATTaGGGACGACAAGACTTGCAG +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVPWGCH*GRQDLQ
Trigger: CTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGG...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAGTACTCCTGGAGGGATaGTGTGTCTCCTTTGTCAAT +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKVLLEG*CVSFVN
Trigger: ATTGACAAAGGAGACACACCATCCCTCCAGGAGTAC...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGTCGTCAGGGTCAGGCTaGGGGTGCTGCTGGAACACG +
Preference number: 4 (lower is better)
Translates to: SVTTTFPLALDMFSDVTASSGSG*GCCWNT
Trigger: CGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGA...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACATCTTCCTCTTGACTaGACAACCCTGAGAAGTCAG +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKHLPLD*TTLRSQ
Trigger: CTGACTTCTCAGGGTTGTCCAGTCAAGAGGAAGATG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCATCTTCCTCTTGACTaGACAACCCTGAGAAGTCAG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLHLPLD*TTLRSQ
Trigger: CTGACTTCTCAGGGTTGTCCAGTCAAGAGGAAGATG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATATTTCCAACTGGTTTaGTCTGTGCTAGGAGCGGAT +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAYFQLV*SVLGAD
Trigger: ATCCGCTCCTAGCACAGACCAAACCAGTTGGAAATA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATCCAAGAGAGTGTTGTTaGGGAAGTGAGTTTCGCTAT +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHPRECC*GSEFRY
Trigger: ATAGCGAAACTCACTTCCTCAACAACACTCTCTTGG...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGAACATGAACAGGCTGTaGCGCAGGCTCTGCTGGGGA +
Preference number: 4 (lower is better)
Translates to: HLLWLVINIDTSTDQRAENMNRL*RRLCWG
Trigger: TCCCCAGCAGAGCCTGCGTCACAGCCTGTTCATGTT...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAATCCTGCCGCCTCCCTaGAGGCAGAGGTTTGAGGTC +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTILPPP*RQRFEV
Trigger: GACCTCAAACCTCTGCCTTCAGGGAGGCGGCAGGAT...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCAGAATAAAGTGGCATTaGGTCACTTTTCTCCTCTTC +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCRIKWH*VTFLLF
Trigger: GAAGAGGAGAAAAGTGACTCAATGCCACTTTATTCT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCACCTCAGGGTGGCAGTaGTCAAACCCTATAAAAATT +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPTSGWQ*SNPIKI
Trigger: AATTTTTATAGGGTTTGATCACTGCCACCCTGAGGT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTGTTAAGAGGAAAGCCTaGCACCTGGGACGGATCCAC +
Preference number: 4 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGVKRKA*HLGRIH
Trigger: GTGGATCCGTCCCAGGTGTCAGGCTTTCCTCTTAAC...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTCCAGCTTCAGGATGTTaGGGGCTTCCTTCCAGTACG +
Preference number: 4 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGPASGC*GLPSST
Trigger: CGTACTGGAAGGAAGCCCTCAACATCCTGAAGCTGG...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTCAGAGATGTCAAAGTaGAAATCTAAGGTCTTGCCG +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPSEMSK*KSKVLP
Trigger: CGGCAAGACCTTAGATTTTCACTTTGACATCTCTGA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATCATCACTTCCAATaGGCTTTTAAACTTGGTACC +
Preference number: 4 (lower is better)
Translates to: GLQLKGVGPIPASLHPALHHHFQ*AFKLGT
Trigger: GGTACCAAGTTTAAAAGCTCATTGGAAGTGATGATG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCCAAGACGCCAAACTTaGGTGTTTCCAGCAAGCCAC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFPRRQT*VFPASH
Trigger: GTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAAAACAGAAGCAGCAGCTaGAAGTGCAGCCGGTACAAC +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKNRSSS*KCSRYN
Trigger: GTTGTACCGGCTGCACTTTCAGCTGCTGCTTCTGTT...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 15 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGTTTCGATCAGAGAGTaGATGGCAGTTTCTATCGTG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLVSIRE*MAVSIV
Trigger: CACGATAGAAACTGCCATTCACTCTCTGATCGAAAC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGTTTCGATCAGAGAGTaGATGGCAGTTTCTATCGTG +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLVSIRE*MAVSIV
Trigger: CACGATAGAAACTGCCATTCACTCTCTGATCGAAAC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCTGCAGCCTGGTGTATaGGAACATCCACGCATAGCT +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRLQPGV*EHPRIA
Trigger: AGCTATGCGTGGATGTTCGCATACACCAGGCTGCAG...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCTTCATCTTCATCCTaGCGCCTCCCTGAAGGCAGA +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSSSSS*RLPEGR
Trigger: TCTGCCTTCAGGGAGGCGGCAGGATGAAGATGAAGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATTCTGCAGACAGGGGCTaGTTCAGTGCCCTGAAAATC +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYSADRG*FSALKI
Trigger: GATTTTCAGGGCACTGAAGCAGCCCCTGTCTGCAGA...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTTTTCCTGTTAGCTaGATACTTGTTTCCCATGAC +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSAFPVS*ILVSHD
Trigger: GTCATGGGAAACAAGTATGCAGCTAACAGGAAAAGC...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGCCGCCGGTCACCTCTaGGGTCACCAACTAGACTTA +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHAAGHL*GHQLDL
Trigger: TAAGTCTAGTTGGTGACCGCAGAGGTGACCGGCGGC...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAATCTGTAGCAACGACTaGTGCATGCTGGACAGTCCC +
Preference number: 4 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLICSND*CMLDSP
Trigger: GGGACTGTCCAGCATGCAGCAGTCGTTGCTACAGAT...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCATCTCCAGATTAAACTaGTTGACCGGGGCCGCAGAC +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPISRLN*LTGAAD
Trigger: GTCTGCGGCCCCGGTCAAGCAGTTTAATCTGGAGAT...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCATCTCCAGATTAAACTaGTTGACCGGGGCCGCAGAC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFISRLN*LTGAAD
Trigger: GTCTGCGGCCCCGGTCAAGCAGTTTAATCTGGAGAT...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTGTTCAGCATCTGGGTaGGTGACAGGATCTGGCTTG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFCSASG*VTGSGL
Trigger: CAAGCCAGATCCTGTCACGCACCCAGATGCTGAACA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTGTTCAGCATCTGGGTaGGTGACAGGATCTGGCTTG +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPCSASG*VTGSGL
Trigger: CAAGCCAGATCCTGTCACGCACCCAGATGCTGAACA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACCCTCTGAAGAGATCTaGATAACAGCTTTTCCAAGG +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKPSEEI*ITAFPR
Trigger: CCTTGGAAAAGCTGTTATCCAGATCTCTTCAGAGGG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTTCGTCGGTTCCGTTCTaGCGTCGGTACCAGTCAAAC +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFSSVPF*RRYQSN
Trigger: GTTTGACTGGTACCGACGCCAGAACGGAACCGACGA...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCTCCTGTGGTGGGCATaGGAGGGTCTCCATCCTTCT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIILLWWA*EGLHPS
Trigger: AGAAGGATGGAGACCCTCCCATGCCCACCACAGGAG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACACTCCTGTGGTGGGCATaGGAGGGTCTCCATCCTTCT +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTLLWWA*EGLHPS
Trigger: AGAAGGATGGAGACCCTCCCATGCCCACCACAGGAG...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTACTGGTCATACACATTaGTCTCCCAACCTCTTTGTC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLTGHTH*SPNLFV
Trigger: GACAAAGAGGTTGGGAGACCAATGTGTATGACCAGT...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTGTCCATCACATCTATaGCTAACTCATCATCACCCT +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPCPSHL*LTHHHP
Trigger: AGGGTGATGATGAGTTAGCCATAGATGTGATGGACA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTACTAAGGCACTGAAATaGCATCGGATATCCTTCAGG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLTKALK*HRISFR
Trigger: CCTGAAGGATATCCGATGCCATTTCAGTGCCTTAGT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTAGCCGTCTGCAAGGGTaGTCCACACATTCTCCACCT +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFSRLQG*STHSPP
Trigger: AGGTGGAGAATGTGTGGACCACCCTTGCAGACGGCT...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCGTAAGGCAAGAGGCTTaGTTCGCTATTCACTCCGCA +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVVRQEA*FAIHSA
Trigger: TGCGGAGTGAATAGCGAACCAAGCCTCTTGCCTTAC...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATGAAGAAACGTCCTCATaGTTCCAAAGGGGCCCTCGT +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYEETSS*FQRGPR
Trigger: ACGAGGGCCCCTTTGGAACCATGAGGACGTTTCTTC...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCTTTGCAAAACTGAGTTaGGCTGTCAAAATGCTGGAT +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCFAKLS*AVKMLD
Trigger: ATCCAGCATTTTGACAGCCCAACTCAGTTTTGCAAA...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAACCTTGGGGATGTCATTaGGGACGACAAGACTTGCAG +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKPWGCH*GRQDLQ
Trigger: CTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGG...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACACCCGCGGCACTGTGTTaGCCTCCATACTTGTTCCCA +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTPAALC*PPYLFP
Trigger: TGGGAACAAGTATGGAGGCCAACACAGTGCCGCGGG...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCAGGAACTAGGGCGTTaGATGTGGAGCCAGAGGAGG +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIQELGR*MWSQRR
Trigger: CCTCCTCTGGCTCCACATCCAACGCCCTAGTTCCTG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCCATCCTCTTCACAGATaGACTCGGGGTAGCTTTCAG +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVHPLHR*TRGSFQ
Trigger: CTGAAAGCTACCCCGAGTCCATCTGTGAAGAGGATG...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATGGAAAGCTGCTATTATaGCAGACAGAAAGGGGGTCG +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDGKLLL*QTERGS
Trigger: CGACCCCCTTTCTGTCTGCCATAATAGCAGCTTTCC...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTGGCAGTTTCTATCGTaGTCTGGGCCGCTTTGGAGA +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPWQFLS*SGPLWR
Trigger: TCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTGGCAGTTTCTATCGTaGTCTGGGCCGCTTTGGAGA +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFWQFLS*SGPLWR
Trigger: TCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCGATCAGAGAGTGAATaGCAGTTTCTATCGTGGTCT +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLRSESE*QFLSWS
Trigger: AGACCACGATAGAAACTGCCATTCACTCTCTGATCG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 72 bp GCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTaGATCATCTTCAGCTTACTCCCTCTTGAGGGTTGC +
Preference number: 4 (lower is better)
Translates to: AQGFLKGAWLAV*IIFSLLPLEGC
Trigger: GCAACCCTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGAGATCTTCACCCCTCTaGAGAGATCTGGATAACAGC +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTRSSPL*RDLDNS
Trigger: GCTGTTATCCAGATCTCTTCAGAGGGGTGAAGATCT...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGACTGCTACAGAGGATaGCCAGGGCAAAGCCTTCGA +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIDCYRG*PGQSLR
Trigger: TCGAAGGCTTTGCCCTGGTCATCCTCTGTAGCAGTC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTCACAGCCCAACTGGTaGACCTTTTTATCCAGAGAG +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVSQPNW*TFLSRE
Trigger: CTCTCTGGATAAAAAGGTTCACCAGTTGGGCTGTGA...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGGCCTGCTGGTCACCATaGGCTCTCGGTCTTTCAAGG +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQACWSP*ALGLSR
Trigger: CCTTGAAAGACCGAGAGCTCATGGTGACCAGCAGGC...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAACCTCAGGGTGGCAGTaGTCAAACCCTATAAAAATT +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKTSGWQ*SNPIKI
Trigger: AATTTTTATAGGGTTTGATCACTGCCACCCTGAGGT...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTATTCCTTCTGCATTTaGCTGCTTGAAGACGGAAAC +
Preference number: 4 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHYSFCI*LLEDGN
Trigger: GTTTCCGTCTTCAAGCAGTCAAATGCAGAAGGAATA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTTTGCAGATTCCAAGGTaGGAAGCAGTTCAATCACAA +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLLQIPR*EAVQSQ
Trigger: TTGTGATTGAACTGCTTCTCACCTTGGAATCTGCAA...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGACTTGTGCTTAGATTaGGCTGGCCAGTGCTTTTCC +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRDLCLD*AGQCFS
Trigger: GGAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAAGTTTGCTCAGAAGCCTaGGAGCCAGGAGGTATTCAT +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKVCSEA*EPGGIH
Trigger: ATGAATACCTCCTGGCTCTCAGGCTTCTGAGCAAAC...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTACAAACTCATCATGTaGGCCAGGTTCACCAGCGTC +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPYKLIM*ARFTSV
Trigger: GACGCTGGTGAACCTGGCTCACATGATGAGTTTGTA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCCAGCTTCAGGATGTTaGGGGCTTCCTTCCAGTACG +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIPASGC*GLPSST
Trigger: CGTACTGGAAGGAAGCCCTCAACATCCTGAAGCTGG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTTCCAAATCCTCATTTaGAGAAAACACAACGGAGGG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLFQILI*RKHNGG
Trigger: CCCTCCGTTGTGTTTTCTTCAAATGAGGATTTGGAA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATGGCGGCTTCTTCCTCTaGGGACTCGTCGGTATCCTC +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDGGFFL*GLVGIL
Trigger: GAGGATACCGACGAGTCCTCAGAGGAAGAAGCCGCC...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCTGCTAGCAGAATCCTaGGACTGCAGCAGGTCCTGG +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQLLAES*DCSRSW
Trigger: CCAGGACCTGCTGCAGTCTCAGGATTCTGCTAGCAG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTGTTCATCTTCCTCTTaGCTGGACAACCCTGAGAAG +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVCSSSS*LDNPEK
Trigger: CTTCTCAGGGTTGTCCAGTCAAGAGGAAGATGAACA...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAGTGTCCGACAGCGTCTaGTTGACATGGCAACGCCAC +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLVSDSV*LTWQRH
Trigger: GTGGCGTTGCCATGTCAATCAGACGCTGTCGGACAC...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGGTGTCCGACAGCGTCTaGTTGACATGGCAACGCCAC +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQVSDSV*LTWQRH
Trigger: GTGGCGTTGCCATGTCAATCAGACGCTGTCGGACAC...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAACTGGGCAAGTTCTTCTaGCATGTTGATGACCTCTGC +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKLGKFF*HVDDLC
Trigger: GCAGAGGTCATCAACATGTCAGAAGAACTTGCCCAG...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAATACAAAGACTCCAGTaGAACTCGAGACATTTTAGG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSIQRLQ*NSRHFR
Trigger: CCTAAAATGTCTCGAGTTGCACTGGAGTCTTTGTAT...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAATCATTGGAACTATGTaGTTAAACAGGGAAGAAGGG +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSIIGTM*LNREEG
Trigger: CCCTTCTTCCCTGTTTAAGCACATAGTTCCAATGAT...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATGGCCTTCTTTCAAGTaGTTCTTTAATGATGGGATG +
Preference number: 4 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAWPSFK*FFNDGM
Trigger: CATCCCATCATTAAAGAAGCACTTGAAAGAAGGCCA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCTCTAGAAGAGTCAGCTaGTTTAAACAGTATCAGGTT +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCSRRVS*FKQYQV
Trigger: AACCTGATACTGTTTAAAGCAGCTGACTCTTCTAGA...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCCTTACTGTCAGGGTTaGCATCTGTGGGAGCGACCA +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIPYCQG*HLWERP
Trigger: TGGTCGCTCCCACAGATGGCAACCCTGACAGTAAGG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGGCTCTCCTTGGTTGTaGTCCATCACTTTCAGGCGC +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIGSPWL*SITFRR
Trigger: GCGCCTGAAAGTGATGGAGCACAACCAAGGAGAGCC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGAGGCAATCCAGGAGATaGTGTTTCAGGCACGTAATC +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTRQSRR*CFRHVI
Trigger: GATTACGTGCCTGAAACAGCATCTCCTGGATTGCCT...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTCAGGGGCTGCTTCAGTaGCCTGAAAATCTGGAAGGA +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFQGLLQ*PENLEG
Trigger: TCCTTCCAGATTTTCAGGGCACTGAAGCAGCCCCTG...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TTATGTTACAGACTTAGACAGTGGAGAAGGACATTGTGTGGTCTGGGAGTCGGTTCTGCAGACAGGGGCTaGTTCAGTGCCCTGAAAATC +
Preference number: 4 (lower is better)
Translates to: LCYRLRQWRRTLCGLGVGSADRG*FSALKI
Trigger: GATTTTCAGGGCACTGAAGCAGCCCCTGTCTGCAGA...ACCGACTCCCAGACCACACAATGTCCTTCTCCACTGTCTAAGTCTGTAACATAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATGGAGTAGGTATGTGTaGTGTACAAACTCATCATGT +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSWSRYV*CTNSSC
Trigger: ACATGATGAGTTTGTACAGCACACATACCTACTCCA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCGTGCTCCTGGTGACTaGGATCACCTTTGCCTTCCC +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQRAPGD*DHLCLP
Trigger: GGGAAGGCAAAGGTGATCGCAGTCACCAGGAGCACG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTATCAGGCTGGGGGTGCTaGTGGAACACGGGTACTCCT +
Preference number: 4 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVSGWGC*WNTGTP
Trigger: AGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGA...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATTGGCTGGAAAGCTaGTATTATGGCAGACAGAAA +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLHWLES*YYGRQK
Trigger: TTTCTGTCTGCCATAATAGCAGCTTTCCAGCCAATG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCATGTTGATGACCTCTaGTTCATTCTTGATGGTATT +
Preference number: 4 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCHVDDL*FILDGI
Trigger: AATACCATCAAGAATGAAGCAGAGGTCATCAACATG...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTTCTTCCTCACAGCCTaGAACTTTGACTGGGCAAGC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFFFLTA*NFDWAS
Trigger: GCTTGCCCAGTCAAAGTTCCAGGCTGTGAGGAAGAA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGAAGCTGATGACGCTCTaGACCACGTGTGGGCTCTGC +
Preference number: 4 (lower is better)
Translates to: SVTTTFPLALDMFSDVTAKLMTL*TTCGLC
Trigger: GCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTT...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCCTTCAGGCTCTTTGTTaGACATCTGCACACTGGTCA +
Preference number: 4 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSLQALC*TSAHWS
Trigger: TGACCAGTGTGCAGATGTCCAACAAAGAGCCTGAAG...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTGCTCTCCAGAATGGATaGGCTCAGTCTGTCCATCAC +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFALQNG*AQSVHH
Trigger: GTGATGGACAGACTGAGCCCATCCATTCTGGAGAGC...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTTTAACGCACAGTACTaGTGTCTGTTGATCTGCATA +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPFNAQY*CLLICI
Trigger: TATGCAGATCAACAGACACCAGTACTGTGCGTTAAA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATTTAACGCACAGTACTaGTGTCTGTTGATCTGCATA +
Preference number: 4 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSFNAQY*CLLICI
Trigger: TATGCAGATCAACAGACACCAGTACTGTGCGTTAAA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTCACAGAATAGAGATGTaGCAGCGGGGACAGCTGACT +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFHRIEM*QRGQLT
Trigger: AGTCAGCTGTCCCCGCTGCCACATCTCTATTCTGTG...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCAGGGTTGCCATCTGTaGGAGCGACCATTGTATTGC +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEQGCHL*ERPLYC
Trigger: GCAATACAATGGTCGCTCCCACAGATGGCAACCCTG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCATCAAGCTGGTCTGTTaGTCCCCGACTTCCAAATCC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFIKLVC*SPTSKS
Trigger: GGATTTGGAAGTCGGGGACCAACAGACCAGCTTGAT...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATCATCTTCCTCTTGACTaGACAACCCTGAGAAGTCAG +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDHLPLD*TTLRSQ
Trigger: CTGACTTCTCAGGGTTGTCCAGTCAAGAGGAAGATG...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCGGAAAGCTGCTATTATaGCAGACAGAAAGGGGGTCG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFGKLLL*QTERGS
Trigger: CGACCCCCTTTCTGTCTGCCATAATAGCAGCTTTCC...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGGTCTGGGCCGCTTTaGAGATATCAATTTCTTCAT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLWSGPL*RYQFLH
Trigger: ATGAAGAAATTGATATCTCCAAAGCGGCCCAGACCA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAGTTCAAATGTAGTCTaGTACAGCATCTCCACAAAA +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPSSNVV*YSISTK
Trigger: TTTTGTGGAGATGCTGTATCAGACTACATTTGAACT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCTTCACAAATATATTaGGAGGGGTGTCACGGGGGA +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSSQIY*EGCHGG
Trigger: TCCCCCGTGACACCCCTCTCAATATATTTGTGAAGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTAAATGTGTGAGGGGCTaGTCACATCAAACTGGTGGC +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFKCVRG*SHQTGG
Trigger: GCCACCAGTTTGATGTGATCAGCCCCTCACACATTT...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTAGAATAAAGTGGCATTaGGTCACTTTTCTCCTCTTC +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLRIKWH*VTFLLF
Trigger: GAAGAGGAGAAAAGTGACTCAATGCCACTTTATTCT...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGGCAACTTCTTCTTCTTaGATTATGTCCTCGGTGGTG +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTATSSS*IMSSVV
Trigger: CACCACCGAGGACATAATTCAAGAAGAAGAAGTTGC...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
48% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGAGAAGTCGAAGTCCTTaGAGACGCCAAACTGCTGCT +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLERSRSP*RRQTAA
Trigger: AGCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCT...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATCTTTCAAAGCCAAGGTaGCATCCTCTTCACAGATGG +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYLSKPR*HPLHRW
Trigger: CCATCTGTGAAGAGGATGTCACCTTGGCTTTGAAAG...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAATGTTCATCTTCCTCTTaGCTGGACAACCCTGAGAAG +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKCSSSS*LDNPEK
Trigger: CTTCTCAGGGTTGTCCAGTCAAGAGGAAGATGAACA...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTGTCTGAAACAGTCTTaGAAACACGTGGAAAGTAAA +
Preference number: 4 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPCLKQS*KHVESK
Trigger: TTTACTTTCCACGTGTTTTCAAGACTGTTTCAGACA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACATCATCACTTCCAATaGGCTTTTAAACTTGGTACC +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKHHHFQ*AFKLGT
Trigger: GGTACCAAGTTTAAAAGCTCATTGGAAGTGATGATG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATCCAAGACGCCAAACTTaGGTGTTTCCAGCAAGCCAC +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHPRRQT*VFPASH
Trigger: GTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGG...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCTGGGCAAGTTCTTCTaGCATGTTGATGACCTCTGC +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHLGKFF*HVDDLC
Trigger: GCAGAGGTCATCAACATGTCAGAAGAACTTGCCCAG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTATACAAAGACTCCAGTaGAACTCGAGACATTTTAGG +
Preference number: 4 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLIQRLQ*NSRHFR
Trigger: CCTAAAATGTCTCGAGTTGCACTGGAGTCTTTGTAT...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCTTTGTTGGACATCTaGACACTGGTCATACACATT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSLLDI*TLVIHI
Trigger: AATGTGTATGACCAGTGTGCAGATGTCCAACAAAGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTTGGGAAGGTTTTCTTaGTTTAGGAAACTGGAGAGA +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLLGRFS*FRKLER
Trigger: TCTCTCCAGTTTCCTAAAGCAAGAAAACCTTCCCAA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAATCATTGGAACTATGTaGTTAAACAGGGAAGAAGGG +
Preference number: 4 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKIIGTM*LNREEG
Trigger: CCCTTCTTCCCTGTTTAAGCACATAGTTCCAATGAT...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGGCCTTCTTTCAAGTaGTTCTTTAATGATGGGATG +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLWPSFK*FFNDGM
Trigger: CATCCCATCATTAAAGAAGCACTTGAAAGAAGGCCA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGGTGTCTGTTGATCTaGATATTCCTGTCACTGTAT +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLWCLLI*IFLSLY
Trigger: ATACAGTGACAGGAATATGCAGATCAACAGACACCA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACACAGCAGCAACGTGACTaGTTCACAGCCCAACTGGTG +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTQQQRD*FTAQLV
Trigger: CACCAGTTGGGCTGTGAAGCAGTCACGTTGCTGCTG...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCCCAGTACATCAGGCTaGTCTGATCAGGGTTCAGCT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIPSTSG*SDQGSA
Trigger: AGCTGAACCCTGATCAGAGCAGCCTGATGTACTGGG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATTTCGGCTCCAGGATCTaGAAGAGTTGCATAGCAACT +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYFGSRI*KSCIAT
Trigger: AGTTGCTATGCAACTCTTGCAGATCCTGGAGCCGAA...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAAGACGCCAAACTGCTaGTCACTGCTGTTGTCTTCG +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHKTPNC*SLLLSS
Trigger: CGAAGACAACAGCAGTGAGCAGCAGTTTGGCGTCTT...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCACCGAATGTCCTCTTaGAGTTGTCTAGCCACTGCT +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEHRMSS*SCLATA
Trigger: AGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCCCCTCTGAAGAGATCTaGATAACAGCTTTTCCAAGG +
Preference number: 4 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSPSEEI*ITAFPR
Trigger: CCTTGGAAAAGCTGTTATCCAGATCTCTTCAGAGGG...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGACTGCGGGAGCCCTTTaGGAAAAGAGCAGACACTAT +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLETAGAL*EKSRHY
Trigger: ATAGTGTCTGCTCTTTTCCCAAAGGGCTCCCGCAGT...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGACTGGTCATACACATTaGTCTCCCAACCTCTTTGTC +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTTGHTH*SPNLFV
Trigger: GACAAAGAGGTTGGGAGACCAATGTGTATGACCAGT...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCTTCAGGCTCTTTGTTaGACATCTGCACACTGGTCA +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRLQALC*TSAHWS
Trigger: TGACCAGTGTGCAGATGTCCAACAAAGAGCCTGAAG...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGTCAAGAAGGGTGGGGTaGACATCAGTCACTTCACGA +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLESRRVG*TSVTSR
Trigger: TCGTGAAGTGACTGATGTCCACCCCACCCTTCTTGA...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCTGATCACATCAAACTaGTGGCTGATGGGAGAAGAG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRLITSN*WLMGEE
Trigger: CTCTTCTCCCATCAGCCACCAGTTTGATGTGATCAG...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCGAGACTTATAATCCATaGGTCTTGGCCTTGGGTCAC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFETYNP*VLALGH
Trigger: GTGACCCAAGGCCAAGACCCATGGATTATAAGTCTC...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCACTAAGGCACTGAAATaGCATCGGATATCCTTCAGG +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVTKALK*HRISFR
Trigger: CCTGAAGGATATCCGATGCCATTTCAGTGCCTTAGT...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGGCAGTGGCTCTCCTTaGTTGTGCTCCATCACTTTC +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIGSGSP*LCSITF
Trigger: GAAAGTGATGGAGCACAACCAAGGAGAGCCACTGCC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCCACCTTCACGCTGTaGTCAATGATCAGATCTGTC +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSTFTL*SMIRSV
Trigger: GACAGATCTGATCATTGACCACAGCGTGAAGGTGGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTTGCTATCCAAAAGATaGTGGCCATCAGGTTGCTCG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFLLSKR*WPSGCS
Trigger: CGAGCAACCTGATGGCCACCATCTTTTGGATAGCAA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATTTATCCAGAGGCAAGTaGGTGAGCAGTTTGCTCAGA +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYLSRGK*VSSLLR
Trigger: TCTGAGCAAACTGCTCACCCACTTGCCTCTGGATAA...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTGCACGGTCATCTCTTaGGTAGACACTGAGGTAAAG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRCTVIS*VDTEVK
Trigger: CTTTACCTCAGTGTCTACCCAAGAGATGACCGTGCA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAATGCACGGTCATCTCTTaGGTAGACACTGAGGTAAAG +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKCTVIS*VDTEVK
Trigger: CTTTACCTCAGTGTCTACCCAAGAGATGACCGTGCA...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAGTACTCCTGGAGGGATaGTGTGTCTCCTTTGTCAAT +
Preference number: 4 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLVLLEG*CVSFVN
Trigger: ATTGACAAAGGAGACACACCATCCCTCCAGGAGTAC...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTCICLR*HRMSSC
Trigger: GCAAGAGGACATTCGGTGCCAACGAAGACATATACA...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
48% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTGGCAGTTTCTATCGTaGTCTGGGCCGCTTTGGAGA +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIWQFLS*SGPLWR
Trigger: TCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCA...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATCATTCCTGCATGAACTaGAAGGATGCTTCGAAATCT +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDHSCMN*KDASKS
Trigger: AGATTTCGAAGCATCCTTTCAGTTCATGCAGGAATG...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCATCAAACTGGTGGCTaGTGGGAGAAGAGTTCCAAT +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHHQTGG*WEKSSN
Trigger: ATTGGAACTCTTCTCCCATCAGCCACCAGTTTGATG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTCGCCACTAAGGCACTaGAATGGCATCGGATATCCT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIISPLRH*NGIGYP
Trigger: AGGATATCCGATGCCATTTCAGTGCCTTAGTGGCGA...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCCGGAACATTCTGAATaGTATTCGCCACTAAGGCAC +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEPEHSE*YSPLRH
Trigger: GTGCCTTAGTGGCGAATATCATTCAGAATGTTCCGG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCCGGAACATTCTGAATaGTATTCGCCACTAAGGCAC +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHPEHSE*YSPLRH
Trigger: GTGCCTTAGTGGCGAATATCATTCAGAATGTTCCGG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATTGCACCGGAACATTCTaGATGATATTCGCCACTAAG +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYCTGTF*MIFATK
Trigger: CTTAGTGGCGAATATCATTCAGAATGTTCCGGTGCA...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTATCTGGATCCGCTGGCTaGTCTCTGAGAATATGGCGA +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLSGSAG*SLRIWR
Trigger: TCGCCATATTCTCAGAGATCAGCCAGCGGATCCAGA...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGCAACTTCTTCTTCTTaGATTATGTCCTCGGTGGTG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRATSSS*IMSSVV
Trigger: CACCACCGAGGACATAATTCAAGAAGAAGAAGTTGC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCGCAACTTCTTCTTCTTaGATTATGTCCTCGGTGGTG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFATSSS*IMSSVV
Trigger: CACCACCGAGGACATAATTCAAGAAGAAGAAGTTGC...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCCAAATGTCGGAGAATaGTGTCTAATGCTTTTCTTA +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLPNVGE*CLMLFL
Trigger: TAAGAAAAGCATTAGACAGCATTCTCCGACATTTGG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAATCAACCTTGGAATTaGAGCAATGCAGGTTCTAAA +
Preference number: 4 (lower is better)
Translates to: LKGVGPIPASLHPALQHLNQPWN*SNAGSK
Trigger: TTTAGAACCTGCATTGCTGCAATTCCAAGGTTGATT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCCTTACTGTCAGGGTTaGCATCTGTGGGAGCGACCA +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDPYCQG*HLWERP
Trigger: TGGTCGCTCCCACAGATGGCAACCCTGACAGTAAGG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATATCGGAGAGTGTGTCTaGAGACAGGGGCTGCTTCAG +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDIGECV*RQGLLQ
Trigger: CTGAAGCAGCCCCTGTCTGCAGACACACTCTCCGAT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTGTAGCAACGACTGCTaGATGCTGGACAGTCCCTTT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIICSNDC*MLDSPF
Trigger: AAAGGGACTGTCCAGCATGCAGCAGTCGTTGCTACA...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCCATTGGCTGGAAAGCTaGTATTATGGCAGACAGAAA +
Preference number: 4 (lower is better)
Translates to: TACGANVQENTGFSLGGVHWLES*YYGRQK
Trigger: TTTCTGTCTGCCATAATAGCAGCTTTCCAGCCAATG...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGCATTGGCTGGAAAGCTaGTATTATGGCAGACAGAAA +
Preference number: 4 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTHWLES*YYGRQK
Trigger: TTTCTGTCTGCCATAATAGCAGCTTTCCAGCCAATG...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATCACCGAATGTCCTCTTaGAGTTGTCTAGCCACTGCT +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHHRMSS*SCLATA
Trigger: AGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTG...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCATCGGGAATCAACCTTaGAATTGCAGCAATGCAGGT +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFIGNQP*NCSNAG
Trigger: ACCTGCATTGCTGCAATTCCAAGGTTGATTCCCGAT...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATAGTTCTTCATCCATGTaGATTGTGAGCCTTGCTAAC +
Preference number: 4 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDSSSSM*IVSLAN
Trigger: GTTAGCAAGGCTCACAATCCACATGGATGAAGAACT...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCTGATCACATCAAACTaGTGGCTGATGGGAGAAGAG +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLELITSN*WLMGEE
Trigger: CTCTTCTCCCATCAGCCACCAGTTTGATGTGATCAG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCATGGGTCTTGGCCTTaGGTCACATGTGCAAATATC +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHHGSWP*VTCANI
Trigger: GATATTTGCACATGTGACCCAAGGCCAAGACCCATG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGATAATCCATGGGTCTTaGCCTTGGGTCACATGTGCA +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEIIHGS*PWVTCA
Trigger: TGCACATGTGACCCAAGGCCAAGACCCATGGATTAT...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACTTGCTATCCAAAAGATaGTGGCCATCAGGTTGCTCG +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHLLSKR*WPSGCS
Trigger: CGAGCAACCTGATGGCCACCATCTTTTGGATAGCAA...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACTTATCCAGAGGCAAGTaGGTGAGCAGTTTGCTCAGA +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHLSRGK*VSSLLR
Trigger: TCTGAGCAAACTGCTCACCCACTTGCCTCTGGATAA...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACATGGTGGAGATCAAGCTaGTCTGTTGGTCCCCGACTT +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTWWRSS*SVGPRL
Trigger: AAGTCGGGGACCAACAGACCAGCTTGATCTCCACCA...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGGTCCTCGTAAGCCATTaGCTGGAAAGCTGCTATTAT +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRVLVSH*LESCYY
Trigger: ATAATAGCAGCTTTCCAGCCAATGGCTTACGAGGAC...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACACATCCACAAAGACAGTaGGGCATTCAGAACAGGCCA +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTHPQRQ*GIQNRP
Trigger: TGGCCTGTTCTGAATGCCCCACTGTCTTTGTGGATG...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRCICLR*HRMSSC
Trigger: GCAAGAGGACATTCGGTGCCAACGAAGACATATACA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGTGGCAGTTTCTATCGTaGTCTGGGCCGCTTTGGAGA +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQWQFLS*SGPLWR
Trigger: TCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCA...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCGATCAGAGAGTGAATaGCAGTTTCTATCGTGGTCT +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPRSESE*QFLSWS
Trigger: AGACCACGATAGAAACTGCCATTCACTCTCTGATCG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 72 bp GCATGCTCTGAGAAGCTGTCACCAGACATCCACACCTaGAAAATAGGACTGTCACACACATACACACACACT +
Preference number: 4 (lower is better)
Translates to: ACSEKLSPDIHT*KIGLSHTYTHT
Trigger: AGTGTGTGTGTATGTGTGTGACAGTCCTATTTTCAAGGTGTGGATGTCTGGTGACAGCTTCTCAGAGCATGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 72 bp TACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTaGGACATGTTCTCTGATGTAACAGCGTGTGGCGCG +
Preference number: 4 (lower is better)
Translates to: YTPSVTTTFPLA*DMFSDVTACGA
Trigger: CGCGCCACACGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 72 bp AACTACGTCAGCAGTCCGACGGCGTGCACAGTGGCCTaGATTAATGCACTTGAGCATAATTACATTTCTGTC +
Preference number: 4 (lower is better)
Translates to: NYVSSPTACTVA*INALEHNYISV
Trigger: GACAGAAATGTAATTATGCTCAAGTGCATTAATCAAGGCCACTGTGCACGCCGTCGGACTGCTGACGTAGTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCATTCCTGCATGAACTaGAAGGATGCTTCGAAATCT +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPHSCMN*KDASKS
Trigger: AGATTTCGAAGCATCCTTTCAGTTCATGCAGGAATG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACATTGCTAACAGCTCAATaGGGTCCGTTCTGCTCATAC +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTLLTAQ*GPFCSY
Trigger: GTATGAGCAGAACGGACCTCATTGAGCTGTTAGCAA...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGTGTGAACGTGTAATCTaGGTGTGCCGTCTGCTTGAC +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQCERVI*VCRLLD
Trigger: GTCAAGCAGACGGCACACTCAGATTACACGTTCACA...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAGTTTGCTCAGAAGCCTaGGAGCCAGGAGGTATTCAT +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTVCSEA*EPGGIH
Trigger: ATGAATACCTCCTGGCTCTCAGGCTTCTGAGCAAAC...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCTCTTGGGTAGACACTaGGGTAAAGCCCTTAAGGAA +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIILLGRH*GKALKE
Trigger: TTCCTTAAGGGCTTTACCTCAGTGTCTACCCAAGAG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACGTCTCTTTGCAAAACTaGGTTGGGCTGTCAAAATGC +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHVSLQN*VGLSKC
Trigger: GCATTTTGACAGCCCAACTCAGTTTTGCAAAGAGAC...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTATACAAACTCATCATGTaGGCCAGGTTCACCAGCGTC +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLYKLIM*ARFTSV
Trigger: GACGCTGGTGAACCTGGCTCACATGATGAGTTTGTA...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCAGAGATGTCAAAGTaGAAATCTAAGGTCTTGCCG +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSEMSK*KSKVLP
Trigger: CGGCAAGACCTTAGATTTTCACTTTGACATCTCTGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTTCCAAATCCTCATTTaGAGAAAACACAACGGAGGG +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFFQILI*RKHNGG
Trigger: CCCTCCGTTGTGTTTTCTTCAAATGAGGATTTGGAA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAAGAAGTCGAAGTCCTTaGAGACGCCAAACTGCTGCT +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLRSRSP*RRQTAA
Trigger: AGCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCT...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCGGCTCCAGGATCTaGAAGAGTTGCATAGCAACT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIFGSRI*KSCIAT
Trigger: AGTTGCTATGCAACTCTTGCAGATCCTGGAGCCGAA...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATAGCCAAGGTATCAATTaGAGATTCCAAGGTGAGAAG +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYSQGIN*RFQGEK
Trigger: CTTCTCACCTTGGAATCTGCAATTGATACCTTGGCT...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGTGTAGCAACGACTGCTaGATGCTGGACAGTCCCTTT +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQCSNDC*MLDSPF
Trigger: AAAGGGACTGTCCAGCATGCAGCAGTCGTTGCTACA...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTATGTAGCAACGACTGCTaGATGCTGGACAGTCCCTTT +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLCSNDC*MLDSPF
Trigger: AAAGGGACTGTCCAGCATGCAGCAGTCGTTGCTACA...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATATCTGTAGCAACGACTaGTGCATGCTGGACAGTCCC +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDICSND*CMLDSP
Trigger: GGGACTGTCCAGCATGCAGCAGTCGTTGCTACAGAT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACATGGACATCTGCACACTaGTCATACACATTGGTCTCC +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTWTSAH*SYTLVS
Trigger: GGAGACCAATGTGTATGACCAGTGTGCAGATGTCCA...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCAGTTCTTCATCCATGTaGATTGTGAGCCTTGCTAAC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFSSSSM*IVSLAN
Trigger: GTTAGCAAGGCTCACAATCCACATGGATGAAGAACT...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAGCCTTCGACCACATaGAACACAGTGGAATATGGG +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTKPSTT*NTVEYG
Trigger: CCCATATTCCACTGTGTTCCATGTGGTCGAAGGCTT...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCCGTTTCATATTCTCTaGCCTTCTTTCAAGTGCTTC +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPPFHIL*PSFKCF
Trigger: GAAGCACTTGAAAGAAGGCCAGAGAATATGAAACGG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCAATTTTCAGGTTCTTTaGCCAGCCGTCTGCAAGGGT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIINFQVL*PAVCKG
Trigger: ACCCTTGCAGACGGCTGGCCAAAGAACCTGAAAATT...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCGGTCATAGTGCTTCATaGTTTCAGCCAAGGTATCAA +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPGHSAS*FQPRYQ
Trigger: TTGATACCTTGGCTGAAACCATGAAGCACTATGACC...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATGGTCATAGTGCTTCATaGTTTCAGCCAAGGTATCAA +
Preference number: 4 (lower is better)
Translates to: ACGANVQENTGFSLGGVYGHSAS*FQPRYQ
Trigger: TTGATACCTTGGCTGAAACCATGAAGCACTATGACC...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTATCCAGAGGCAAGTaGGTGAGCAGTTTGCTCAGA +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIILSRGK*VSSLLR
Trigger: TCTGAGCAAACTGCTCACCCACTTGCCTCTGGATAA...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCCTTGGGGATGTCATTaGGGACGACAAGACTTGCAG +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDPWGCH*GRQDLQ
Trigger: CTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAATCAAGCTGGTCTGTTaGTCCCCGACTTCCAAATCC +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTIKLVC*SPTSKS
Trigger: GGATTTGGAAGTCGGGGACCAACAGACCAGCTTGAT...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGGTACCCTCAGGCAGCTaGCTGCTAGCATTATCTAGA +
Preference number: 4 (lower is better)
Translates to: SVTTTFPLALDMFSDVTAVPSGS*LLALSR
Trigger: TCTAGATAATGCTAGCAGCCAGCTGCCTGAGGGTAC...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCATCCACAAAGACAGTaGGGCATTCAGAACAGGCCA +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQHPQRQ*GIQNRP
Trigger: TGGCCTGTTCTGAATGCCCCACTGTCTTTGTGGATG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTGGTCTGGGCCGCTTTaGAGATATCAATTTCTTCAT +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFWSGPL*RYQFLH
Trigger: ATGAAGAAATTGATATCTCCAAAGCGGCCCAGACCA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGTATTTCCAACTGGTTTaGTCTGTGCTAGGAGCGGAT +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEYFQLV*SVLGAD
Trigger: ATCCGCTCCTAGCACAGACCAAACCAGTTGGAAATA...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 72 bp CACTTCACCCTGCCCTGCAACATCTTGGGGCCATTATaGCAAACATCCTTGGAATTTCTTCTTTTCTCCAGA +
Preference number: 4 (lower is better)
Translates to: HFTLPCNILGPL*QTSLEFLLFSR
Trigger: TCTGGAGAAAAGAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGGTGAAGTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACATCCATGTGGATTGTaGGCCTTGCTAACAGCTCAA +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLHPCGL*ALLTAQ
Trigger: TTGAGCTGTTAGCAAGGCTCACAATCCACATGGATG...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAGTCTCTTTGCAAAACTaGGTTGGGCTGTCAAAATGC +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTVSLQN*VGLSKC
Trigger: GCATTTTGACAGCCCAACTCAGTTTTGCAAAGAGAC...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGTTCCAAATCCTCATTTaGAGAAAACACAACGGAGGG +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEFQILI*RKHNGG
Trigger: CCCTCCGTTGTGTTTTCTTCAAATGAGGATTTGGAA...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAAGAAGTCGAAGTCCTTaGAGACGCCAAACTGCTGCT +
Preference number: 4 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVRSRSP*RRQTAA
Trigger: AGCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCT...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTGTCTGAAACAGTCTTaGAAACACGTGGAAAGTAAA +
Preference number: 4 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSCLKQS*KHVESK
Trigger: TTTACTTTCCACGTGTTTTCAAGACTGTTTCAGACA...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCATCATCACTTCCAATaGGCTTTTAAACTTGGTACC +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFHHHFQ*AFKLGT
Trigger: GGTACCAAGTTTAAAAGCTCATTGGAAGTGATGATG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCATGAACTGAAAGGATaGTTCGAAATCTTCCACGGG +
Preference number: 4 (lower is better)
Translates to: HLLWLVINIDTSTDQRAEHELKG*FEIFHG
Trigger: CCCGTGGAAGATTTCGAAGCATCCTTTCAGTTCATG...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCTTTGTTGGACATCTaGACACTGGTCATACACATT +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSLLDI*TLVIHI
Trigger: AATGTGTATGACCAGTGTGCAGATGTCCAACAAAGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGAGCCAAGGTATCAATTaGAGATTCCAAGGTGAGAAG +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLESQGIN*RFQGEK
Trigger: CTTCTCACCTTGGAATCTGCAATTGATACCTTGGCT...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAATGGAGTAGGTATGTGTaGTGTACAAACTCATCATGT +
Preference number: 4 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKWSRYV*CTNSSC
Trigger: ACATGATGAGTTTGTACAGCACACATACCTACTCCA...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCCATGTTGATGACCTCTaGTTCATTCTTGATGGTATT +
Preference number: 4 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSHVDDL*FILDGI
Trigger: AATACCATCAAGAATGAAGCAGAGGTCATCAACATG...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAGAACACAGTGGAATATaGGTTCCTTTCCAGAGGAGG +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLEHSGI*VPFQRR
Trigger: CCTCCTCTGGAAAGGAACCCATATTCCACTGTGTTC...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCATGGGTCTTGGCCTTaGGTCACATGTGCAAATATC +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQHGSWP*VTCANI
Trigger: GATATTTGCACATGTGACCCAAGGCCAAGACCCATG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCCGTTTCATATTCTCTaGCCTTCTTTCAAGTGCTTC +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHPFHIL*PSFKCF
Trigger: GAAGCACTTGAAAGAAGGCCAGAGAATATGAAACGG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGAATTTTCAGGTTCTTTaGCCAGCCGTCTGCAAGGGT +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQNFQVL*PAVCKG
Trigger: ACCCTTGCAGACGGCTGGCCAAAGAACCTGAAAATT...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACATCCACCTTCACGCTGTaGTCAATGATCAGATCTGTC +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTSTFTL*SMIRSV
Trigger: GACAGATCTGATCATTGACCACAGCGTGAAGGTGGA...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATAGTTGGAACAGTCTCTaGAGTAGGTATGTGTGCTGT +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHSWNSL*SRYVCC
Trigger: ACAGCACACATACCTACTCCAGAGACTGTTCCAACT...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAATCAAGCTGGTCTGTTaGTCCCCGACTTCCAAATCC +
Preference number: 4 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVIKLVC*SPTSKS
Trigger: GGATTTGGAAGTCGGGGACCAACAGACCAGCTTGAT...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGTCCTCGTAAGCCATTaGCTGGAAAGCTGCTATTAT +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIVLVSH*LESCYY
Trigger: ATAATAGCAGCTTTCCAGCCAATGGCTTACGAGGAC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTTGGTCTGGGCCGCTTTaGAGATATCAATTTCTTCAT +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFWSGPL*RYQFLH
Trigger: ATGAAGAAATTGATATCTCCAAAGCGGCCCAGACCA...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACATATTTCCAACTGGTTTaGTCTGTGCTAGGAGCGGAT +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTYFQLV*SVLGAD
Trigger: ATCCGCTCCTAGCACAGACCAAACCAGTTGGAAATA...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
3UTR CAA 72 bp ATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTaGCAAACAAAAGTCACAGTGGAGAAGAGATGCATA +
Preference number: 4 (lower is better)
Translates to: ISIPNSGASEPS*QTKVTVEKRCI
Trigger: TATGCATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAACTTCTAAGAAATACTaGGCGCATTCCTGCATGAAC +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTTSKKY*AHSCMN
Trigger: GTTCATGCAGGAATGCGCTCAGTATTTCTTAGAAGT...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCAAATCCAAACGTTCCTaGGCAATGAACTGGATGATC +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIKSKRS*AMNWMI
Trigger: GATCATCCAGTTCATTGCTCAGGAACGTTTGGATTT...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTATTCCTTCTGCATTTaGCTGCTTGAAGACGGAAAC +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIYSFCI*LLEDGN
Trigger: GTTTCCGTCTTCAAGCAGTCAAATGCAGAAGGAATA...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATTTGCAGATTCCAAGGTaGGAAGCAGTTCAATCACAA +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHLQIPR*EAVQSQ
Trigger: TTGTGATTGAACTGCTTCTCACCTTGGAATCTGCAA...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCTCTTGGGTAGACACTaGGGTAAAGCCCTTAAGGAA +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDLLGRH*GKALKE
Trigger: TTCCTTAAGGGCTTTACCTCAGTGTCTACCCAAGAG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR TCA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTGTCTGAAACAGTCTTaGAAACACGTGGAAAGTAAA +
Preference number: 4 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFCLKQS*KHVESK
Trigger: TTTACTTTCCACGTGTTTTCAAGACTGTTTCAGACA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGAAACCAGCAAGTGCGTaGTTTATGTCCTTATCTTTT +
Preference number: 4 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRKPASA*FMSLSF
Trigger: AAAAGATAAGGACATAAAGCACGCACTTGCTGGTTT...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTAGAAGAGTCAGCTaGTTTAAACAGTATCAGGTT +
Preference number: 4 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPSRRVS*FKQYQV
Trigger: AACCTGATACTGTTTAAAGCAGCTGACTCTTCTAGA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCAGCCAAGGTATCAATTaGAGATTCCAAGGTGAGAAG +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIISQGIN*RFQGEK
Trigger: CTTCTCACCTTGGAATCTGCAATTGATACCTTGGCT...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGGCTTTTCCTGTTAGCTaGATACTTGTTTCCCATGAC +
Preference number: 4 (lower is better)
Translates to: HLLWLVINIDTSTDQRAEAFPVS*ILVSHD
Trigger: GTCATGGGAAACAAGTATGCAGCTAACAGGAAAAGC...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACTGGAGTAGGTATGTGTaGTGTACAAACTCATCATGT +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHWSRYV*CTNSSC
Trigger: ACATGATGAGTTTGTACAGCACACATACCTACTCCA...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATATAATCCATGGGTCTTaGCCTTGGGTCACATGTGCA +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDIIHGS*PWVTCA
Trigger: TGCACATGTGACCCAAGGCCAAGACCCATGGATTAT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGGTGCTTAGATTGAGCTaGCCAGTGCTTTTCCTGTTA +
Preference number: 4 (lower is better)
Translates to: SVTTTFPLALDMFSDVTAVLRLS*PVLFLL
Trigger: TAACAGGAAAAGCACTGGCCAGCTCAATCTAAGCAC...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGAGTTGGAACAGTCTCTaGAGTAGGTATGTGTGCTGT +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQSWNSL*SRYVCC
Trigger: ACAGCACACATACCTACTCCAGAGACTGTTCCAACT...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAGTCCTCGTAAGCCATTaGCTGGAAAGCTGCTATTAT +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTVLVSH*LESCYY
Trigger: ATAATAGCAGCTTTCCAGCCAATGGCTTACGAGGAC...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: SVTTTFPLALDMFSDVTACICLR*HRMSSC
Trigger: GCAAGAGGACATTCGGTGCCAACGAAGACATATACA...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACATGGTCTGGGCCGCTTTaGAGATATCAATTTCTTCAT +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTWSGPL*RYQFLH
Trigger: ATGAAGAAATTGATATCTCCAAAGCGGCCCAGACCA...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACACGATCAGAGAGTGAATaGCAGTTTCTATCGTGGTCT +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTRSESE*QFLSWS
Trigger: AGACCACGATAGAAACTGCCATTCACTCTCTGATCG...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTTCAAATGTAGTCTaGTACAGCATCTCCACAAAA +
Preference number: 4 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHSSNVV*YSISTK
Trigger: TTTTGTGGAGATGCTGTATCAGACTACATTTGAACT...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAAAATCCAAACGTTCCTaGGCAATGAACTGGATGATC +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLKSKRS*AMNWMI
Trigger: GATCATCCAGTTCATTGCTCAGGAACGTTTGGATTT...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGCTGCCTGTTTCCATTaGTTTATTAATTGTACCAAC +
Preference number: 4 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEAACFH*FINCTN
Trigger: GTTGGTACAATTAATAAATCAATGGAAACAGGCAGC...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCATGAACTGAAAGGATaGTTCGAAATCTTCCACGGG +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDHELKG*FEIFHG
Trigger: CCCGTGGAAGATTTCGAAGCATCCTTTCAGTTCATG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTCCAAATGTCGGAGAATaGTGTCTAATGCTTTTCTTA +
Preference number: 4 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFPNVGE*CLMLFL
Trigger: TAAGAAAAGCATTAGACAGCATTCTCCGACATTTGG...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATATCGGGAATCAACCTTaGAATTGCAGCAATGCAGGT +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDIGNQP*NCSNAG
Trigger: ACCTGCATTGCTGCAATTCCAAGGTTGATTCCCGAT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACTCAGAGCGCATCATTaGAACTATGTGCTTAAACAG +
Preference number: 4 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLLRAHH*NYVLKQ
Trigger: CTGTTTAAGCACATAGTTCCAATGATGCGCTCTGAG...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACATTTGCAAAACTGAGTTaGGCTGTCAAAATGCTGGAT +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTFAKLS*AVKMLD
Trigger: ATCCAGCATTTTGACAGCCCAACTCAGTTTTGCAAA...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CCA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTACGATCAGAGAGTGAATaGCAGTTTCTATCGTGGTCT +
Preference number: 4 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVRSESE*QFLSWS
Trigger: AGACCACGATAGAAACTGCCATTCACTCTCTGATCG...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATTATTTCCAACTGGTTTaGTCTGTGCTAGGAGCGGAT +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDYFQLV*SVLGAD
Trigger: ATCCGCTCCTAGCACAGACCAAACCAGTTGGAAATA...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp AGAGTAATCAAAGCTGTGCTATTTACCGTTCTGTGGACACAGAGAAATGAACACCATTCCTGCATGAACTaGAAGGATGCTTCGAAATCT +
Preference number: 4 (lower is better)
Translates to: RVIKAVLFTVLWTQRNEHHSCMN*KDASKS
Trigger: AGATTTCGAAGCATCCTTTCAGTTCATGCAGGAATG...GTGTTCATTTCTCTGTGTCCACAGAACGGTAAATAGCACAGCTTTGATTACTCT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000152631.2
CDS-3UTR TCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATACTTCTAAGAAATACTaGGCGCATTCCTGCATGAAC +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDTSKKY*AHSCMN
Trigger: GTTCATGCAGGAATGCGCTCAGTATTTCTTAGAAGT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGCTGCCTGTTTCCATTaGTTTATTAATTGTACCAAC +
Preference number: 4 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHAACFH*FINCTN
Trigger: GTTGGTACAATTAATAAATCAATGGAAACAGGCAGC...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR TCA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTATCAGAGATGTCAAAGTaGAAATCTAAGGTCTTGCCG +
Preference number: 4 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVSEMSK*KSKVLP
Trigger: CGGCAAGACCTTAGATTTTCACTTTGACATCTCTGA...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCAATCAACCTTGGAATTaGAGCAATGCAGGTTCTAAA +
Preference number: 4 (lower is better)
Translates to: INEAQGFLKGAWLAVLIINQPWN*SNAGSK
Trigger: TTTAGAACCTGCATTGCTGCAATTCCAAGGTTGATT...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGTTGGGAAGGTTTTCTTaGTTTAGGAAACTGGAGAGA +
Preference number: 4 (lower is better)
Translates to: SKIILQCSFRHALRSCHQLGRFS*FRKLER
Trigger: TCTCTCCAGTTTCCTAAAGCAAGAAAACCTTCCCAA...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGTGGTGTCTGTTGATCTaGATATTCCTGTCACTGTAT +
Preference number: 4 (lower is better)
Translates to: SVTTTFPLALDMFSDVTAWCLLI*IFLSLY
Trigger: ATACAGTGACAGGAATATGCAGATCAACAGACACCA...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR GCA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACACATGTTGATGACCTCTaGTTCATTCTTGATGGTATT +
Preference number: 4 (lower is better)
Translates to: KQFISIPNSGASEPSLQTHVDDL*FILDGI
Trigger: AATACCATCAAGAATGAAGCAGAGGTCATCAACATG...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR TCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCATCATCACTTCCAATaGGCTTTTAAACTTGGTACC +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDHHHFQ*AFKLGT
Trigger: GGTACCAAGTTTAAAAGCTCATTGGAAGTGATGATG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR GCA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAAAACCAGCAAGTGCGTaGTTTATGTCCTTATCTTTT +
Preference number: 4 (lower is better)
Translates to: KVFLSNQRRWEATFISFTKPASA*FMSLSF
Trigger: AAAAGATAAGGACATAAAGCACGCACTTGCTGGTTT...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CCA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATTTTGCAAAACTGAGTTaGGCTGTCAAAATGCTGGAT +
Preference number: 4 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDFAKLS*AVKMLD
Trigger: ATCCAGCATTTTGACAGCCCAACTCAGTTTTGCAAA...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR GCA 90 bp TATTATTTCCAACACATGATTCCTTACAGAGACTATCACAAATGCACCAAGAGTCATGAACTGAAAGGATaGTTCGAAATCTTCCACGGG +
Preference number: 4 (lower is better)
Translates to: YYFQHMIPYRDYHKCTKSHELKG*FEIFHG
Trigger: CCCGTGGAAGATTTCGAAGCATCCTTTCAGTTCATG...ACTCTTGGTGCATTTGTGATAGTCTCTGTAAGGAATCATGTGTTGGAAATAATA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000152631.2
CDS-3UTR TCA 90 bp TTATTATTTCCAACACATGATTCCTTACAGAGACTATCACAAATGCACCAAGAGACTTCTAAGAAATACTaGGCGCATTCCTGCATGAAC +
Preference number: 4 (lower is better)
Translates to: LLFPTHDSLQRLSQMHQETSKKY*AHSCMN
Trigger: GTTCATGCAGGAATGCGCTCAGTATTTCTTAGAAGT...CTCTTGGTGCATTTGTGATAGTCTCTGTAAGGAATCATGTGTTGGAAATAATAA
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000152631.2
CDS-3UTR TCA 90 bp ATTCCTTACAGAGACTATCACAAATGCACCAAGAGTAATCAAAGCTGTGCTATTAGTTCAAATGTAGTCTaGTACAGCATCTCCACAAAA +
Preference number: 4 (lower is better)
Translates to: IPYRDYHKCTKSNQSCAISSNVV*YSISTK
Trigger: TTTTGTGGAGATGCTGTATCAGACTACATTTGAACT...AATAGCACAGCTTTGATTACTCTTGGTGCATTTGTGATAGTCTCTGTAAGGAAT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000152631.2
CDS CCA 90 bp GAGAGCATCTCACGGAGCCTGCGGGTGCTGATGGGGACGGGGAGGTaGCTGCGCTGCAGCAGAGGACCAGGTAGTTTCTCCACAGGCCAA +
Preference number: 5 (lower is better)
Translates to: ESISRSLRVLMGTGR*LRCSRGPGSFSTGQ
Trigger: TTGGCCTGTGGAGAAACTACCTGGTCCTCTGCTGCAGCGCAGCCACCTCCCCGTCCCCATCAGCACCCGCAGGCTCCGTGAGATGCTCTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 90 bp GGGCGTTGGATGTGGAGCCAGAGGAGGTGGAGGACGTGCTCCTGGTaGCTGCGATCACCTTTGCCTTCCCATTCCTTCCCGCGGCACTGT +
Preference number: 5 (lower is better)
Translates to: GRWMWSQRRWRTCSW*LRSPLPSHSFPRHC
Trigger: ACAGTGCCGCGGGAAGGAATGGGAAGGCAAAGGTGATCGCAGTCACCAGGAGCACGTCCTCCACCTCCTCTGGCTCCACATCCAACGCCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp GGATGCCAACGATCTTGGAATCGATGCTGTAGCCACTGTCAGGGGTaGACGCCAGCGTCTCGGGAGGAGAGCATCTCACGGAGCCTGCGG +
Preference number: 5 (lower is better)
Translates to: GCQRSWNRCCSHCQG*TPASREESISRSLR
Trigger: CCGCAGGCTCCGTGAGATGCTCTCCTCCCGAGACGCTGGCGTCCACCCCTGACAGTGGCTACAGCATCGATTCCAAGATCGTTGGCATCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp CCTCTGAGGACTCGTCGGTATCCTCCTGGTTCGTCAGGGTCAGGCTaGGGGTGCTGCTGGAACACGGGTACTCCTGGAGGGATGGTGTGT +
Preference number: 5 (lower is better)
Translates to: PLRTRRYPPGSSGSG*GCCWNTGTPGGMVC
Trigger: ACACACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGGATACCGACGAGTCCTCAGAGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 90 bp AGGACTCGTCGGTATCCTCCTGGTTCGTCAGGGTCAGGCTGGGGGTaGTGCTGGAACACGGGTACTCCTGGAGGGATGGTGTGTCTCCTT +
Preference number: 5 (lower is better)
Translates to: RTRRYPPGSSGSGWG*CWNTGTPGGMVCLL
Trigger: AAGGAGACACACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGGATACCGACGAGTCCT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCAGAGCCTGCAGGGTGTaGAAGGCCAGCGCCCGCAGT +
Preference number: 5 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCRACRV*KASARS
Trigger: ACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 90 bp GGAAGAATGACTCCTGTGGTGGGCATGGGAGGGTCTCCATCCTTCTaGTGCAGGCTGTCCGCGATGACGAGGAAGACTCGCAGGCCAATG +
Preference number: 5 (lower is better)
Translates to: GRMTPVVGMGGSPSF*CRLSAMTRKTRRPM
Trigger: CATTGGCCTGCGAGTCTTCCTCGTCATCGCGGACAGCCTGCAGCAGAAGGATGGAGACCCTCCCATGCCCACCACAGGAGTCATTCTTCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000153903.3
CDS GCA 90 bp GGGTTATCCATGTGCGTGACGCCGGAACTGACGGGGTCCGTGAGCTaGAGCTCGCTCACCAGCTCTTCCAGCAGCTGCATGGTTTTGTCT +
Preference number: 5 (lower is better)
Translates to: GLSMCVTPELTGSVS*SSLTSSSSSCMVLS
Trigger: AGACAAAACCATGCAGCTGCTGGAAGAGCTGGTGAGCGAGCTGCAGCTCACGGACCCCGTCAGTTCCGGCGTCACGCACATGGATAACCC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 90 bp ACTCGTCGGTATCCTCCTGGTTCGTCAGGGTCAGGCTGGGGGTGCTaGTGGAACACGGGTACTCCTGGAGGGATGGTGTGTCTCCTTTGT +
Preference number: 5 (lower is better)
Translates to: TRRYPPGSSGSGWGC*WNTGTPGGMVCLLC
Trigger: ACAAAGGAGACACACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGGATACCGACGAGT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp ATCCACCAGTGGCGACCAGCAGCCTCCAGCTGGCGGGAAGGGCAGTaGCTCTCCTTGGTTGTGCTCCATCACTTTCAGGCGCCAATTAGA +
Preference number: 5 (lower is better)
Translates to: IHQWRPAASSWREGQ*LSLVVLHHFQAPIR
Trigger: TCTAATTGGCGCCTGAAAGTGATGGAGCACAACCAAGGAGAGCCACTGCCCTTCCCGCCAGCTGGAGGCTGCTGGTCGCCACTGGTGGAT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CCA 90 bp CGTCGGTATCCTCCTGGTTCGTCAGGGTCAGGCTGGGGGTGCTGCTaGAACACGGGTACTCCTGGAGGGATGGTGTGTCTCCTTTGTCAA +
Preference number: 5 (lower is better)
Translates to: RRYPPGSSGSGWGCC*NTGTPGGMVCLLCQ
Trigger: TTGACAAAGGAGACACACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGGATACCGACG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TGCTCGGGCATCATGTCCTCCGTCACACAGTCACTGTTCAGCATCTaGGTGCGTGACAGGATCTGGCTTGCGGTGAGGGCGGCTTCTTCC +
Preference number: 5 (lower is better)
Translates to: CSGIMSSVTQSLFSI*VRDRIWLAVRAASS
Trigger: GGAAGAAGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGAACAGTGACTGTGTGACGGAGGACATGATGCCCGAGCA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 90 bp AGTCACTGTTCAGCATCTGGGTGCGTGACAGGATCTGGCTTGCGGTaGGGGCGGCTTCTTCCTCTGAGGACTCGTCGGTATCCTCCTGGT +
Preference number: 5 (lower is better)
Translates to: SHCSASGCVTGSGLR*GRLLPLRTRRYPPG
Trigger: ACCAGGAGGATACCGACGAGTCCTCAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGAACAGTGACT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TGTTTCAGGCACGTAATCCACCAGTGGCGACCAGCAGCCTCCAGCTaGCGGGAAGGGCAGTGGCTCTCCTTGGTTGTGCTCCATCACTTT +
Preference number: 5 (lower is better)
Translates to: CFRHVIHQWRPAASS*REGQWLSLVVLHHF
Trigger: AAAGTGATGGAGCACAACCAAGGAGAGCCACTGCCCTTCCCGCCAGCTGGAGGCTGCTGGTCGCCACTGGTGGATTACGTGCCTGAAACA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CCA 90 bp TCCGTCACACAGTCACTGTTCAGCATCTGGGTGCGTGACAGGATCTaGCTTGCGGTGAGGGCGGCTTCTTCCTCTGAGGACTCGTCGGTA +
Preference number: 5 (lower is better)
Translates to: SVTQSLFSIWVRDRI*LAVRAASSSEDSSV
Trigger: TACCGACGAGTCCTCAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGAACAGTGACTGTGTGACGGA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTAGAGCCTGCAGGGTGTaGAAGGCCAGCGCCCGCAGT +
Preference number: 5 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLRACRV*KASARS
Trigger: ACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCT...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCTAAAGACTCCCGGGTaGGTCCTGCCGAGGCCTAGA +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALLKTPG*VLPRPR
Trigger: TCTAGGCCTCGGCAGGACCAACCCGGGAGTCTTTAG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGCCTTACTGTCAGGGTaGCCATCTGTGGGAGCGACC +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALALLSG*PSVGAT
Trigger: GGTCGCTCCCACAGATGGCAACCCTGACAGTAAGGC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 90 bp GAAAGCACATCCTCGCGCCAGTCTGGGAAATCAAGCATCAGAGCCTaGAGGGTGTTGAAGGCCAGCGCCCGCAGTTCTTCATCCATGTGG +
Preference number: 5 (lower is better)
Translates to: ESTSSRQSGKSSIRA*RVLKASARSSSSMW
Trigger: CCACATGGATGAAGAACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCTGATGCTTGATTTCCCAGACTGGCGCGAGGATGTGCTTTC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 90 bp ATCCAAAAGATGGTGGCCATCAGGTTGCTCGGCTCCGTCGGGGGCTaGGTGTCGTACACACCTTTCTCTCTCAGCGAGGAAAGGCTTCGA +
Preference number: 5 (lower is better)
Translates to: IQKMVAIRLLGSVGG*VSYTPFSLSEERLR
Trigger: TCGAAGCCTTTCCTCGCTGAGAGAGAAAGGTGTGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGAT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TTTCGGGAGAGCCTACGTCCACTCCGTAGGCCTTGGGGATGTCATTaGGGACGACAAGACTTGCAGAGCGAGACACCACCAGCTTCAGGA +
Preference number: 5 (lower is better)
Translates to: FRESLRPLRRPWGCH*GRQDLQSETPPASG
Trigger: TCCTGAAGCTGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGCCTACGGAGTGGACGTAGGCTCTCCCGAAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATCCCGCGGCACTGTGTaGGCCTCCATACTTGTTCCC +
Preference number: 5 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSSRGTV*ASILVP
Trigger: GGGAACAAGTATGGAGGCCAACACAGTGCCGCGGGA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACGGGAGAGGCGAGGTTaGCACTTCTGGAAAGCCGTC +
Preference number: 5 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPARERRG*HFWKAV
Trigger: GACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS TCA 90 bp TGTCACACTGGTAATCCCTGTTCTGGAACACGTTGGCAATGGCTTTaGAGCAGCCGGCTGCTACTCTCCGGGAGCCGGTGTAGCATCGGT +
Preference number: 5 (lower is better)
Translates to: CHTGNPCSGTRWQWL*SSRLLLSGSRCSIG
Trigger: ACCGATGCTACACCGGCTCCCGGAGAGTAGCAGCCGGCTGCTTCAAAGCCATTGCCAACGTGTTCCAGAACAGGGATTACCAGTGTGACA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 90 bp ATCAAGCTGATGACGCTCTGGACCACGTGTGGGCTCTGCTCCTTCTaGCGCAGCTCTTTCAGCTCAGTCACGAACTTCTTCCTCACAGCC +
Preference number: 5 (lower is better)
Translates to: IKLMTLWTTCGLCSF*RSSFSSVTNFFLTA
Trigger: GGCTGTGAGGAAGAAGTTCGTGACTGAGCTGAAAGAGCTGCGGCAGAAGGAGCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTTGAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 90 bp GTCCACTCCGTAGGCCTTGGGGATGTCATTGGGGACGACAAGACTTaGAGAGCGAGACACCACCAGCTTCAGGATGTTGAGGGCTTCCTT +
Preference number: 5 (lower is better)
Translates to: VHSVGLGDVIGDDKT*RARHHQLQDVEGFL
Trigger: AAGGAAGCCCTCAACATCCTGAAGCTGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGCCTACGGAGTGGAC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TCTCTCAGCGAGGAAAGGCTTCGAGTCCTCGCCAAGCTACCACCGTaGTTTATCCGTCCATCCGTTATGTCCAGTGTGTTACTCCGCCGC +
Preference number: 5 (lower is better)
Translates to: SLSEERLRVLAKLPP*FIRPSVMSSVLLRR
Trigger: GCGGCGGAGTAACACACTGGACATAACGGATGGACGGATAAACCACGGTGGTAGCTTGGCGAGGACTCGAAGCCTTTCCTCGCTGAGAGA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACTGCGGGAGCCCTTaGGGAAAAGAGCAGACACTA +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALHCGSP*GKEQTL
Trigger: TAGTGTCTGCTCTTTTCCCAAAGGGCTCCCGCAGTG...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCACGTTGGCAATGGCTTaGAAGCAGCCGGCTGCTACT +
Preference number: 5 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCTLAMA*KQPAAT
Trigger: AGTAGCAGCCGGCTGCTTCAAAGCCATTGCCAACGT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGCCTTACTGTCAGGGTaGCCATCTGTGGGAGCGACC +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLALLSG*PSVGAT
Trigger: GGTCGCTCCCACAGATGGCAACCCTGACAGTAAGGC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCCCGCGGCACTGTGTaGGCCTCCATACTTGTTCCC +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSRGTV*ASILVP
Trigger: GGGAACAAGTATGGAGGCCAACACAGTGCCGCGGGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAACAACGGAGGGATTCTaGGGGAGGCCAGATTCGGGG +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKTTEGF*GRPDSG
Trigger: CCCCGAATCTGGCCTCCCCAAGAATCCCTCCGTTGT...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAACGGGAGAGGCGAGGTTaGCACTTCTGGAAAGCCGTC +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKRERRG*HFWKAV
Trigger: GACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCG...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS GCA 90 bp ATCCCCATGATCAAGCTGATGACGCTCTGGACCACGTGTGGGCTCTaGTCCTTCTGCCGCAGCTCTTTCAGCTCAGTCACGAACTTCTTC +
Preference number: 5 (lower is better)
Translates to: IPMIKLMTLWTTCGL*SFCRSSFSSVTNFF
Trigger: GAAGAAGTTCGTGACTGAGCTGAAAGAGCTGCGGCAGAAGGAGCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTTGATCATGGGGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp TTCACTCGGAAGAACTTCATCCCCATGATCAAGCTGATGACGCTCTaGACCACGTGTGGGCTCTGCTCCTTCTGCCGCAGCTCTTTCAGC +
Preference number: 5 (lower is better)
Translates to: FTRKNFIPMIKLMTL*TTCGLCSFCRSSFS
Trigger: GCTGAAAGAGCTGCGGCAGAAGGAGCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTTGATCATGGGGATGAAGTTCTTCCGAGTGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCACATATTCACCGGGCTaGACATCCGGGTCAATCGTG +
Preference number: 5 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCTYSPG*TSGSIV
Trigger: CACGATTGACCCGGATGTCAAGCCCGGTGAATATGT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACGTTGGCAATGGCTTaGAAGCAGCCGGCTGCTACT +
Preference number: 5 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPATLAMA*KQPAAT
Trigger: AGTAGCAGCCGGCTGCTTCAAAGCCATTGCCAACGT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCCTGAAGGCAGAGGTTaGAGGTCGACCAGCTCGATG +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLPEGRG*RSTSSM
Trigger: CATCGAGCTGGTCGACCTCAAACCTCTGCCTTCAGG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGAGTGGCTCTCCTTGGTaGTGCTCCATCACTTTCAGG +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALSGSPW*CSITFR
Trigger: CCTGAAAGTGATGGAGCACAACCAAGGAGAGCCACT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATTGGGGACGACAAGACTaGCAGAGCGAGACACCACCA +
Preference number: 5 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHWGRQD*QSETPP
Trigger: TGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCCA...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS TCA 90 bp ACCTGGGACGGATCCACCAGTGTGTGTTTGGAGACGGAAATGAGCTaGCTGAGGAGGTGCACGGTCATCTCTTGGGTAGACACTGAGGTA +
Preference number: 5 (lower is better)
Translates to: TWDGSTSVCLETEMS*LRRCTVISWVDTEV
Trigger: TACCTCAGTGTCTACCCAAGAGATGACCGTGCACCTCCTCAGTCAGCTCATTTCCGTCTCCAAACACACACTGGTGGATCCGTCCCAGGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 90 bp ACCATGAGCTCTCGGTCTTTCAAGGAGTCATCTTCATCTTCATCCTaGCGCCTCCCTGAAGGCAGAGGTTTGAGGTCGACCAGCTCGATG +
Preference number: 5 (lower is better)
Translates to: TMSSRSFKESSSSSS*RLPEGRGLRSTSSM
Trigger: CATCGAGCTGGTCGACCTCAAACCTCTGCCTTCAGGGAGGCGGCAGGATGAAGATGAAGATGACTCCTTGAAAGACCGAGAGCTCATGGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 90 bp CCTGGAACAGAAGCAGCAGCTGAAAGTGCAGCCGGTACAACCTTCTaGAGAGCTCCAGCTCTGCTAGAATTCCCATTTGATGCGCGTTGG +
Preference number: 5 (lower is better)
Translates to: PGTEAAAESAAGTTF*RAPALLEFPFDARW
Trigger: CCAACGCGCATCAAATGGGAATTCTAGCAGAGCTGGAGCTCTGCAGAAGGTTGTACCGGCTGCACTTTCAGCTGCTGCTTCTGTTCCAGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000202806.4
CDS CCA 90 bp GCTCCAGCTCATGCGCGTTGGTGTTCATCCTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGCAGTTGTCTAGCCACTGCTCGGCTG +
Preference number: 5 (lower is better)
Translates to: APAHARWCSSCICLR*HRMSSCSCLATARL
Trigger: CAGCCGAGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATGAGCTGGAGC
54% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTGCACGTTCCCCGTGTaGGTCCCTGAATATCCTTCC +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLCTFPV*VPEYPS
Trigger: GGAAGGATATTCAGGGACCAACACGGGGAACGTGCA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTTCACAGCCTGGAACTTaGACTGGGCAAGCACGCCAA +
Preference number: 5 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLSQPGT*TGQARQ
Trigger: TTGGCGTGCTTGCCCAGTCAAAGTTCCAGGCTGTGA...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCATCGGGAATCAACCTaGGAATTGCAGCAATGCAGG +
Preference number: 5 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCHREST*ELQQCR
Trigger: CCTGCATTGCTGCAATTCCAAGGTTGATTCCCGATG...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAGGGCAGTGGCTCTCCTaGGTTGTGCTCCATCACTTT +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKGQWLS*VVLHHF
Trigger: AAAGTGATGGAGCACAACCAAGGAGAGCCACTGCCC...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTAAGTGGGTGAGCAGTTaGCTCAGAAGCCTGAGAGCC +
Preference number: 5 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLKWVSS*LRSLRA
Trigger: GGCTCTCAGGCTTCTGAGCAAACTGCTCACCCACTT...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCCAGATTAAACTGCTaGACCGGGGCCGCAGACAAG +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSRLNC*TGAADK
Trigger: CTTGTCTGCGGCCCCGGTCAAGCAGTTTAATCTGGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATCCAGATTAAACTGCTaGACCGGGGCCGCAGACAAG +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKSRLNC*TGAADK
Trigger: CTTGTCTGCGGCCCCGGTCAAGCAGTTTAATCTGGA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGCCTTGGGGATGTCATaGGGGACGACAAGACTTGCA +
Preference number: 5 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLALGMS*GTTRLA
Trigger: TGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCACAACGGAGGGATTCTaGGGGAGGCCAGATTCGGGG +
Preference number: 5 (lower is better)
Translates to: TACGANVQENTGFSLGGVTTEGF*GRPDSG
Trigger: CCCCGAATCTGGCCTCCCCAAGAATCCCTCCGTTGT...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCGATCAAGCTGGTCTGTaGGTCCCCGACTTCCAAATC +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPDQAGL*VPDFQI
Trigger: GATTTGGAAGTCGGGGACCAACAGACCAGCTTGATC...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCATGCTGCTCACTGCTGTaGTCTTCGACGGCAACTTCT +
Preference number: 5 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPACCSLL*SSTATS
Trigger: AGAAGTTGCCGTCGAAGACAACAGCAGTGAGCAGCA...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTGCTGCTCACTGCTGTaGTCTTCGACGGCAACTTCT +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPCCSLL*SSTATS
Trigger: AGAAGTTGCCGTCGAAGACAACAGCAGTGAGCAGCA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCACTGCCGAAGATGTCATaGGGCCAGAGGGTTCTGAAA +
Preference number: 5 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPALPKMS*GQRVLK
Trigger: TTTCAGAACCCTCTGGCCCAATGACATCTTCGGCAG...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp AATGAGCTGACTGAGGAGGTGCACGGTCATCTCTTGGGTAGACACTaGGGTAAAGCCCTTAAGGAAGAGCTGCTGAAGGCCGGGGAAGTT +
Preference number: 5 (lower is better)
Translates to: NELTEEVHGHLLGRH*GKALKEELLKAGEV
Trigger: AACTTCCCCGGCCTTCAGCAGCTCTTCCTTAAGGGCTTTACCTCAGTGTCTACCCAAGAGATGACCGTGCACCTCCTCAGTCAGCTCATT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 90 bp AGGTCGCCTCTGAGAAAGAGTCGTGCAGGTACCGGCACACCACGTTaGTCCAGTTGGAACAGTCTCTGGAGTAGGTATGTGTGCTGTACA +
Preference number: 5 (lower is better)
Translates to: RSPLRKSRAGTGTPR*SSWNSLWSRYVCCT
Trigger: TGTACAGCACACATACCTACTCCAGAGACTGTTCCAACTGGATCAACGTGGTGTGCCGGTACCTGCACGACTCTTTCTCAGAGGCGACCT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 90 bp TGGACAGTCCCTTTTCTAACAGCTCTGCCAGGTAAGTCACAAGACTaGAGGTCGCCTCTGAGAAAGAGTCGTGCAGGTACCGGCACACCA +
Preference number: 5 (lower is better)
Translates to: WTVPFLTALPGKSQD*RSPLRKSRAGTGTP
Trigger: TGGTGTGCCGGTACCTGCACGACTCTTTCTCAGAGGCGACCTTCAGTCTTGTGACTTACCTGGCAGAGCTGTTAGAAAAGGGACTGTCCA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 90 bp GATGACATATTCACCGGGCTTGACATCCGGGTCAATCGTGATGCTTaGCATGATGGCGCTCTTTCTTCCCGGAGTGGAGTGGAAGGTGGA +
Preference number: 5 (lower is better)
Translates to: DDIFTGLDIRVNRDA*HDGALSSRSGVEGG
Trigger: TCCACCTTCCACTCCACTCCGGGAAGAAAGAGCGCCATCATGTCAAGCATCACGATTGACCCGGATGTCAAGCCCGGTGAATATGTCATC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000176910.3
CDS GCA 90 bp TTTCTTGAGGTAATGAACTCCATGAGGGTTTTGACTTTTCCATCCTaGTCCACTGAGAGGTCCACCTCGCCGAGGAGGGTGGTGTGGAGG +
Preference number: 5 (lower is better)
Translates to: FLEVMNSMRVLTFPS*STERSTSPRRVVWR
Trigger: CCTCCACACCACCCTCCTCGGCGAGGTGGACCTCTCAGTGGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTTCATTACCTCAAGAAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS GCA 90 bp ATTCTAACAGAGATGTTGCTATCCAAAAGATGGTGGCCATCAGGTTaGTCGGCTCCGTCGGGGGCTGCGTGTCGTACACACCTTTCTCTC +
Preference number: 5 (lower is better)
Translates to: ILTEMLLSKRWWPSG*SAPSGAACRTHLSL
Trigger: GAGAGAAAGGTGTGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAAT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 90 bp CCTGGAACAGAAGCAGCAGCTGAAAGTGCAGCCGGTACAACCTTCTaGAGAGCTCCAGCTCATGCGCGTTGGTGTTCATCCTGTATATGT +
Preference number: 5 (lower is better)
Translates to: PGTEAAAESAAGTTF*RAPAHARWCSSCIC
Trigger: ACATATACAGGATGAACACCAACGCGCATGAGCTGGAGCTCTGCAGAAGGTTGTACCGGCTGCACTTTCAGCTGCTGCTTCTGTTCCAGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CCA 90 bp ACGTTCTCGATCTTCTCCCGGCTCTCTGACTTATCCAGAGGCAAGTaGGTGAGCAGTTTGCTCAGAAGCCTGAGAGCCAGGAGGTATTCA +
Preference number: 5 (lower is better)
Translates to: TFSIFSRLSDLSRGK*VSSLLRSLRARRYS
Trigger: TGAATACCTCCTGGCTCTCAGGCTTCTGAGCAAACTGCTCACCCACTTGCCTCTGGATAAGTCAGAGAGCCGGGAGAAGATCGAGAACGT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp ATCGTGATGCTTGACATGATGGCGCTCTTTCTTCCCGGAGTGGAGTaGAAGGTGGAAGCGGCGGCAGCACAGAACTTATTCACTTTGCTG +
Preference number: 5 (lower is better)
Translates to: IVMLDMMALFLPGVE*KVEAAAAQNLFTLL
Trigger: CAGCAAAGTGAATAAGTTCTGTGCTGCCGCCGCTTCCACCTTCCACTCCACTCCGGGAAGAAAGAGCGCCATCATGTCAAGCATCACGAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000176910.3
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGATGTCTTCAGGCTCTTaGTTGGACATCTGCACACTG +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALMSSGS*LDICTL
Trigger: CAGTGTGCAGATGTCCAACAAAGAGCCTGAAGACAT...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCATGTCTTCAGGCTCTTaGTTGGACATCTGCACACTG +
Preference number: 5 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCMSSGS*LDICTL
Trigger: CAGTGTGCAGATGTCCAACAAAGAGCCTGAAGACAT...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCCATCGGGAATCAACCTaGGAATTGCAGCAATGCAGG +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPHREST*ELQQCR
Trigger: CCTGCATTGCTGCAATTCCAAGGTTGATTCCCGATG...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAGTGGCTCTCCTTGGTaGTGCTCCATCACTTTCAGG +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSGSPW*CSITFR
Trigger: CCTGAAAGTGATGGAGCACAACCAAGGAGAGCCACT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATGGCTCATTGAATTCCTaGTCCCTGAGGAGGACAGAG +
Preference number: 5 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHGSLNS*SLRRTE
Trigger: CTCTGTCCTCCTCAGGGACAAGGAATTCAATGAGCC...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTTGATGCTAGGGTTCTaGGAAGAAACGTCCTCATGG +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALLMLGF*EETSSW
Trigger: CCATGAGGACGTTTCTTCCAAGAACCCTAGCATCAA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCTCCAAGACGCCAAACTaGAGTGTTTCCAGCAAGCCA +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPSKTPN*SVSSKP
Trigger: TGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGA...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp GACTGCTTGAAGACGGAAACCACGTGCTTCAGGAACGTGGCGAGCTaGTCAGCACTCTTGATGCTAGGGTTCTTGGAAGAAACGTCCTCA +
Preference number: 5 (lower is better)
Translates to: DCLKTETTCFRNVAS*SALLMLGFLEETSS
Trigger: TGAGGACGTTTCTTCCAAGAACCCTAGCATCAAGAGTGCTGATCAGCTCGCCACGTTCCTGAAGCACGTGGTTTCCGTCTTCAAGCAGTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS TCA 90 bp TGGTGTAAGTATCCAGATGTTCCTGCAGCTCCAAGACGCCAAACTTaGGTGTTTCCAGCAAGCCACACGCCATCAGCGTTTCGGCATCCA +
Preference number: 5 (lower is better)
Translates to: WCKYPDVPAAPRRQT*VFPASHTPSAFRHP
Trigger: TGGATGCCGAAACGCTGATGGCGTGTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGAGCTGCAGGAACATCTGGATACTTACACCA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 90 bp ATTCATAGTCGGATTCTAACAGAGATGTTGCTATCCAAAAGATGGTaGCCATCAGGTTGCTCGGCTCCGTCGGGGGCTGCGTGTCGTACA +
Preference number: 5 (lower is better)
Translates to: IHSRILTEMLLSKRW*PSGCSAPSGAACRT
Trigger: TGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAATCCGACTATGAAT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp CATATTCATAGTCGGATTCTAACAGAGATGTTGCTATCCAAAAGATaGTGGCCATCAGGTTGCTCGGCTCCGTCGGGGGCTGCGTGTCGT +
Preference number: 5 (lower is better)
Translates to: HIHSRILTEMLLSKR*WPSGCSAPSGAACR
Trigger: ACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAATCCGACTATGAATATG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ACAGCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCCACTGCGGGAGCCCTTaGGGAAAAGAGCAGACACTA +
Preference number: 5 (lower is better)
Translates to: TACGANVQENTGFSLGGVHCGSP*GKEQTL
Trigger: TAGTGTCTGCTCTTTTCCCAAAGGGCTCCCGCAGTG...GACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGCTGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTCCATGGGTCTTGGCCTaGGGTCACATGTGCAAATAT +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLPWVLA*GHMCKY
Trigger: ATATTTGCACATGTGACCCAAGGCCAAGACCCATGG...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATATAATCCATGGGTCTaGGCCTTGGGTCACATGTGC +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKYNPWV*ALGHMC
Trigger: GCACATGTGACCCAAGGCCAAGACCCATGGATTATA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGGAAATGGCAGCGCTGTaGTTTCCTAAGCTGATACTA +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALEMAAL*FPKLIL
Trigger: TAGTATCAGCTTAGGAAACAACAGCGCTGCCATTTC...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAACTCCATGAGGGTTTaGACTTTTCCATCCTGCTCC +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPNSMRV*TFPSCS
Trigger: GGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTTCCCGCGGCACTGTGTaGGCCTCCATACTTGTTCCC +
Preference number: 5 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFSRGTV*ASILVP
Trigger: GGGAACAAGTATGGAGGCCAACACAGTGCCGCGGGA...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCGGCAACTTCTTCTTCTaGAATTATGTCCTCGGTGGT +
Preference number: 5 (lower is better)
Translates to: RRSSAKRSWSHPSLTSPCGNFFF*NYVLGG
Trigger: ACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCC...GCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACCTGCG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GGTCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGTTCTGGAAAGCCGTCTaGTTCATCTTCCTCTTGACT +
Preference number: 5 (lower is better)
Translates to: GLQLKGVGPIPASLHPALFWKAV*FIFLLT
Trigger: AGTCAAGAGGAAGATGAACAAGACGGCTTTCCAGAA...CAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGACC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCGGGAGAGGCGAGGTTaGCACTTCTGGAAAGCCGTC +
Preference number: 5 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLERERRG*HFWKAV
Trigger: GACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAAGGGTTCTGAAAGCTTaGACTTGTGCCACAGCTGAT +
Preference number: 5 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPARVLKA*TCATAD
Trigger: ATCAGCTGTGGCACAAGTCAAAGCTTTCAGAACCCT...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAAGGGTTCTGAAAGCTTaGACTTGTGCCACAGCTGAT +
Preference number: 5 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSRVLKA*TCATAD
Trigger: ATCAGCTGTGGCACAAGTCAAAGCTTTCAGAACCCT...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp TGTCGCGTTAAGTCCACGTACTCCAAGAGAGTGTTGTTGAGGAAGTaGGTTTCGCTATCAAGGCCGCCGCTTGCACTGTGGCTAATGACA +
Preference number: 5 (lower is better)
Translates to: CRVKSTYSKRVLLRK*VSLSRPPLALWLMT
Trigger: TGTCATTAGCCACAGTGCAAGCGGCGGCCTTGATAGCGAAACTCACTTCCTCAACAACACTCTCTTGGAGTACGTGGACTTAACGCGACA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 90 bp GGTAATAAGACACAGAATAGAGATGTGGCAGCGGGGACAGCTGACTaGGGACTCCATCCGTTCTCTGAACCTCCAGTTTGTGAGCATAGC +
Preference number: 5 (lower is better)
Translates to: GNKTQNRDVAAGTAD*GLHPFSEPPVCEHS
Trigger: GCTATGCTCACAAACTGGAGGTTCAGAGAACGGATGGAGTCCTCAGTCAGCTGTCCCCGCTGCCACATCTCTATTCTGTGTCTTATTACC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 90 bp GCTCTTCCAGCAGCTGCATGGTTTTGTCTCGACCCAGGTAGACGATaGCTTTCTTCACGTAAGGCAAGAGGCTTGGTTCGCTATTCACTC +
Preference number: 5 (lower is better)
Translates to: ALPAAAWFCLDPGRR*LSSRKARGLVRYSL
Trigger: GAGTGAATAGCGAACCAAGCCTCTTGCCTTACGTGAAGAAAGTCATCGTCTACCTGGGTCGAGACAAAACCATGCAGCTGCTGGAAGAGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 90 bp GCAGGTGGAGGTAACTTCCCCATTCCACCTTCACGCTGTGGTCAATaGTCAGATCTGTCAGCAGGATCACGGCTATGTTACACCTGTGTA +
Preference number: 5 (lower is better)
Translates to: AGGGNFPIPPSRCGQ*SDLSAGSRLCYTCV
Trigger: TACACAGGTGTAACATAGCCGTGATCCTGCTGACAGATCTGATCATTGACCACAGCGTGAAGGTGGAATGGGGAAGTTACCTCCACCTGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 90 bp GTCCATCCGTTATGTCCAGTGTGTTACTCCGCCGCCGGTCACCTCTaGGGTCACCAACTAGACTTAACCTCAAAGAGTTACTTCTTGTGT +
Preference number: 5 (lower is better)
Translates to: VHPLCPVCYSAAGHL*GHQLDLTSKSYFLC
Trigger: ACACAAGAAGTAACTCTTTGAGGTTAAGTCTAGTTGGTGACCGCAGAGGTGACCGGCGGCGGAGTAACACACTGGACATAACGGATGGAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 90 bp TGGTGTTCATCCTGTATATGTCTTCGTTGGCACCGAATGTCCTCTTaGAGTTGTCTAGCCACTGCTCGGCTGCTTCTCTCTTGGTGGTGT +
Preference number: 5 (lower is better)
Translates to: WCSSCICLRWHRMSS*SCLATARLLLSWWC
Trigger: ACACCACCAAGAGAGAAGCAGCCGAGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCA
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 90 bp TTCCCATTTGATGCGCGTTGGTGTTCATCCTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGCAGTTGTCTAGCCACTGCTCGGCTG +
Preference number: 5 (lower is better)
Translates to: FPFDARWCSSCICLR*HRMSSCSCLATARL
Trigger: CAGCCGAGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATCAAATGGGAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCACATATTCACCGGGCTaGACATCCGGGTCAATCGTG +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSTYSPG*TSGSIV
Trigger: CACGATTGACCCGGATGTCAAGCCCGGTGAATATGT...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAATCTGCAAAGAGACTCTaGATGACATATTCACCGGGC +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKSAKRL*MTYSPG
Trigger: GCCCGGTGAATATGTCATCAAGAGTCTCTTTGCAGA...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTTCTGCAAAGAGACTCTaGATGACATATTCACCGGGC +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLSAKRL*MTYSPG
Trigger: GCCCGGTGAATATGTCATCAAGAGTCTCTTTGCAGA...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGCCTGAAGGCAGAGGTTaGAGGTCGACCAGCTCGATG +
Preference number: 5 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEPEGRG*RSTSSM
Trigger: CATCGAGCTGGTCGACCTCAAACCTCTGCCTTCAGG...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCGTAAGGCAAGAGGCTaGGTTCGCTATTCACTCCGC +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFRKARG*VRYSLR
Trigger: GCGGAGTGAATAGCGAACCAAGCCTCTTGCCTTACG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TCTTCAGCTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAGAAATGGCAGCGCTGTaGTTTCCTAAGCTGATACTA +
Preference number: 5 (lower is better)
Translates to: SSAKRSWSHPSLTSPCPAEMAAL*FPKLIL
Trigger: TAGTATCAGCTTAGGAAACAACAGCGCTGCCATTTC...TGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAGCTGAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGAAGTGGGTGAGCAGTTaGCTCAGAAGCCTGAGAGCC +
Preference number: 5 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRKWVSS*LRSLRA
Trigger: GGCTCTCAGGCTTCTGAGCAAACTGCTCACCCACTT...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAAAGTGGGTGAGCAGTTaGCTCAGAAGCCTGAGAGCC +
Preference number: 5 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLKWVSS*LRSLRA
Trigger: GGCTCTCAGGCTTCTGAGCAAACTGCTCACCCACTT...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCGATCAAGCTGGTCTGTaGGTCCCCGACTTCCAAATC +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSDQAGL*VPDFQI
Trigger: GATTTGGAAGTCGGGGACCAACAGACCAGCTTGATC...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAGGGTTCTGAAAGCTTaGACTTGTGCCACAGCTGAT +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLRVLKA*TCATAD
Trigger: ATCAGCTGTGGCACAAGTCAAAGCTTTCAGAACCCT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS GCA 90 bp GACTCTGTGATCTCCATGCTCTCAGAGCGCATCATTGGAACTATGTaGTTAAACAGGGAAGAAGGGGACGGGATGCCAACGATCTTGGAA +
Preference number: 5 (lower is better)
Translates to: DSVISMLSERIIGTM*LNREEGDGMPTILE
Trigger: TTCCAAGATCGTTGGCATCCCGTCCCCTTCTTCCCTGTTTAAGCACATAGTTCCAATGATGCGCTCTGAGAGCATGGAGATCACAGAGTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp GTGGCATTTACTTTCTTAGCATTGATGGGGCTATTTATATCCACCTaGGGGGACAAGAGCTGCAGCCTGGTGTATGCGAACATCCACGCA +
Preference number: 5 (lower is better)
Translates to: VAFTFLALMGLFIST*GDKSCSLVYANIHA
Trigger: TGCGTGGATGTTCGCATACACCAGGCTGCAGCTCTTGTCCCCCCAGGTGGATATAAATAGCCCCATCAATGCTAAGAAAGTAAATGCCAC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp AGGTTTGCACTTCTGGAAAGCCGTCTTGTTCATCTTCCTCTTGACTaGACAACCCTGAGAAGTCAGCCTCTTCCTCCTCACACCGTTCAT +
Preference number: 5 (lower is better)
Translates to: RFALLESRLVHLPLD*TTLRSQPLPPHTVH
Trigger: ATGAACGGTGTGAGGAGGAAGAGGCTGACTTCTCAGGGTTGTCCAGTCAAGAGGAAGATGAACAAGACGGCTTTCCAGAAGTGCAAACCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTGCTGTAGAGCAGTGTTaGGGAAGGTTTTCTTGCTTT +
Preference number: 5 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLAVEQC*GRFSCF
Trigger: AAAGCAAGAAAACCTTCCCAAACACTGCTCTACAGC...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACTAAAGACTCCCGGGTaGGTCCTGCCGAGGCCTAGA +
Preference number: 5 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLLKTPG*VLPRPR
Trigger: TCTAGGCCTCGGCAGGACCAACCCGGGAGTCTTTAG...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCACAGGATCTGCAAGAGTaGCATAGCAACTTCATAGAT +
Preference number: 5 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSQDLQE*HSNFID
Trigger: ATCTATGAAGTTGCTATGCAACTCTTGCAGATCCTG...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACCGTAAGGCAAGAGGCTaGGTTCGCTATTCACTCCGC +
Preference number: 5 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHRKARG*VRYSLR
Trigger: GCGGAGTGAATAGCGAACCAAGCCTCTTGCCTTACG...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGGGCAGTGGCTCTCCTaGGTTGTGCTCCATCACTTT +
Preference number: 5 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEGQWLS*VVLHHF
Trigger: AAAGTGATGGAGCACAACCAAGGAGAGCCACTGCCC...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCGGCTCATTGAATTCCTaGTCCCTGAGGAGGACAGAG +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPGSLNS*SLRRTE
Trigger: CTCTGTCCTCCTCAGGGACAAGGAATTCAATGAGCC...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGCCTTGGGGATGTCATaGGGGACGACAAGACTTGCA +
Preference number: 5 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEALGMS*GTTRLA
Trigger: TGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGC...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAACAACGGAGGGATTCTaGGGGAGGCCAGATTCGGGG +
Preference number: 5 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLTTEGF*GRPDSG
Trigger: CCCCGAATCTGGCCTCCCCAAGAATCCCTCCGTTGT...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTGGCAACTTCTTCTTCTaGAATTATGTCCTCGGTGGT +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLGNFFF*NYVLGG
Trigger: ACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCC...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TTAATGCACTTGAGCATAATTACATTTCTGTCGGGGGCCATGCCCCCAGGGAAATGCTGCTCACTGCTGTaGTCTTCGACGGCAACTTCT +
Preference number: 5 (lower is better)
Translates to: LMHLSIITFLSGAMPPGKCCSLL*SSTATS
Trigger: AGAAGTTGCCGTCGAAGACAACAGCAGTGAGCAGCA...TTTCCCTGGGGGCATGGCCCCCGACAGAAATGTAATTATGCTCAAGTGCATTAA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATAAGAAGTCGAAGTCCTaGAAGACGCCAAACTGCTGC +
Preference number: 5 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDKKSKS*KTPNCC
Trigger: GCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCTT...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTCCAAGACGCCAAACTaGAGTGTTTCCAGCAAGCCA +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSSKTPN*SVSSKP
Trigger: TGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGA...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCTGCCGAAGATGTCATaGGGCCAGAGGGTTCTGAAA +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFLPKMS*GQRVLK
Trigger: TTTCAGAACCCTCTGGCCCAATGACATCTTCGGCAG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp TTGACTGGGCAAGCACGCCAATCACCTCTGCATATAAATCCGCAATaGTATGCACGTTCCCCGTGTTGGTCCCTGAATATCCTTCCTTGT +
Preference number: 5 (lower is better)
Translates to: LTGQARQSPLHINPQ*YARSPCWSLNILPC
Trigger: ACAAGGAAGGATATTCAGGGACCAACACGGGGAACGTGCATATCATTGCGGATTTATATGCAGAGGTGATTGGCGTGCTTGCCCAGTCAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 90 bp GGGGTGGACATCAGTCACTTCACGAACGATAAAATATACAAAGCCTaGAAGCACATCCTCGCGCCAGTCTGGGAAATCAAGCATCAGAGC +
Preference number: 5 (lower is better)
Translates to: GVDISHFTNDKIYKA*KHILAPVWEIKHQS
Trigger: GCTCTGATGCTTGATTTCCCAGACTGGCGCGAGGATGTGCTTTCAGGCTTTGTATATTTTATCGTTCGTGAAGTGACTGATGTCCACCCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 90 bp ATCTCTTGGGTAGACACTGAGGTAAAGCCCTTAAGGAAGAGCTGCTaGAGGCCGGGGAAGTTACTCCATTTCAACTTGCTCTGTACGTTC +
Preference number: 5 (lower is better)
Translates to: ISWVDTEVKPLRKSC*RPGKLLHFNLLCTF
Trigger: GAACGTACAGAGCAAGTTGAAATGGAGTAACTTCCCCGGCCTTCAGCAGCTCTTCCTTAAGGGCTTTACCTCAGTGTCTACCCAAGAGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 90 bp GTCATATTTCCAACTGGTTTGGTCTGTGCTAGGAGCGGATATGACTaGACTGTGCGGAGAGACTCTCTGATCTCCAGGTTAAGTTCCATC +
Preference number: 5 (lower is better)
Translates to: VIFPTGLVCARSGYD*TVRRDSLISRLSSI
Trigger: GATGGAACTTAACCTGGAGATCAGAGAGTCTCTCCGCACAGTGCAGTCATATCCGCTCCTAGCACAGACCAAACCAGTTGGAAATATGAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 90 bp CCCAAATGGCCGCTGCTGTTAATGGGACTTGTGCTTAGATTGAGCTaGCCAGTGCTTTTCCTGTTAGCTGCATACTTGTTTCCCATGACA +
Preference number: 5 (lower is better)
Translates to: PKWPLLLMGLVLRLS*PVLFLLAAYLFPMT
Trigger: TGTCATGGGAAACAAGTATGCAGCTAACAGGAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTCCCATTAACAGCAGCGGCCATTTGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp CTTAACCTCAAAGAGTTACTTCTTGTGTCCCCGTTGCATCCCAAATaGCCGCTGCTGTTAATGGGACTTGTGCTTAGATTGAGCTGGCCA +
Preference number: 5 (lower is better)
Translates to: LNLKELLLVSPLHPK*PLLLMGLVLRLSWP
Trigger: TGGCCAGCTCAATCTAAGCACAAGTCCCATTAACAGCAGCGGCCATTTGGGATGCAACGGGGACACAAGAAGTAACTCTTTGAGGTTAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TGTCTTCGACGGCAACTTCTTCTTCTTGAATTATGTCCTCGGTGGTaGAGATCAAGCTGGTCTGTTGGTCCCCGACTTCCAAATCCTCAT +
Preference number: 5 (lower is better)
Translates to: CLRRQLLLLELCPRW*RSSWSVGPRLPNPH
Trigger: ATGAGGATTTGGAAGTCGGGGACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCCGTCGAAGACA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TGTTGTCTTCGACGGCAACTTCTTCTTCTTGAATTATGTCCTCGGTaGTGGAGATCAAGCTGGTCTGTTGGTCCCCGACTTCCAAATCCT +
Preference number: 5 (lower is better)
Translates to: CCLRRQLLLLELCPR*WRSSWSVGPRLPNP
Trigger: AGGATTTGGAAGTCGGGGACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCCGTCGAAGACAACA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TCATTTTCCGAAGCGGCCTCAGCTTCCTTAAGGATGCCTTCCAGCTaGGCAAGTTCTTCTGACATGTTGATGACCTCTGCTTCATTCTTG +
Preference number: 5 (lower is better)
Translates to: SFSEAASASLRMPSS*ASSSDMLMTSASFL
Trigger: CAAGAATGAAGCAGAGGTCATCAACATGTCAGAAGAACTTGCCCAGCTGGAAGGCATCCTTAAGGAAGCTGAGGCCGCTTCGGAAAATGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 90 bp CGATCAGAGAGTGAATGGCAGTTTCTATCGTGGTCTGGGCCGCTTTaGAGATATCAATTTCTTCATTTTCCGAAGCGGCCTCAGCTTCCT +
Preference number: 5 (lower is better)
Translates to: RSESEWQFLSWSGPL*RYQFLHFPKRPQLP
Trigger: AGGAAGCTGAGGCCGCTTCGGAAAATGAAGAAATTGATATCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCATTCACTCTCTGATCG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCGGTCTCCCAACCTCTTaGTCCAAATGTCGGAGAATG +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFGLPTS*SKCRRM
Trigger: CATTCTCCGACATTTGGACAAAGAGGTTGGGAGACC...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCCACTGGTCATACACATaGGTCTCCCAACCTCTTTGT +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSHWSYT*VSQPLC
Trigger: ACAAAGAGGTTGGGAGACCAATGTGTATGACCAGTG...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTCAGGCTCTTTGTaGGACATCTGCACACTGGTC +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPSSGSL*DICTLV
Trigger: GACCAGTGTGCAGATGTCCAACAAAGAGCCTGAAGA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTATAATCCATGGGTCTaGGCCTTGGGTCACATGTGC +
Preference number: 5 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRYNPWV*ALGHMC
Trigger: GCACATGTGACCCAAGGCCAAGACCCATGGATTATA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCTGTTCTGGAACACGTaGGCAATGGCTTTGAAGCAG +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFLFWNT*AMALKQ
Trigger: CTGCTTCAAAGCCATTGCCAACGTGTTCCAGAACAG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCAACTCCATGAGGGTTTaGACTTTTCCATCCTGCTCC +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSNSMRV*TFPSCS
Trigger: GGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTT...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAACGTTGATGCTAGGGTTCTaGGAAGAAACGTCCTCATGG +
Preference number: 5 (lower is better)
Translates to: INIDTSTDQRAEQQSPLTLMLGF*EETSSW
Trigger: CCATGAGGACGTTTCTTCCAAGAACCCTAGCATCAA...CGTTAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATCTGTTAGCTGCATACTaGTTTCCCATGACAGGATCG +
Preference number: 5 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDLLAAY*FPMTGS
Trigger: CGATCCTGTCATGGGAAACAAGTATGCAGCTAACAG...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCGGACTTGTGCTTAGATaGAGCTGGCCAGTGCTTTTC +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFGLVLR*SWPVLF
Trigger: GAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTCC...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTCAAAGAGTTACTTCTaGTGTCCCCGTTGCATCCCA +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSSKSYF*CPRCIP
Trigger: TGGGATGCAACGGGGACACAAGAAGTAACTCTTTGA...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCATTCTAACAGAGATGTaGCTATCCAAAAGATGGTGG +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPILTEM*LSKRWW
Trigger: CCACCATCTTTTGGATAGCAACATCTCTGTTAGAAT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGTGGGGACGACAAGACTaGCAGAGCGAGACACCACCA +
Preference number: 5 (lower is better)
Translates to: SKIILQCSFRHALRSCHQWGRQD*QSETPP
Trigger: TGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCCA...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCATCCTTCGAGACGTTATaGAAAATTTTAGCGAAGGAG +
Preference number: 5 (lower is better)
Translates to: LCVDGGWKSKWLCRRRSSSFETL*KILAKE
Trigger: CTCCTTCGCTAAAATTTTCAATAACGTCTCGAAGGA...TGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAAGGAGTTGGTCCCAATGAGCTTTTAAACTaGGTACCAATGCGCTGTAGA +
Preference number: 5 (lower is better)
Translates to: GNPSGSAGAGLQLKGVGPNELLN*VPMRCR
Trigger: TCTACAGCGCATTGGTACCAAGTTTAAAAGCTCATT...GGGACCAACTCCTTTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCCAAGACGCCAAACTaGAGTGTTTCCAGCAAGCCA +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPSKTPN*SVSSKP
Trigger: TGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCCAAGACGCCAAACTaGAGTGTTTCCAGCAAGCCA +
Preference number: 5 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSKTPN*SVSSKP
Trigger: TGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp AGTGCTTCATGGTTTCAGCCAAGGTATCAATTGCAGATTCCAAGGTaGGAAGCAGTTCAATCACAAATCCCTGTGCATCCTCTCCGGGGT +
Preference number: 5 (lower is better)
Translates to: SASWFQPRYQLQIPR*EAVQSQIPVHPLRG
Trigger: ACCCCGGAGAGGATGCACAGGGATTTGTGATTGAACTGCTTCTCACCTTGGAATCTGCAATTGATACCTTGGCTGAAACCATGAAGCACT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 90 bp TGGGCAAGCACGCCAATCACCTCTGCATATAAATCCGCAATGATATaGACGTTCCCCGTGTTGGTCCCTGAATATCCTTCCTTGTGTTTA +
Preference number: 5 (lower is better)
Translates to: WASTPITSAYKSAMI*TFPVLVPEYPSLCL
Trigger: TAAACACAAGGAAGGATATTCAGGGACCAACACGGGGAACGTGCATATCATTGCGGATTTATATGCAGAGGTGATTGGCGTGCTTGCCCA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp TCGACCCAGGTAGACGATGACTTTCTTCACGTAAGGCAAGAGGCTTaGTTCGCTATTCACTCCGCAGATGCTGATCAGAAAGTGCAAAAT +
Preference number: 5 (lower is better)
Translates to: STQVDDDFLHVRQEA*FAIHSADADQKVQN
Trigger: ATTTTGCACTTTCTGATCAGCATCTGCGGAGTGAATAGCGAACCAAGCCTCTTGCCTTACGTGAAGAAAGTCATCGTCTACCTGGGTCGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS-3UTR CAA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTAATCTTCACAAATATATaGAGAGGGGTGTCACGGGGG +
Preference number: 5 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLIFTNI*RGVSRG
Trigger: CCCCCGTGACACCCCTCTCAATATATTTGTGAAGAT...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACTCTTCAGGCTCTTTGTaGGACATCTGCACACTGGTC +
Preference number: 5 (lower is better)
Translates to: HFYSKLWSLGAQFANKSHSSGSL*DICTLV
Trigger: GACCAGTGTGCAGATGTCCAACAAAGAGCCTGAAGA...GTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGAACTCCATGAGGGTTTaGACTTTTCCATCCTGCTCC +
Preference number: 5 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRNSMRV*TFPSCS
Trigger: GGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTT...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCTTGAGGGACTTGTGCTTAGATaGAGCTGGCCAGTGCTTTTC +
Preference number: 5 (lower is better)
Translates to: LKGAWLAVLIIFSLLPLEGLVLR*SWPVLF
Trigger: GAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTCC...CTCAAGAGGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCTCAAAGAGTTACTTCTaGTGTCCCCGTTGCATCCCA +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFSKSYF*CPRCIP
Trigger: TGGGATGCAACGGGGACACAAGAAGTAACTCTTTGA...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTATCAAAGAGTTACTTCTaGTGTCCCCGTTGCATCCCA +
Preference number: 5 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLSKSYF*CPRCIP
Trigger: TGGGATGCAACGGGGACACAAGAAGTAACTCTTTGA...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp GTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCAGCTAAAATTCTAACAGAGATGTaGCTATCCAAAAGATGGTGG +
Preference number: 5 (lower is better)
Translates to: VDGGWKSKWLCRRRSSAKILTEM*LSKRWW
Trigger: CCACCATCTTTTGGATAGCAACATCTCTGTTAGAAT...TTTAGCTGAAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGGCCTTGGGGATGTCATaGGGGACGACAAGACTTGCA +
Preference number: 5 (lower is better)
Translates to: SVTTTFPLALDMFSDVTAALGMS*GTTRLA
Trigger: TGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGC...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGATCAAGCTGGTCTGTaGGTCCCCGACTTCCAAATC +
Preference number: 5 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHDQAGL*VPDFQI
Trigger: GATTTGGAAGTCGGGGACCAACAGACCAGCTTGATC...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCGGCAACTTCTTCTTCTaGAATTATGTCCTCGGTGGT +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSGNFFF*NYVLGG
Trigger: ACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCC...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAAAGTCACAGTGGAGAAGAGATTTCTGGAAAGCCGTCTaGTTCATCTTCCTCTTGACT +
Preference number: 5 (lower is better)
Translates to: TLEPRSPVCKQKSQWRRDFWKAV*FIFLLT
Trigger: AGTCAAGAGGAAGATGAACAAGACGGCTTTCCAGAA...ATCTCTTCTCCACTGTGACTTTTGTTTGCAAACTGGGCTCCGAGGCTCCAGAGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGCGCAGGTCTTCTCTCCAAACTTCCTTaGAATTGTCTGAAACAGTCT +
Preference number: 5 (lower is better)
Translates to: NSVLMVAGNPSGSAGAGLLSKLP*NCLKQS
Trigger: AGACTGTTTCAGACAATTCAAAGGAAGTTTGGAGAG...AAGACCTGCGCCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CTAAAAGGAGTTGGTCCCATCCCAGCCTCACTTCACCCTGCCCTGCAACATCTTAATGAGCTTTTAAACTaGGTACCAATGCGCTGTAGA +
Preference number: 5 (lower is better)
Translates to: LKGVGPIPASLHPALQHLNELLN*VPMRCR
Trigger: TCTACAGCGCATTGGTACCAAGTTTAAAAGCTCATT...AAGATGTTGCAGGGCAGGGTGAAGTGAGGCTGGGATGGGACCAACTCCTTTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp GCGTGTGGCGCGAACGTACAAGAAAATACAGGTTTTAGTCTAGGCGGTGTCTATCTGTATATGTCTTCGTaGGCACCGAATGTCCTCTTG +
Preference number: 5 (lower is better)
Translates to: ACGANVQENTGFSLGGVYLYMSS*APNVLL
Trigger: CAAGAGGACATTCGGTGCCAACGAAGACATATACAG...ATAGACACCGCCTAGACTAAAACCTGTATTTTCTTGTACGTTCGCGCCACACGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp GTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCAGCAGAGTCCACTACTGTATATGTCTTCGTaGGCACCGAATGTCCTCTTG +
Preference number: 5 (lower is better)
Translates to: VINIDTSTDQRAEQQSPLLYMSS*APNVLL
Trigger: CAAGAGGACATTCGGTGCCAACGAAGACATATACAG...TAGTGGACTCTGCTGCTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAAC
48% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp CCTCCATACTTGTTCCCAATGATAGGTGTCTCAGAGATGTCAAAGTaGAAATCTAAGGTCTTGCCGGGCAGCTCCTTCGAGACGTTATTG +
Preference number: 5 (lower is better)
Translates to: PPYLFPMIGVSEMSK*KSKVLPGSSFETLL
Trigger: CAATAACGTCTCGAAGGAGCTGCCCGGCAAGACCTTAGATTTTCACTTTGACATCTCTGAGACACCTATCATTGGGAACAAGTATGGAGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp GTTTCCTCTAAATCAAGAATCCCTCGACATACTAGCGGGTCCTGTTaGTCTGGAATAACGTATGACCCTTCGTCTTCAAAGGCTGTAACG +
Preference number: 5 (lower is better)
Translates to: VSSKSRIPRHTSGSC*SGITYDPSSSKAVT
Trigger: CGTTACAGCCTTTGAAGACGAAGGGTCATACGTTATTCCAGACCAACAGGACCCGCTAGTATGTCGAGGGATTCTTGATTTAGAGGAAAC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATTCACAGCCTGGAACTTaGACTGGGCAAGCACGCCAA +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDSQPGT*TGQARQ
Trigger: TTGGCGTGCTTGCCCAGTCAAAGTTCCAGGCTGTGA...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGGACTTGTGCTTAGATaGAGCTGGCCAGTGCTTTTC +
Preference number: 5 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIGLVLR*SWPVLF
Trigger: GAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTCC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CCCTGCCCTGCAACATCTTGGGGCCATTATTGCAAACATCCTTGGAATTTCTTCCTTTGCAAAACTGAGTaGGGCTGTCAAAATGCTGGA +
Preference number: 5 (lower is better)
Translates to: PCPATSWGHYCKHPWNFFLCKTE*GCQNAG
Trigger: TCCAGCATTTTGACAGCCCAACTCAGTTTTGCAAAG...GAAGAAATTCCAAGGATGTTTGCAATAATGGCCCCAAGATGTTGCAGGGCAGGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCTTTGCAAAACTGAGTaGGGCTGTCAAAATGCTGGA +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPLCKTE*GCQNAG
Trigger: TCCAGCATTTTGACAGCCCAACTCAGTTTTGCAAAG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATTCCAGATTAAACTGCTaGACCGGGGCCGCAGACAAG +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDSRLNC*TGAADK
Trigger: CTTGTCTGCGGCCCCGGTCAAGCAGTTTAATCTGGA...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCAAGAAGTCGAAGTCCTaGAAGACGCCAAACTGCTGC +
Preference number: 5 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIKKSKS*KTPNCC
Trigger: GCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCTT...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ATCTCTTCTCTTGAAGTCCGCAGCCCTTCAGGGCCCGCAGAACATACACTCCATCTTGATGGTATTTACTaGGTTGATGAGTTTGCAGTA +
Preference number: 5 (lower is better)
Translates to: ISSLEVRSPSGPAEHTLHLDGIY*VDEFAV
Trigger: TACTGCAAACTCATCAACCAAGTAAATACCATCAAG...ATGGAGTGTATGTTCTGCGGGCCCTGAAGGGCTGCGGACTTCAAGAGAAGAGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGCTGCCGAAGATGTCATaGGGCCAGAGGGTTCTGAAA +
Preference number: 5 (lower is better)
Translates to: SVTTTFPLALDMFSDVTALPKMS*GQRVLK
Trigger: TTTCAGAACCCTCTGGCCCAATGACATCTTCGGCAG...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp CTCATAGAGCTTACCAACTGGTCAAACTGCAGATCTTCACCCCTCTaGAGAGATCTGGATAACAGCTTTTCCAAGGGTTCAGCCATTACA +
Preference number: 5 (lower is better)
Translates to: LIELTNWSNCRSSPL*RDLDNSFSKGSAIT
Trigger: TGTAATGGCTGAACCCTTGGAAAAGCTGTTATCCAGATCTCTTCAGAGGGGTGAAGATCTGCAGTTTGACCAGTTGGTAAGCTCTATGAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 90 bp AGACAGCAGGTCATAGTGCTTCATGGTTTCAGCCAAGGTATCAATTaGAGATTCCAAGGTGAGAAGCAGTTCAATCACAAATCCCTGTGC +
Preference number: 5 (lower is better)
Translates to: RQQVIVLHGFSQGIN*RFQGEKQFNHKSLC
Trigger: GCACAGGGATTTGTGATTGAACTGCTTCTCACCTTGGAATCTGCAATTGATACCTTGGCTGAAACCATGAAGCACTATGACCTGCTGTCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 90 bp TGCTTTAGGAAACTGGAGAGACTTATAATCCATGGGTCTTGGCCTTaGGTCACATGTGCAAATATCCAAATGTGTGAGGGGCTGATCACA +
Preference number: 5 (lower is better)
Translates to: CFRKLERLIIHGSWP*VTCANIQMCEGLIT
Trigger: TGTGATCAGCCCCTCACACATTTGGATATTTGCACATGTGACCCAAGGCCAAGACCCATGGATTATAAGTCTCTCCAGTTTCCTAAAGCA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACAGGTCTCCCAACCTCTTaGTCCAAATGTCGGAGAATG +
Preference number: 5 (lower is better)
Translates to: KVFLSNQRRWEATFISFTGLPTS*SKCRRM
Trigger: CATTCTCCGACATTTGGACAAAGAGGTTGGGAGACC...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACACCATGGGTCTTGGCCTaGGGTCACATGTGCAAATAT +
Preference number: 5 (lower is better)
Translates to: KVFLSNQRRWEATFISFTPWVLA*GHMCKY
Trigger: ATATTTGCACATGTGACCCAAGGCCAAGACCCATGG...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGGAGCGACCATTGTATaGCTACTGGAAGTAGTTCCT +
Preference number: 5 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIGATIV*LLEVVP
Trigger: AGGAACTACTTCCAGTAGCAATACAATGGTCGCTCC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAAAGAAGTCGAAGTCCTaGAAGACGCCAAACTGCTGC +
Preference number: 5 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLKKSKS*KTPNCC
Trigger: GCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCTT...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp CTTCAGGGCCCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCCTCTCCAAACTTCCTTaGAATTGTCTGAAACAGTCT +
Preference number: 5 (lower is better)
Translates to: LQGPQNIHSISDHNFSFSLSKLP*NCLKQS
Trigger: AGACTGTTTCAGACAATTCAAAGGAAGTTTGGAGAG...GCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGGGCCCTGAAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCTGTATATGTCTTCGTaGGCACCGAATGTCCTCTTG +
Preference number: 5 (lower is better)
Translates to: HLLWLVINIDTSTDQRAELYMSS*APNVLL
Trigger: CAAGAGGACATTCGGTGCCAACGAAGACATATACAG...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCAGTTCTTCTGACATGTaGATGACCTCTGCTTCATTC +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPSSSDM*MTSASF
Trigger: GAATGAAGCAGAGGTCATCAACATGTCAGAAGAACT...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCTGCCGAAGATGTCATaGGGCCAGAGGGTTCTGAAA +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDLPKMS*GQRVLK
Trigger: TTTCAGAACCCTCTGGCCCAATGACATCTTCGGCAG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp ACAGCTGATACAAATTCCTTGTTCTTCAAGGTTTCGATCAGAGAGTaGATGGCAGTTTCTATCGTGGTCTGGGCCGCTTTGGAGATATCA +
Preference number: 5 (lower is better)
Translates to: TADTNSLFFKVSIRE*MAVSIVVWAALEIS
Trigger: TGATATCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCATTCACTCTCTGATCGAAACCTTGAAGAACAAGGAATTTGTATCAGCTGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp GTCATTGGGCCAGAGGGTTCTGAAAGCTTTGACTTGTGCCACAGCTaGTACAAATTCCTTGTTCTTCAAGGTTTCGATCAGAGAGTGAAT +
Preference number: 5 (lower is better)
Translates to: VIGPEGSESFDLCHS*YKFLVLQGFDQRVN
Trigger: ATTCACTCTCTGATCGAAACCTTGAAGAACAAGGAATTTGTATCAGCTGTGGCACAAGTCAAAGCTTTCAGAACCCTCTGGCCCAATGAC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 90 bp CAGCTCAATGAGGTCCGTTCTGCTCATACCATCGGGAATCAACCTTaGAATTGCAGCAATGCAGGTTCTAAACAAATCGATTTTGGGTTT +
Preference number: 5 (lower is better)
Translates to: QLNEVRSAHTIGNQP*NCSNAGSKQIDFGF
Trigger: AAACCCAAAATCGATTTGTTTAGAACCTGCATTGCTGCAATTCCAAGGTTGATTCCCGATGGTATGAGCAGAACGGACCTCATTGAGCTG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp TTTTCTTGCTTTAGGAAACTGGAGAGACTTATAATCCATGGGTCTTaGCCTTGGGTCACATGTGCAAATATCCAAATGTGTGAGGGGCTG +
Preference number: 5 (lower is better)
Translates to: FSCFRKLERLIIHGS*PWVTCANIQMCEGL
Trigger: CAGCCCCTCACACATTTGGATATTTGCACATGTGACCCAAGGCCAAGACCCATGGATTATAAGTCTCTCCAGTTTCCTAAAGCAAGAAAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp CAACTTCTTCTTCTTGAATTATGTCCTCGGTGGTGGAGATCAAGCTaGTCTGTTGGTCCCCGACTTCCAAATCCTCATTTGAAGAAAACA +
Preference number: 5 (lower is better)
Translates to: QLLLLELCPRWWRSS*SVGPRLPNPHLKKT
Trigger: TGTTTTCTTCAAATGAGGATTTGGAAGTCGGGGACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCTAAACAAATCGATTTaGGGTTTTCTTTCCCCCGTA +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPLNKSI*GFLSPV
Trigger: TACGGGGGAAAGAAAACCCAAAATCGATTTGTTTAG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCTGTTCTGGAACACGTaGGCAATGGCTTTGAAGCAG +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDLFWNT*AMALKQ
Trigger: CTGCTTCAAAGCCATTGCCAACGTGTTCCAGAACAG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGCTGTTAGCTGCATACTaGTTTCCCATGACAGGATCG +
Preference number: 5 (lower is better)
Translates to: SKIILQCSFRHALRSCHQLLAAY*FPMTGS
Trigger: CGATCCTGTCATGGGAAACAAGTATGCAGCTAACAG...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AATAAGTTAACTTGTGTAATGAGAGGCGCCGGCGGGCAGCGTCCATCTTTATTTGGGCTCTGTACGTATTaGCCAATGATCTTTATGATC +
Preference number: 5 (lower is better)
Translates to: NKLTCVMRGAGGQRPSLFGLCTY*PMIFMI
Trigger: GATCATAAAGATCATTGGCAAATACGTACAGAGCCC...AAATAAAGATGGACGCTGCCCGCCGGCGCCTCTCATTACACAAGTTAACTTATT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGTCCTTCGAGACGTTATaGAAAATTTTAGCGAAGGAG +
Preference number: 5 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRSFETL*KILAKE
Trigger: CTCCTTCGCTAAAATTTTCAATAACGTCTCGAAGGA...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCTCCTTCGAGACGTTATaGAAAATTTTAGCGAAGGAG +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPSFETL*KILAKE
Trigger: CTCCTTCGCTAAAATTTTCAATAACGTCTCGAAGGA...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ATTAAGTGTCAACTCTGTGTTGATGGTGGCTGGAAATCCAAGTGGCTCTGCAGGAATGAGCTTTTAAACTaGGTACCAATGCGCTGTAGA +
Preference number: 5 (lower is better)
Translates to: IKCQLCVDGGWKSKWLCRNELLN*VPMRCR
Trigger: TCTACAGCGCATTGGTACCAAGTTTAAAAGCTCATT...CCTGCAGAGCCACTTGGATTTCCAGCCACCATCAACACAGAGTTGACACTTAAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp GAACAGGAATCTGCTTTAGAACTTCTACCAAAACTAAACAGAAAATaGAGTCTACGGCTAAATCCCGCCGCTCCAGGAGGTAATCTCTCT +
Preference number: 5 (lower is better)
Translates to: EQESALELLPKLNRK*SLRLNPAAPGGNLS
Trigger: AGAGAGATTACCTCCTGGAGCGGCGGGATTTAGCCGTAGACTTCATTTTCTGTTTAGTTTTGGTAGAAGTTCTAAAGCAGATTCCTGTTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp TGTTCTTCAAGGTTTCGATCAGAGAGTGAATGGCAGTTTCTATCGTaGTCTGGGCCGCTTTGGAGATATCAATTTCTTCATTTTCCGAAG +
Preference number: 5 (lower is better)
Translates to: CSSRFRSESEWQFLS*SGPLWRYQFLHFPK
Trigger: CTTCGGAAAATGAAGAAATTGATATCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCATTCACTCTCTGATCGAAACCTTGAAGAACA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATATCTTCACAAATATATaGAGAGGGGTGTCACGGGGG +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDIFTNI*RGVSRG
Trigger: CCCCCGTGACACCCCTCTCAATATATTTGTGAAGAT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCACTGGTCATACACATaGGTCTCCCAACCTCTTTGT +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDHWSYT*VSQPLC
Trigger: ACAAAGAGGTTGGGAGACCAATGTGTATGACCAGTG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TCAAAAATAATCTTGCAGTGCTCTTTTAGGCATGCTCTGAGAAGCTGTCACCAGGCTGTAGAGCAGTGTTaGGGAAGGTTTTCTTGCTTT +
Preference number: 5 (lower is better)
Translates to: SKIILQCSFRHALRSCHQAVEQC*GRFSCF
Trigger: AAAGCAAGAAAACCTTCCCAAACACTGCTCTACAGC...CTGGTGACAGCTTCTCAGAGCATGCCTAAAAGAGCACTGCAAGATTATTTTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATCAGGATCTGCAAGAGTaGCATAGCAACTTCATAGAT +
Preference number: 5 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHQDLQE*HSNFID
Trigger: ATCTATGAAGTTGCTATGCAACTCTTGCAGATCCTG...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAGGAGCGACCATTGTATaGCTACTGGAAGTAGTTCCT +
Preference number: 5 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVGATIV*LLEVVP
Trigger: AGGAACTACTTCCAGTAGCAATACAATGGTCGCTCC...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCTGTTAGCTGCATACTaGTTTCCCATGACAGGATCG +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDLLAAY*FPMTGS
Trigger: CGATCCTGTCATGGGAAACAAGTATGCAGCTAACAG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACACTTTGCAAAACTGAGTaGGGCTGTCAAAATGCTGGA +
Preference number: 5 (lower is better)
Translates to: KVFLSNQRRWEATFISFTLCKTE*GCQNAG
Trigger: TCCAGCATTTTGACAGCCCAACTCAGTTTTGCAAAG...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCGGGCTCTGTACGTATTaGCCAATGATCTTTATGATC +
Preference number: 5 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIGLCTY*PMIFMI
Trigger: GATCATAAAGATCATTGGCAAATACGTACAGAGCCC...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATCTGTATATGTCTTCGTaGGCACCGAATGTCCTCTTG +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDLYMSS*APNVLL
Trigger: CAAGAGGACATTCGGTGCCAACGAAGACATATACAG...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp AGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCTTCAGCTTACTCCCCTTGATGGTATTTACTaGGTTGATGAGTTTGCAGTA +
Preference number: 5 (lower is better)
Translates to: RVPKRCLASSLDHLQLTPLDGIY*VDEFAV
Trigger: TACTGCAAACTCATCAACCAAGTAAATACCATCAAG...GGGAGTAAGCTGAAGATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp AAGCAATTCATTTCTATTCCAAACTCTGGAGCCTCGGAGCCCAGTTTGCAAACAAGTTCTTCTGACATGTaGATGACCTCTGCTTCATTC +
Preference number: 5 (lower is better)
Translates to: KQFISIPNSGASEPSLQTSSSDM*MTSASF
Trigger: GAATGAAGCAGAGGTCATCAACATGTCAGAAGAACT...TGTTTGCAAACTGGGCTCCGAGGCTCCAGAGTTTGGAATAGAAATGAATTGCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CCGCAGAACATACACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATAGTTCTTCTGACATGTaGATGACCTCTGCTTCATTC +
Preference number: 5 (lower is better)
Translates to: PQNIHSISDHNFSFSFGHSSSDM*MTSASF
Trigger: GAATGAAGCAGAGGTCATCAACATGTCAGAAGAACT...ATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGTGTATGTTCTGCGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATAGGGTTCTGAAAGCTTaGACTTGTGCCACAGCTGAT +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDRVLKA*TCATAD
Trigger: ATCAGCTGTGGCACAAGTCAAAGCTTTCAGAACCCT...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 90 bp AAAGCTAGGTTTAGAACCTCATGGACTAAGGGGTCGGGCACAGGATaGACAGGAATCTGCTTTAGAACTTCTACCAAAACTAAACAGAAA +
Preference number: 5 (lower is better)
Translates to: KARFRTSWTKGSGTG*TGICFRTSTKTKQK
Trigger: TTTCTGTTTAGTTTTGGTAGAAGTTCTAAAGCAGATTCCTGTTCATCCTGTGCCCGACCCCTTAGTCCATGAGGTTCTAAACCTAGCTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 90 bp AATGAGGTCCGTTCTGCTCATACCATCGGGAATCAACCTTGGAATTaGAGCAATGCAGGTTCTAAACAAATCGATTTTGGGTTTTCTTTC +
Preference number: 5 (lower is better)
Translates to: NEVRSAHTIGNQPWN*SNAGSKQIDFGFSF
Trigger: GAAAGAAAACCCAAAATCGATTTGTTTAGAACCTGCATTGCTGCAATTCCAAGGTTGATTCCCGATGGTATGAGCAGAACGGACCTCATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 90 bp CTGATACAAATTCCTTGTTCTTCAAGGTTTCGATCAGAGAGTGAATaGCAGTTTCTATCGTGGTCTGGGCCGCTTTGGAGATATCAATTT +
Preference number: 5 (lower is better)
Translates to: LIQIPCSSRFRSESE*QFLSWSGPLWRYQF
Trigger: AAATTGATATCTCCAAAGCGGCCCAGACCACGATAGAAACTGCCATTCACTCTCTGATCGAAACCTTGAAGAACAAGGAATTTGTATCAG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp CATCTGCTTTGGTTAGTTATCAACATCGACACAAGCACTGATCAGAGAGCTGAGCTAAACAAATCGATTTaGGGTTTTCTTTCCCCCGTA +
Preference number: 5 (lower is better)
Translates to: HLLWLVINIDTSTDQRAELNKSI*GFLSPV
Trigger: TACGGGGGAAAGAAAACCCAAAATCGATTTGTTTAG...CTCAGCTCTCTGATCAGTGCTTGTGTCGATGTTGATAACTAACCAAAGCAGATG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENSMUST00000101127.12
CDS-3UTR CAA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCATTCTAACAGAGATGTaGCTATCCAAAAGATGGTGG +
Preference number: 5 (lower is better)
Translates to: INEAQGFLKGAWLAVLIIILTEM*LSKRWW
Trigger: CCACCATCTTTTGGATAGCAACATCTCTGTTAGAAT...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp ACAAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTAGGGCTCTGTACGTATTaGCCAATGATCTTTATGATC +
Preference number: 5 (lower is better)
Translates to: TRCSFQIRGVGRLHSFPLGLCTY*PMIFMI
Trigger: GATCATAAAGATCATTGGCAAATACGTACAGAGCCC...TAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTTGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TATCTGTCTGACTGGGTGGTCAAGTTGATCATTAAGTGTCAACTCTGTGTTGATTTCTGGAAAGCCGTCTaGTTCATCTTCCTCTTGACT +
Preference number: 5 (lower is better)
Translates to: YLSDWVVKLIIKCQLCVDFWKAV*FIFLLT
Trigger: AGTCAAGAGGAAGATGAACAAGACGGCTTTCCAGAA...ATCAACACAGAGTTGACACTTAATGATCAACTTGACCACCCAGTCAGACAGATA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS-3UTR CAA 90 bp TCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTAACAGCGAATGAGCTTTTAAACTaGGTACCAATGCGCTGTAGA +
Preference number: 5 (lower is better)
Translates to: SVTTTFPLALDMFSDVTANELLN*VPMRCR
Trigger: TCTACAGCGCATTGGTACCAAGTTTAAAAGCTCATT...CGCTGTTACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp ATCAATGAAGCACAAGGGTTCCTAAAAGGTGCTTGGCTAGCAGTCTTGATCATCCTTGATGGTATTTACTaGGTTGATGAGTTTGCAGTA +
Preference number: 5 (lower is better)
Translates to: INEAQGFLKGAWLAVLIILDGIY*VDEFAV
Trigger: TACTGCAAACTCATCAACCAAGTAAATACCATCAAG...GATGATCAAGACTGCTAGCCAAGCACCTTTTAGGAACCCTTGTGCTTCATTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp ACTCCATCAGTGACCACAACTTTTCCTTTAGCTTTGGACATGTTCTCTGATGTACTCTCCAAACTTCCTTaGAATTGTCTGAAACAGTCT +
Preference number: 5 (lower is better)
Translates to: TPSVTTTFPLALDMFSDVLSKLP*NCLKQS
Trigger: AGACTGTTTCAGACAATTCAAAGGAAGTTTGGAGAG...TACATCAGAGAACATGTCCAAAGCTAAAGGAAAAGTTGTGGTCACTGATGGAGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS-3UTR CAA 90 bp AAGGTGTTCCTTTCAAATCAGAGGCGTTGGGAGGCTACATTCATTTCCTTTACACTTGATGGTATTTACTaGGTTGATGAGTTTGCAGTA +
Preference number: 5 (lower is better)
Translates to: KVFLSNQRRWEATFISFTLDGIY*VDEFAV
Trigger: TACTGCAAACTCATCAACCAAGTAAATACCATCAAG...TGTAAAGGAAATGAATGTAGCCTCCCAACGCCTCTGATTTGAAAGGAACACCTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS GCA 90 bp TATCCTAATTACATAAACCCACAACAGCCTATACAAAGACTCCAGTaGAACTCGAGACATTTTAGGGTCTTTATTCTGCAGGGTTTCTAT +
Preference number: 5 (lower is better)
Translates to: YPNYINPQQPIQRLQ*NSRHFRVFILQGFY
Trigger: ATAGAAACCCTGCAGAATAAAGACCCTAAAATGTCTCGAGTTGCACTGGAGTCTTTGTATAGGCTGTTGTGGGTTTATGTAATTAGGATA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000153903.3
CDS CCA 90 bp ATTAATTGTACCAACATCTTTACAGCGTTATCAAGAAGGGTGGGGTaGACATCAGTCACTTCACGAACGATAAAATATACAAAGCCTGAA +
Preference number: 5 (lower is better)
Translates to: INCTNIFTALSRRVG*TSVTSRTIKYTKPE
Trigger: TTCAGGCTTTGTATATTTTATCGTTCGTGAAGTGACTGATGTCCACCCCACCCTTCTTGATAACGCTGTAAAGATGTTGGTACAATTAAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp CTCGGGAGGAGAGCATCTCACGGAGCCTGCGGGTGCTaGTGGGGACGGGGAGGTGGCTGCGCTGCAGCAGAG +
Preference number: 6 (lower is better)
Translates to: LGRRASHGACGC*WGRGGGCAAAE
Trigger: CTCTGCTGCAGCGCAGCCACCTCCCCGTCCCCATCAGCACCCGCAGGCTCCGTGAGATGCTCTCCTCCCGAG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp TCACGGAGCCTGCGGGTGCTGATGGGGACGGGGAGGTaGCTGCGCTGCAGCAGAGGACCAGGTAGTTTCTCC +
Preference number: 6 (lower is better)
Translates to: SRSLRVLMGTGR*LRCSRGPGSFS
Trigger: GGAGAAACTACCTGGTCCTCTGCTGCAGCGCAGCCACCTCCCCGTCCCCATCAGCACCCGCAGGCTCCGTGA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp GCCTGCCGCCCCGCGGGGTGTGCCGTCTGGATCCGCTaGCTGATCTCTGAGAATATGGCGAGAGTGAGCTCT +
Preference number: 6 (lower is better)
Translates to: ACRPAGCAVWIR*LISENMARVSS
Trigger: AGAGCTCACTCTCGCCATATTCTCAGAGATCAGCCAGCGGATCCAGACGGCACACCCCGCGGGGCGGCAGGC
65% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 72 bp ATGTGCGTGACGCCGGAACTGACGGGGTCCGTGAGCTaGAGCTCGCTCACCAGCTCTTCCAGCAGCTGCATG +
Preference number: 6 (lower is better)
Translates to: MCVTPELTGSVS*SSLTSSSSSCM
Trigger: CATGCAGCTGCTGGAAGAGCTGGTGAGCGAGCTGCAGCTCACGGACCCCGTCAGTTCCGGCGTCACGCACAT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 72 bp GGAGCCAGAGGAGGTGGAGGACGTGCTCCTGGTGACTaGGATCACCTTTGCCTTCCCATTCCTTCCCGCGGC +
Preference number: 6 (lower is better)
Translates to: GARGGGGRAPGD*DHLCLPIPSRG
Trigger: GCCGCGGGAAGGAATGGGAAGGCAAAGGTGATCGCAGTCACCAGGAGCACGTCCTCCACCTCCTCTGGCTCC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp CGGTATCCTCCTGGTTCGTCAGGGTCAGGCTGGGGGTaGTGCTGGAACACGGGTACTCCTGGAGGGATGGTG +
Preference number: 6 (lower is better)
Translates to: RYPPGSSGSGWG*CWNTGTPGGMV
Trigger: CACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGGATACCG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CCTCCTGGTTCGTCAGGGTCAGGCTGGGGGTGCTGCTaGAACACGGGTACTCCTGGAGGGATGGTGTGTCTC +
Preference number: 6 (lower is better)
Translates to: PPGSSGSGWGCC*NTGTPGGMVCL
Trigger: GAGACACACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp ACTCGTCGGTATCCTCCTGGTTCGTCAGGGTCAGGCTaGGGGTGCTGCTGGAACACGGGTACTCCTGGAGGG +
Preference number: 6 (lower is better)
Translates to: TRRYPPGSSGSG*GCCWNTGTPGG
Trigger: CCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCCAGCCTGACCCTGACGAACCAGGAGGATACCGACGAGT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp ACTCCTGTGGTGGGCATGGGAGGGTCTCCATCCTTCTaGTGCAGGCTGTCCGCGATGACGAGGAAGACTCGC +
Preference number: 6 (lower is better)
Translates to: TPVVGMGGSPSF*CRLSAMTRKTR
Trigger: GCGAGTCTTCCTCGTCATCGCGGACAGCCTGCAGCAGAAGGATGGAGACCCTCCCATGCCCACCACAGGAGT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000153903.3
CDS CCA 72 bp CGATGTTGTTCATCCAGGGCAGTAGGTAATGAAGCATaGCCTGCCGCCCCGCGGGGTGTGCCGTCTGGATCC +
Preference number: 6 (lower is better)
Translates to: RCCSSRAVGNEA*PAAPRGVPSGS
Trigger: GGATCCAGACGGCACACCCCGCGGGGCGGCAGGCCATGCTTCATTACCTACTGCCCTGGATGAACAACATCG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CCA 72 bp TCCAGGAGATGCTGTTTCAGGCACGTAATCCACCAGTaGCGACCAGCAGCCTCCAGCTGGCGGGAAGGGCAG +
Preference number: 6 (lower is better)
Translates to: SRRCCFRHVIHQ*RPAASSWREGQ
Trigger: CTGCCCTTCCCGCCAGCTGGAGGCTGCTGGTCGCCACTGGTGGATTACGTGCCTGAAACAGCATCTCCTGGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CAA 72 bp GAACACGGGTACTCCTGGAGGGATGGTGTGTCTCCTTaGTCAATGCTGTCCAGCGAGCGCCGGCGGACTCCC +
Preference number: 6 (lower is better)
Translates to: EHGYSWRDGVSP*SMLSSERRRTP
Trigger: GGGAGTCCGCCGGCGCTCGCTGGACAGCATTGACAAAGGAGACACACCATCCCTCCAGGAGTACCCGTGTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp GGGCCCGCCCAGTGGCTGAACAACATGAACAGGCTGTaGCGCAGGCTCTGCTGGGGAAAGATGCTTCTCCTC +
Preference number: 6 (lower is better)
Translates to: GPAQWLNNMNRL*RRLCWGKMLLL
Trigger: GAGGAGAAGCATCTTTCCCCAGCAGAGCCTGCGTCACAGCCTGTTCATGTTGTTCAGCCACTGGGCGGGCCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp CAGGATCTGGCTTGCGGTGAGGGCGGCTTCTTCCTCTaGGGACTCGTCGGTATCCTCCTGGTTCGTCAGGGT +
Preference number: 6 (lower is better)
Translates to: QDLACGEGGFFL*GLVGILLVRQG
Trigger: ACCCTGACGAACCAGGAGGATACCGACGAGTCCTCAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCCTG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp ATGGTGGCCATCAGGTTGCTCGGCTCCGTCGGGGGCTaGGTGTCGTACACACCTTTCTCTCTCAGCGAGGAA +
Preference number: 6 (lower is better)
Translates to: MVAIRLLGSVGG*VSYTPFSLSEE
Trigger: TTCCTCGCTGAGAGAGAAAGGTGTGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCAT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CGATCTTGGAATCGATGCTGTAGCCACTGTCAGGGGTaGACGCCAGCGTCTCGGGAGGAGAGCATCTCACGG +
Preference number: 6 (lower is better)
Translates to: RSWNRCCSHCQG*TPASREESISR
Trigger: CCGTGAGATGCTCTCCTCCCGAGACGCTGGCGTCCACCCCTGACAGTGGCTACAGCATCGATTCCAAGATCG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp GGGGGTGCTGCTGGAACACGGGTACTCCTGGAGGGATaGTGTGTCTCCTTTGTCAATGCTGTCCAGCGAGCG +
Preference number: 6 (lower is better)
Translates to: GGAAGTRVLLEG*CVSFVNAVQRA
Trigger: CGCTCGCTGGACAGCATTGACAAAGGAGACACACCATCCCTCCAGGAGTACCCGTGTTCCAGCAGCACCCCC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp CGCGGGGTGTGCCGTCTGGATCCGCTGGCTGATCTCTaGGAATATGGCGAGAGTGAGCTCTGGATATGCTCG +
Preference number: 6 (lower is better)
Translates to: RGVCRLDPLADL*EYGESELWICS
Trigger: CGAGCATATCCAGAGCTCACTCTCGCCATATTCTCAGAGATCAGCCAGCGGATCCAGACGGCACACCCCGCG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp TCAGCATCTGGGTGCGTGACAGGATCTGGCTTGCGGTaGGGGCGGCTTCTTCCTCTGAGGACTCGTCGGTAT +
Preference number: 6 (lower is better)
Translates to: SASGCVTGSGLR*GRLLPLRTRRY
Trigger: ATACCGACGAGTCCTCAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp CTCCGTCACACAGTCACTGTTCAGCATCTGGGTGCGTaGCAGGATCTGGCTTGCGGTGAGGGCGGCTTCTTC +
Preference number: 6 (lower is better)
Translates to: LRHTVTVQHLGA*QDLACGEGGFF
Trigger: GAAGAAGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGAACAGTGACTGTGTGACGGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp TCCTCGCGCCAGTCTGGGAAATCAAGCATCAGAGCCTaGAGGGTGTTGAAGGCCAGCGCCCGCAGTTCTTCA +
Preference number: 6 (lower is better)
Translates to: SSRQSGKSSIRA*RVLKASARSSS
Trigger: TGAAGAACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCTGATGCTTGATTTCCCAGACTGGCGCGAGGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp CTCCACCAGCCGGGAGAGGACATCGGAGAGTGTGTCTaGAGACAGGGGCTGCTTCAGTGCCCTGAAAATCTG +
Preference number: 6 (lower is better)
Translates to: LHQPGEDIGECV*RQGLLQCPENL
Trigger: CAGATTTTCAGGGCACTGAAGCAGCCCCTGTCTGCAGACACACTCTCCGATGTCCTCTCCCGGCTGGTGGAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CAGTCACTGTTCAGCATCTGGGTGCGTGACAGGATCTaGCTTGCGGTGAGGGCGGCTTCTTCCTCTGAGGAC +
Preference number: 6 (lower is better)
Translates to: QSLFSIWVRDRI*LAVRAASSSED
Trigger: GTCCTCAGAGGAAGAAGCCGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGAACAGTGACTG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp GCAGCCTCCAGCTGGCGGGAAGGGCAGTGGCTCTCCTaGGTTGTGCTCCATCACTTTCAGGCGCCAATTAGA +
Preference number: 6 (lower is better)
Translates to: AASSWREGQWLS*VVLHHFQAPIR
Trigger: TCTAATTGGCGCCTGAAAGTGATGGAGCACAACCAAGGAGAGCCACTGCCCTTCCCGCCAGCTGGAGGCTGC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CAA 90 bp TCCTCGCGCCAGTCTGGGAAATCAAGCATCAGAGCCTGCAGGGTGTaGAAGGCCAGCGCCCGCAGTTCTTCATCCATGTGGATTGTGAGC +
Preference number: 6 (lower is better)
Translates to: SSRQSGKSSIRACRV*KASARSSSSMWIVS
Trigger: GCTCACAATCCACATGGATGAAGAACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCTGATGCTTGATTTCCCAGACTGGCGCGAGGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp CCAGTCTTCTCGTGGCAGGCCGACTGCTACAGAGGATaGCCAGGGCAAAGCCTTCGACCACATGGAACACAG +
Preference number: 6 (lower is better)
Translates to: PVFSWQADCYRG*PGQSLRPHGTQ
Trigger: CTGTGTTCCATGTGGTCGAAGGCTTTGCCCTGGTCATCCTCTGTAGCAGTCGGCCTGCCACGAGAAGACTGG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp GGTAATCCCTGTTCTGGAACACGTTGGCAATGGCTTTaGAGCAGCCGGCTGCTACTCTCCGGGAGCCGGTGT +
Preference number: 6 (lower is better)
Translates to: GNPCSGTRWQWL*SSRLLLSGSRC
Trigger: ACACCGGCTCCCGGAGAGTAGCAGCCGGCTGCTTCAAAGCCATTGCCAACGTGTTCCAGAACAGGGATTACC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 72 bp ATCAAGCTGATGACGCTCTGGACCACGTGTGGGCTCTaGTCCTTCTGCCGCAGCTCTTTCAGCTCAGTCACG +
Preference number: 6 (lower is better)
Translates to: IKLMTLWTTCGL*SFCRSSFSSVT
Trigger: CGTGACTGAGCTGAAAGAGCTGCGGCAGAAGGAGCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTTGAT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp AAGAAGGGGACGGGATGCCAACGATCTTGGAATCGATaGTGTAGCCACTGTCAGGGGTGGACGCCAGCGTCT +
Preference number: 6 (lower is better)
Translates to: KKGTGCQRSWNR*CSHCQGWTPAS
Trigger: AGACGCTGGCGTCCACCCCTGACAGTGGCTACAGCATCGATTCCAAGATCGTTGGCATCCCGTCCCCTTCTT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp GAGATGTTGCTATCCAAAAGATGGTGGCCATCAGGTTaGTCGGCTCCGTCGGGGGCTGCGTGTCGTACACAC +
Preference number: 6 (lower is better)
Translates to: EMLLSKRWWPSG*SAPSGAACRTH
Trigger: GTGTGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CAGCCTCCAGCTGGCGGGAAGGGCAGTGGCTCTCCTTaGTTGTGCTCCATCACTTTCAGGCGCCAATTAGAA +
Preference number: 6 (lower is better)
Translates to: QPPAGGKGSGSP*LCSITFRRQLE
Trigger: TTCTAATTGGCGCCTGAAAGTGATGGAGCACAACCAAGGAGAGCCACTGCCCTTCCCGCCAGCTGGAGGCTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CCA 72 bp AGCCTACGTCCACTCCGTAGGCCTTGGGGATGTCATTaGGGACGACAAGACTTGCAGAGCGAGACACCACCA +
Preference number: 6 (lower is better)
Translates to: SLRPLRRPWGCH*GRQDLQSETPP
Trigger: TGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGCCTACGGAGTGGACGTAGGCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp ATCATGTCCTCCGTCACACAGTCACTGTTCAGCATCTaGGTGCGTGACAGGATCTGGCTTGCGGTGAGGGCG +
Preference number: 6 (lower is better)
Translates to: IMSSVTQSLFSI*VRDRIWLAVRA
Trigger: CGCCCTCACCGCAAGCCAGATCCTGTCACGCACCCAGATGCTGAACAGTGACTGTGTGACGGAGGACATGAT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp AGGCCAGCTCATCGCCGTACTTCGCTGTCATGTACATaGGATTGTTCAACACCATGGCGGTGGCCTGTGGGG +
Preference number: 6 (lower is better)
Translates to: RPAHRRTSLSCT*DCSTPWRWPVG
Trigger: CCCCACAGGCCACCGCCATGGTGTTGAACAATCTCATGTACATGACAGCGAAGTACGGCGATGAGCTGGCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp CACGAAAGGGCCGTCTGCAGGGCCACCTCGCTGAGATaGCGCTCCAAGTGTATTCCTGCATTTGACTGCTTG +
Preference number: 6 (lower is better)
Translates to: HERAVCRATSLR*RSKCIPAFDCL
Trigger: CAAGCAGTCAAATGCAGGAATACACTTGGAGCGTCATCTCAGCGAGGTGGCCCTGCAGACGGCCCTTTCGTG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000201277.2
CDS GCA 72 bp ATGACGCTCTGGACCACGTGTGGGCTCTGCTCCTTCTaGCGCAGCTCTTTCAGCTCAGTCACGAACTTCTTC +
Preference number: 6 (lower is better)
Translates to: MTLWTTCGLCSF*RSSFSSVTNFF
Trigger: GAAGAAGTTCGTGACTGAGCTGAAAGAGCTGCGGCAGAAGGAGCAGAGCCCACACGTGGTCCAGAGCGTCAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp AAGAACTTCATCCCCATGATCAAGCTGATGACGCTCTaGACCACGTGTGGGCTCTGCTCCTTCTGCCGCAGC +
Preference number: 6 (lower is better)
Translates to: KNFIPMIKLMTL*TTCGLCSFCRS
Trigger: GCTGCGGCAGAAGGAGCAGAGCCCACACGTGGTCCAGAGCGTCATCAGCTTGATCATGGGGATGAAGTTCTT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp CGGATTCTAACAGAGATGTTGCTATCCAAAAGATGGTaGCCATCAGGTTGCTCGGCTCCGTCGGGGGCTGCG +
Preference number: 6 (lower is better)
Translates to: RILTEMLLSKRW*PSGCSAPSGAA
Trigger: CGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAATCCG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp AGATTTCGGGAGAGCCTACGTCCACTCCGTAGGCCTTaGGGATGTCATTGGGGACGACAAGACTTGCAGAGC +
Preference number: 6 (lower is better)
Translates to: RFRESLRPLRRP*GCHWGRQDLQS
Trigger: GCTCTGCAAGTCTTGTCGTCCCCAATGACATCCCCAAGGCCTACGGAGTGGACGTAGGCTCTCCCGAAATCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp CAGTCTGGGAAATCAAGCATCAGAGCCTGCAGGGTGTaGAAGGCCAGCGCCCGCAGTTCTTCATCCATGTGG +
Preference number: 6 (lower is better)
Translates to: QSGKSSIRACRV*KASARSSSSMW
Trigger: CCACATGGATGAAGAACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCTGATGCTTGATTTCCCAGACTG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CAA 72 bp AGAGATGTTGCTATCCAAAAGATGGTGGCCATCAGGTaGCTCGGCTCCGTCGGGGGCTGCGTGTCGTACACA +
Preference number: 6 (lower is better)
Translates to: RDVAIQKMVAIR*LGSVGGCVSYT
Trigger: TGTGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 90 bp TGTGCCGTCTGCTTGACTGTCAACACCCTGGGCTCATTGAATTCCTaGTCCCTGAGGAGGACAGAGGCGACAGTCCGGATGTCACTGTTG +
Preference number: 6 (lower is better)
Translates to: CAVCLTVNTLGSLNS*SLRRTEATVRMSLL
Trigger: CAACAGTGACATCCGGACTGTCGCCTCTGTCCTCCTCAGGGACAAGGAATTCAATGAGCCCAGGGTGTTGACAGTCAAGCAGACGGCACA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp AGTCTGGGAAATCAAGCATCAGAGCCTGCAGGGTGTTaGAGGCCAGCGCCCGCAGTTCTTCATCCATGTGGA +
Preference number: 6 (lower is better)
Translates to: SLGNQASEPAGC*RPAPAVLHPCG
Trigger: TCCACATGGATGAAGAACTGCGGGCGCTGGCCTTCAACACCCTGCAGGCTCTGATGCTTGATTTCCCAGACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp GGTTGGTCCTGCCGAGGCCTAGAACGAGGGACTCTGTaGTCTCCATGCTCTCAGAGCGCATCATTGGAACTA +
Preference number: 6 (lower is better)
Translates to: GWSCRGLERGTL*SPCSQSASLEL
Trigger: TAGTTCCAATGATGCGCTCTGAGAGCATGGAGATCACAGAGTCCCTCGTTCTAGGCCTCGGCAGGACCAACC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp CTCTGCCAGGTAAGTCACAAGACTGAAGGTCGCCTCTaGGAAAGAGTCGTGCAGGTACCGGCACACCACGTT +
Preference number: 6 (lower is better)
Translates to: LCQVSHKTEGRL*ERVVQVPAHHV
Trigger: AACGTGGTGTGCCGGTACCTGCACGACTCTTTCTCAGAGGCGACCTTCAGTCTTGTGACTTACCTGGCAGAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp AGTACGTCTTCTGTCGTGTTGCTGCTAGCAGAATCCTaGGACTGCAGCAGGTCCTGGTGCTCGGGCATCATG +
Preference number: 6 (lower is better)
Translates to: STSSVVLLLAES*DCSRSWCSGIM
Trigger: CATGATGCCCGAGCACCAGGACCTGCTGCAGTCTCAGGATTCTGCTAGCAGCAACACGACAGAAGACGTACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp TTCACCGGGCTTGACATCCGGGTCAATCGTGATGCTTaGCATGATGGCGCTCTTTCTTCCCGGAGTGGAGTG +
Preference number: 6 (lower is better)
Translates to: FTGLDIRVNRDA*HDGALSSRSGV
Trigger: CACTCCACTCCGGGAAGAAAGAGCGCCATCATGTCAAGCATCACGATTGACCCGGATGTCAAGCCCGGTGAA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000176910.3
CDS GCA 72 bp CAGTCAAACAGGGTTCGGAGTAAGGAGGGGAGACAGTaGTCGGCTACGGAGCTCATAGAGCTTACCAACTGG +
Preference number: 6 (lower is better)
Translates to: QSNRVRSKEGRQ*SATELIELTNW
Trigger: CCAGTTGGTAAGCTCTATGAGCTCCGTAGCCGAGCACTGTCTCCCCTCCTTACTCCGAACCCTGTTTGACTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp GTTGAGGAAGTGAGTTTCGCTATCAAGGCCGCCGCTTaGACTGTGGCTAATGACACCAGCATCCGCCAACAG +
Preference number: 6 (lower is better)
Translates to: VEEVSFAIKAAA*TVANDTSIRQQ
Trigger: CTGTTGGCGGATGCTGGTGTCATTAGCCACAGTGCAAGCGGCGGCCTTGATAGCGAAACTCACTTCCTCAAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp GTCCCATCACTATCAGTAAGTGCAGCAGCAGGCGCTTaGAGTGCTCGTACACCTCAGGGTGGCAGTGATCAA +
Preference number: 6 (lower is better)
Translates to: VPSLSVSAAAGA*SARTPQGGSDQ
Trigger: TTGATCACTGCCACCCTGAGGTGTACGAGCACTGCAAGCGCCTGCTGCTGCACTTACTGATAGTGATGGGAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CCA 72 bp ATCTTCTCCCGGCTCTCTGACTTATCCAGAGGCAAGTaGGTGAGCAGTTTGCTCAGAAGCCTGAGAGCCAGG +
Preference number: 6 (lower is better)
Translates to: IFSRLSDLSRGK*VSSLLRSLRAR
Trigger: CCTGGCTCTCAGGCTTCTGAGCAAACTGCTCACCCACTTGCCTCTGGATAAGTCAGAGAGCCGGGAGAAGAT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CGTCCTCGTAAGCCATTGGCTGGAAAGCTGCTATTATaGCAGACAGAAAGGGGGTCGGGAGAGGCGAGGTTT +
Preference number: 6 (lower is better)
Translates to: RPRKPLAGKLLL*QTERGSGEARF
Trigger: AAACCTCGCCTCTCCCGACCCCCTTTCTGTCTGCCATAATAGCAGCTTTCCAGCCAATGGCTTACGAGGACG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CAA 72 bp TGCTTGACTGTCAACACCCTGGGCTCATTGAATTCCTaGTCCCTGAGGAGGACAGAGGCGACAGTCCGGATG +
Preference number: 6 (lower is better)
Translates to: CLTVNTLGSLNS*SLRRTEATVRM
Trigger: CATCCGGACTGTCGCCTCTGTCCTCCTCAGGGACAAGGAATTCAATGAGCCCAGGGTGTTGACAGTCAAGCA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CAA 90 bp ACCTCGCCGAGGAGGGTGGTGTGGAGGTGTGAAATGGCAGCGCTGTaGTTTCCTAAGCTGATACTAGAGGAGGTAGAACTGGAGCTAAGC +
Preference number: 6 (lower is better)
Translates to: TSPRRVVWRCEMAAL*FPKLILEEVELELS
Trigger: GCTTAGCTCCAGTTCTACCTCCTCTAGTATCAGCTTAGGAAACAACAGCGCTGCCATTTCACACCTCCACACCACCCTCCTCGGCGAGGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS CAA 90 bp GGGACGACAAGACTTGCAGAGCGAGACACCACCAGCTTCAGGATGTaGAGGGCTTCCTTCCAGTACGGGCTCTGTACGTATTTGCCAATG +
Preference number: 6 (lower is better)
Translates to: GTTRLAERDTTSFRM*RASFQYGLCTYLPM
Trigger: CATTGGCAAATACGTACAGAGCCCGTACTGGAAGGAAGCCCTCAACATCCTGAAGCTGGTGGTGTCTCGCTCTGCAAGTCTTGTCGTCCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp AAAGTGCAAATAAAGCCCGTATCTCTCGAAGGACGCTaGCTGCCAGTCTTCTCGTGGCAGGCCGACTGCTAC +
Preference number: 6 (lower is better)
Translates to: KVQIKPVSLEGR*LPVFSWQADCY
Trigger: GTAGCAGTCGGCCTGCCACGAGAAGACTGGCAGTCAGCGTCCTTCGAGAGATACGGGCTTTATTTGCACTTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp AAGAACACGAAAGGGCCGTCTGCAGGGCCACCTCGCTaGGATGACGCTCCAAGTGTATTCCTTCTGCATTTG +
Preference number: 6 (lower is better)
Translates to: KNTKGPSAGPPR*DDAPSVFLLHL
Trigger: CAAATGCAGAAGGAATACACTTGGAGCGTCATCTCAGCGAGGTGGCCCTGCAGACGGCCCTTTCGTGTTCTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp ACTGAGGAGGTGCACGGTCATCTCTTGGGTAGACACTaGGGTAAAGCCCTTAAGGAAGAGCTGCTGAAGGCC +
Preference number: 6 (lower is better)
Translates to: TEEVHGHLLGRH*GKALKEELLKA
Trigger: GGCCTTCAGCAGCTCTTCCTTAAGGGCTTTACCTCAGTGTCTACCCAAGAGATGACCGTGCACCTCCTCAGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp GACTTGCAGAGCGAGACACCACCAGCTTCAGGATGTTaGGGGCTTCCTTCCAGTACGGGCTCTGTACGTATT +
Preference number: 6 (lower is better)
Translates to: DLQSETPPASGC*GLPSSTGSVRI
Trigger: AATACGTACAGAGCCCGTACTGGAAGGAAGCCCTCAACATCCTGAAGCTGGTGGTGTCTCGCTCTGCAAGTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp AAGAACACGAAAGGGCCGTCTGCAGGGCCACCTCGCTaGGATGACGCTCCAAGTGTATTCCTGCATTTGACT +
Preference number: 6 (lower is better)
Translates to: KNTKGPSAGPPR*DDAPSVFLHLT
Trigger: AGTCAAATGCAGGAATACACTTGGAGCGTCATCTCAGCGAGGTGGCCCTGCAGACGGCCCTTTCGTGTTCTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000201277.2
CDS TCA 72 bp AAGAACACGAAAGGGCCGTCTGCAGGGCCACCTCGCTaGGATGACGCTCCAAGTGTATTCCTTCTTGAGGTA +
Preference number: 6 (lower is better)
Translates to: KNTKGPSAGPPR*DDAPSVFLLEV
Trigger: TACCTCAAGAAGGAATACACTTGGAGCGTCATCTCAGCGAGGTGGCCCTGCAGACGGCCCTTTCGTGTTCTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000202697.4
CDS GCA 72 bp AGTCACTTTTCTCCTCTTCGTAAGACCCTCCGGAGCTaGTACTGTATCGGGACTCCAGTCTGTGGTGTTGCC +
Preference number: 6 (lower is better)
Translates to: SHFSPLRKTLRS*YCIGTPVCGVA
Trigger: GGCAACACCACAGACTGGAGTCCCGATACAGTAGCAGCTCCGGAGGGTCTTACGAAGAGGAGAAAAGTGACT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 72 bp GTAATGAACTCCATGAGGGTTTTGACTTTTCCATCCTaGTCCACTGAGAGGTCCACCTCGCCGAGGAGGGTG +
Preference number: 6 (lower is better)
Translates to: VMNSMRVLTFPS*STERSTSPRRV
Trigger: CACCCTCCTCGGCGAGGTGGACCTCTCAGTGGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTTCATTAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS GCA 72 bp GCTGCTGAAGGCCGGGGAAGTTACTCCATTTCAACTTaGTCTGTACGTTCTCGATCTTCTCCCGGCTCTCTG +
Preference number: 6 (lower is better)
Translates to: AAEGRGSYSIST*SVRSRSSPGSL
Trigger: CAGAGAGCCGGGAGAAGATCGAGAACGTACAGAGCAAGTTGAAATGGAGTAACTTCCCCGGCCTTCAGCAGC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp CACCAGCGTCGGGCACTTCTCTTCCGCACAGACCTTTaGTATCCGGCTAGCTGTCTCTTTGCAAAACTGAGT +
Preference number: 6 (lower is better)
Translates to: HQRRALLFRTDL*YPASCLFAKLS
Trigger: ACTCAGTTTTGCAAAGAGACAGCTAGCCGGATAGCAAAGGTCTGTGCGGAAGAGAAGTGCCCGACGCTGGTG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp GTCACAAGACTGAAGGTCGCCTCTGAGAAAGAGTCGTaGAGGTACCGGCACACCACGTTGATCCAGTTGGAA +
Preference number: 6 (lower is better)
Translates to: VTRLKVASEKES*RYRHTTLIQLE
Trigger: TTCCAACTGGATCAACGTGGTGTGCCGGTACCTGCACGACTCTTTCTCAGAGGCGACCTTCAGTCTTGTGAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp ATGGCAGACAGAAAGGGGGTCGGGAGAGGCGAGGTTTaGACTTCTGGAAAGCCGTCTTGTTCATCTTCCTCT +
Preference number: 6 (lower is better)
Translates to: MADRKGVGRGEV*TSGKPSCSSSS
Trigger: AGAGGAAGATGAACAAGACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCGACCCCCTTTCTGTCTGCCAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CCA 72 bp GTGTTGAAGGCCAGCGCCCGCAGTTCTTCATCCATGTaGATTGTGAGCCTTGCTAACAGCTCAATGAGGTCC +
Preference number: 6 (lower is better)
Translates to: VLKASARSSSSM*IVSLANSSMRS
Trigger: GGACCTCATTGAGCTGTTAGCAAGGCTCACAATCCACATGGATGAAGAACTGCGGGCGCTGGCCTTCAACAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp AGTCGGATTCTAACAGAGATGTTGCTATCCAAAAGATaGTGGCCATCAGGTTGCTCGGCTCCGTCGGGGGCT +
Preference number: 6 (lower is better)
Translates to: SRILTEMLLSKR*WPSGCSAPSGA
Trigger: AGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAATCCGACT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CAGAAAGGGGGTCGGGAGAGGCGAGGTTTGCACTTCTaGAAAGCCGTCTTGTTCATCTTCCTCTTGACTGGA +
Preference number: 6 (lower is better)
Translates to: QKGGRERRGLHF*KAVLFIFLLTG
Trigger: TCCAGTCAAGAGGAAGATGAACAAGACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCGACCCCCTTTCTG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CCA 72 bp GCAACGCCACGCTTCTTCCTCGTCCTCGTAAGCCATTaGCTGGAAAGCTGCTATTATGGCAGACAGAAAGGG +
Preference number: 6 (lower is better)
Translates to: ATPRFFLVLVSH*LESCYYGRQKG
Trigger: CCCTTTCTGTCTGCCATAATAGCAGCTTTCCAGCCAATGGCTTACGAGGACGAGGAAGAAGCGTGGCGTTGC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CAA 72 bp CTGTCAGGGTTGCCATCTGTGGGAGCGACCATTGTATaGCTACTGGAAGTAGTTCCTGAGGTGACGGAAGGG +
Preference number: 6 (lower is better)
Translates to: LSGLPSVGATIV*LLEVVPEVTEG
Trigger: CCCTTCCGTCACCTCAGGAACTACTTCCAGTAGCAATACAATGGTCGCTCCCACAGATGGCAACCCTGACAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CAA 72 bp AGACTTGCAGAGCGAGACACCACCAGCTTCAGGATGTaGAGGGCTTCCTTCCAGTACGGGCTCTGTACGTAT +
Preference number: 6 (lower is better)
Translates to: RLAERDTTSFRM*RASFQYGLCTY
Trigger: ATACGTACAGAGCCCGTACTGGAAGGAAGCCCTCAACATCCTGAAGCTGGTGGTGTCTCGCTCTGCAAGTCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp TATGGCAGACAGAAAGGGGGTCGGGAGAGGCGAGGTTaGCACTTCTGGAAAGCCGTCTTGTTCATCTTCCTC +
Preference number: 6 (lower is better)
Translates to: YGRQKGGRERRG*HFWKAVLFIFL
Trigger: GAGGAAGATGAACAAGACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCGACCCCCTTTCTGTCTGCCATA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CAA 72 bp CGGTACAACCTTCTGCAGAGCTCCAGCTCATGCGCGTaGGTGTTCATCCTGTATATGTCTTCGTTGGCACCG +
Preference number: 6 (lower is better)
Translates to: RYNLLQSSSSCA*VFILYMSSLAP
Trigger: CGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATGAGCTGGAGCTCTGCAGAAGGTTGTACCG
54% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CAA 72 bp TGCACAGGGTCGTCATCACAGCTGCCGAAGATGTCATaGGGCCAGAGGGTTCTGAAAGCTTTGACTTGTGCC +
Preference number: 6 (lower is better)
Translates to: CTGSSSQLPKMS*GQRVLKALTCA
Trigger: GGCACAAGTCAAAGCTTTCAGAACCCTCTGGCCCAATGACATCTTCGGCAGCTGTGATGACGACCCTGTGCA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CAA 90 bp GATTCTAACAGAGATGTTGCTATCCAAAAGATGGTGGCCATCAGGTaGCTCGGCTCCGTCGGGGGCTGCGTGTCGTACACACCTTTCTCT +
Preference number: 6 (lower is better)
Translates to: DSNRDVAIQKMVAIR*LGSVGGCVSYTPFS
Trigger: AGAGAAAGGTGTGTACGACACGCAGCCCCCGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAATC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 90 bp AGCTCCAGCTCATGCGCGTTGGTGTTCATCCTGTATATGTCTTCGTaGGCACCGAATGTCCTCTTGCAGTTGTCTAGCCACTGCTCGGCT +
Preference number: 6 (lower is better)
Translates to: SSSSCALVFILYMSS*APNVLLQLSSHCSA
Trigger: AGCCGAGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATGAGCTGGAGCT
53% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS TCA 72 bp AAGTCCACGTACTCCAAGAGAGTGTTGTTGAGGAAGTaGGTTTCGCTATCAAGGCCGCCGCTTGCACTGTGG +
Preference number: 6 (lower is better)
Translates to: KSTYSKRVLLRK*VSLSRPPLALW
Trigger: CCACAGTGCAAGCGGCGGCCTTGATAGCGAAACTCACTTCCTCAACAACACTCTCTTGGAGTACGTGGACTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp GTCGCGTTAAGTCCACGTACTCCAAGAGAGTGTTGTTaGGGAAGTGAGTTTCGCTATCAAGGCCGCCGCTTG +
Preference number: 6 (lower is better)
Translates to: VALSPRTPRECC*GSEFRYQGRRL
Trigger: CAAGCGGCGGCCTTGATAGCGAAACTCACTTCCTCAACAACACTCTCTTGGAGTACGTGGACTTAACGCGAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp GGCTGCTCTGATCAGGGTTCAGCTCCAGCAGCAACGTaGCTGCTTCACAGCCCAACTGGTGAACCTTTTTAT +
Preference number: 6 (lower is better)
Translates to: GCSDQGSAPAAT*LLHSPTGEPFY
Trigger: ATAAAAAGGTTCACCAGTTGGGCTGTGAAGCAGTCACGTTGCTGCTGGAGCTGAACCCTGATCAGAGCAGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp ACACAGAATAGAGATGTGGCAGCGGGGACAGCTGACTaGGGACTCCATCCGTTCTCTGAACCTCCAGTTTGT +
Preference number: 6 (lower is better)
Translates to: TQNRDVAAGTAD*GLHPFSEPPVC
Trigger: ACAAACTGGAGGTTCAGAGAACGGATGGAGTCCTCAGTCAGCTGTCCCCGCTGCCACATCTCTATTCTGTGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp GCAGCTGCATGGTTTTGTCTCGACCCAGGTAGACGATaGCTTTCTTCACGTAAGGCAAGAGGCTTGGTTCGC +
Preference number: 6 (lower is better)
Translates to: AAAWFCLDPGRR*LSSRKARGLVR
Trigger: GCGAACCAAGCCTCTTGCCTTACGTGAAGAAAGTCATCGTCTACCTGGGTCGAGACAAAACCATGCAGCTGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp CTTGCTCTGTACGTTCTCGATCTTCTCCCGGCTCTCTaGCTTATCCAGAGGCAAGTGGGTGAGCAGTTTGCT +
Preference number: 6 (lower is better)
Translates to: LALYVLDLLPAL*LIQRQVGEQFA
Trigger: AGCAAACTGCTCACCCACTTGCCTCTGGATAAGTCAGAGAGCCGGGAGAAGATCGAGAACGTACAGAGCAAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp CTGAGAAAGAGTCGTGCAGGTACCGGCACACCACGTTaGTCCAGTTGGAACAGTCTCTGGAGTAGGTATGTG +
Preference number: 6 (lower is better)
Translates to: LRKSRAGTGTPR*SSWNSLWSRYV
Trigger: CACATACCTACTCCAGAGACTGTTCCAACTGGATCAACGTGGTGTGCCGGTACCTGCACGACTCTTTCTCAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp GCCGTCTTGTTCATCTTCCTCTTGACTGGACAACCCTaGGAAGTCAGCCTCTTCCTCCTCACACCGTTCATC +
Preference number: 6 (lower is better)
Translates to: AVLFIFLLTGQP*EVSLFLLTPFI
Trigger: GATGAACGGTGTGAGGAGGAAGAGGCTGACTTCTCAGGGTTGTCCAGTCAAGAGGAAGATGAACAAGACGGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS GCA 72 bp CCAACTGGTTTGGTCTGTGCTAGGAGCGGATATGACTaGACTGTGCGGAGAGACTCTCTGATCTCCAGGTTA +
Preference number: 6 (lower is better)
Translates to: PTGLVCARSGYD*TVRRDSLISRL
Trigger: TAACCTGGAGATCAGAGAGTCTCTCCGCACAGTGCAGTCATATCCGCTCCTAGCACAGACCAAACCAGTTGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 72 bp GAGGAAAGGCTTCGAGTCCTCGCCAAGCTACCACCGTaGTTTATCCGTCCATCCGTTATGTCCAGTGTGTTA +
Preference number: 6 (lower is better)
Translates to: EERLRVLAKLPP*FIRPSVMSSVL
Trigger: TAACACACTGGACATAACGGATGGACGGATAAACCACGGTGGTAGCTTGGCGAGGACTCGAAGCCTTTCCTC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp ACCTTTGCCTTCCCATTCCTTCCCGCGGCACTGTGTTaGCCTCCATACTTGTTCCCAATGATAGGTGTCTCA +
Preference number: 6 (lower is better)
Translates to: TFAFPFLPAALC*PPYLFPMIGVS
Trigger: TGAGACACCTATCATTGGGAACAAGTATGGAGGCCAACACAGTGCCGCGGGAAGGAATGGGAAGGCAAAGGT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp GGTACAACCTTCTGCAGAGCTCCAGCTCATGCGCGTTaGTGTTCATCCTGTATATGTCTTCGTTGGCACCGA +
Preference number: 6 (lower is better)
Translates to: GTTFCRAPAHAR*CSSCICLRWHR
Trigger: TCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATGAGCTGGAGCTCTGCAGAAGGTTGTACC
53% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CCA 72 bp GAAGCGGCCTCAGCTTCCTTAAGGATGCCTTCCAGCTaGGCAAGTTCTTCTGACATGTTGATGACCTCTGCT +
Preference number: 6 (lower is better)
Translates to: EAASASLRMPSS*ASSSDMLMTSA
Trigger: AGCAGAGGTCATCAACATGTCAGAAGAACTTGCCCAGCTGGAAGGCATCCTTAAGGAAGCTGAGGCCGCTTC
53% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CAA 72 bp GTATCCAGATGTTCCTGCAGCTCCAAGACGCCAAACTaGAGTGTTTCCAGCAAGCCACACGCCATCAGCGTT +
Preference number: 6 (lower is better)
Translates to: VSRCSCSSKTPN*SVSSKPHAISV
Trigger: AACGCTGATGGCGTGTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGAGCTGCAGGAACATCTGGATAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CAA 90 bp AGCTGCTATTATGGCAGACAGAAAGGGGGTCGGGAGAGGCGAGGTTaGCACTTCTGGAAAGCCGTCTTGTTCATCTTCCTCTTGACTGGA +
Preference number: 6 (lower is better)
Translates to: SCYYGRQKGGRERRG*HFWKAVLFIFLLTG
Trigger: TCCAGTCAAGAGGAAGATGAACAAGACGGCTTTCCAGAAGTGCAAACCTCGCCTCTCCCGACCCCCTTTCTGTCTGCCATAATAGCAGCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS TCA 72 bp AAGACGGAAACCACGTGCTTCAGGAACGTGGCGAGCTaGTCAGCACTCTTGATGCTAGGGTTCTTGGAAGAA +
Preference number: 6 (lower is better)
Translates to: KTETTCFRNVAS*SALLMLGFLEE
Trigger: TTCTTCCAAGAACCCTAGCATCAAGAGTGCTGATCAGCTCGCCACGTTCCTGAAGCACGTGGTTTCCGTCTT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS TCA 72 bp CCTCACACCGTTCATCCAGCTCTTTCAAAGCCAAGGTaGCATCCTCTTCACAGATGGACTCGGGGTAGCTTT +
Preference number: 6 (lower is better)
Translates to: PHTVHPALSKPR*HPLHRWTRGSF
Trigger: AAAGCTACCCCGAGTCCATCTGTGAAGAGGATGTCACCTTGGCTTTGAAAGAGCTGGATGAACGGTGTGAGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS TCA 72 bp TATCCAGATGTTCCTGCAGCTCCAAGACGCCAAACTTaGGTGTTTCCAGCAAGCCACACGCCATCAGCGTTT +
Preference number: 6 (lower is better)
Translates to: YPDVPAAPRRQT*VFPASHTPSAF
Trigger: AAACGCTGATGGCGTGTGGCTTGCTGGAAACACTCAAGTTTGGCGTCTTGGAGCTGCAGGAACATCTGGATA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS GCA 72 bp ATCTCCATGCTCTCAGAGCGCATCATTGGAACTATGTaGTTAAACAGGGAAGAAGGGGACGGGATGCCAACG +
Preference number: 6 (lower is better)
Translates to: ISMLSERIIGTM*LNREEGDGMPT
Trigger: CGTTGGCATCCCGTCCCCTTCTTCCCTGTTTAAGCACATAGTTCCAATGATGCGCTCTGAGAGCATGGAGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp GTGCAAAATAATTTTCAGGTTCTTTGGCCAGCCGTCTaGAAGGGTGGTCCACACATTCTCCACCTCCGACCA +
Preference number: 6 (lower is better)
Translates to: VQNNFQVLWPAV*KGGPHILHLRP
Trigger: TGGTCGGAGGTGGAGAATGTGTGGACCACCCTTGCAGACGGCTGGCCAAAGAACCTGAAAATTATTTTGCAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS GCA 72 bp TTATGTCCAGTGTGTTACTCCGCCGCCGGTCACCTCTaGGGTCACCAACTAGACTTAACCTCAAAGAGTTAC +
Preference number: 6 (lower is better)
Translates to: LCPVCYSAAGHL*GHQLDLTSKSY
Trigger: GTAACTCTTTGAGGTTAAGTCTAGTTGGTGACCGCAGAGGTGACCGGCGGCGGAGTAACACACTGGACATAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp TCCTGTATATGTCTTCGTTGGCACCGAATGTCCTCTTaGAGTTGTCTAGCCACTGCTCGGCTGCTTCTCTCT +
Preference number: 6 (lower is better)
Translates to: SCICLRWHRMSS*SCLATARLLLS
Trigger: AGAGAGAAGCAGCCGAGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGA
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CCA 72 bp CGGCAACTTCTTCTTCTTGAATTATGTCCTCGGTGGTaGAGATCAAGCTGGTCTGTTGGTCCCCGACTTCCA +
Preference number: 6 (lower is better)
Translates to: RQLLLLELCPRW*RSSWSVGPRLP
Trigger: TGGAAGTCGGGGACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCCG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp CGACGGCAACTTCTTCTTCTTGAATTATGTCCTCGGTaGTGGAGATCAAGCTGGTCTGTTGGTCCCCGACTT +
Preference number: 6 (lower is better)
Translates to: RRQLLLLELCPR*WRSSWSVGPRL
Trigger: AAGTCGGGGACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCCGTCG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp AGTTGTCTAGCCACTGCTCGGCTGCTTCTCTCTTGGTaGTGTAAGTATCCAGATGTTCCTGCAGCTCCAAGA +
Preference number: 6 (lower is better)
Translates to: SCLATARLLLSW*CKYPDVPAAPR
Trigger: TCTTGGAGCTGCAGGAACATCTGGATACTTACACCACCAAGAGAGAAGCAGCCGAGCAGTGGCTAGACAACT
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CAA 72 bp AGGAGGGTGGTGTGGAGGTGTGAAATGGCAGCGCTGTaGTTTCCTAAGCTGATACTAGAGGAGGTAGAACTG +
Preference number: 6 (lower is better)
Translates to: RRVVWRCEMAAL*FPKLILEEVEL
Trigger: CAGTTCTACCTCCTCTAGTATCAGCTTAGGAAACAACAGCGCTGCCATTTCACACCTCCACACCACCCTCCT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS CAA 72 bp CCATTCCTTCCCGCGGCACTGTGTTGGCCTCCATACTaGTTCCCAATGATAGGTGTCTCAGAGATGTCAAAG +
Preference number: 6 (lower is better)
Translates to: PFLPAALCWPPY*FPMIGVSEMSK
Trigger: CTTTGACATCTCTGAGACACCTATCATTGGGAACAAGTATGGAGGCCAACACAGTGCCGCGGGAAGGAATGG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp TATATGTCTTCGTTGGCACCGAATGTCCTCTTGCAGTaGTCTAGCCACTGCTCGGCTGCTTCTCTCTTGGTG +
Preference number: 6 (lower is better)
Translates to: YMSSLAPNVLLQ*SSHCSAASLLV
Trigger: CACCAAGAGAGAAGCAGCCGAGCAGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATA
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CAA 90 bp ACTGTGCGGAGAGACTCTCTGATCTCCAGGTTAAGTTCCATCAGTTaGCAGTTAGCTTCTGACATGTCCAGGTTTGAGCTGATGACCGCG +
Preference number: 6 (lower is better)
Translates to: TVRRDSLISRLSSIS*QLASDMSRFELMTA
Trigger: CGCGGTCATCAGCTCAAACCTGGACATGTCAGAAGCTAACTGCAAACTGATGGAACTTAACCTGGAGATCAGAGAGTCTCTCCGCACAGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS CAA 90 bp GCTCCAAGTGTATTCCTTCTTGAGGTAATGAACTCCATGAGGGTTTaGACTTTTCCATCCTGCTCCACTGAGAGGTCCACCTCGCCGAGN +
Preference number: 6 (lower is better)
Translates to: APSVFLLEVMNSMRV*TFPSCSTERSTSPX
Trigger: NCTCGGCGAGGTGGACCTCTCAGTGGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTTCATTACCTCAAGAAGGAATACACTTGGAGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000202697.4
CDS TCA 72 bp TTGGCCTTGGGTCACATGTGCAAATATCCAAATGTGTaGGGGGCTGATCACATCAAACTGGTGGCTGATGGG +
Preference number: 6 (lower is better)
Translates to: LALGHMCKYPNV*GADHIKLVADG
Trigger: CCCATCAGCCACCAGTTTGATGTGATCAGCCCCTCACACATTTGGATATTTGCACATGTGACCCAAGGCCAA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp GGTAACTTCCCCATTCCACCTTCACGCTGTGGTCAATaGTCAGATCTGTCAGCAGGATCACGGCTATGTTAC +
Preference number: 6 (lower is better)
Translates to: GNFPIPPSRCGQ*SDLSAGSRLCY
Trigger: GTAACATAGCCGTGATCCTGCTGACAGATCTGATCATTGACCACAGCGTGAAGGTGGAATGGGGAAGTTACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp GGGTGTAAAATCGTTAATGCCTGTGAACGTGTAATCTaGGTGTGCCGTCTGCTTGACTGTCAACACCCTGGG +
Preference number: 6 (lower is better)
Translates to: GCKIVNACERVI*VCRLLDCQHPG
Trigger: CCCAGGGTGTTGACAGTCAAGCAGACGGCACACTCAGATTACACGTTCACAGGCATTAACGATTTTACACCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENSMUST00000202381.4
CDS GCA 72 bp TCCGTACCAGCTGTACTCGTAAAATGTCTCGACGCCTaGGCCGTTTCATATTCTCTGGCCTTCTTTCAAGTG +
Preference number: 6 (lower is better)
Translates to: SVPAVLVKCLDA*AVSYSLAFFQV
Trigger: CACTTGAAAGAAGGCCAGAGAATATGAAACGGCGCAGGCGTCGAGACATTTTACGAGTACAGCTGGTACGGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS GCA 72 bp TCCAAGAAGTCGAAGTCCTTGAAGACGCCAAACTGCTaGTCACTGCTGTTGTCTTCGACGGCAACTTCTTCT +
Preference number: 6 (lower is better)
Translates to: SKKSKSLKTPNC*SLLLSSTATSS
Trigger: AGAAGAAGTTGCCGTCGAAGACAACAGCAGTGAGCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCTTGGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS GCA 72 bp ACATCCAAGAAGTCGAAGTCCTTGAAGACGCCAAACTaGTGCTCACTGCTGTTGTCTTCGACGGCAACTTCT +
Preference number: 6 (lower is better)
Translates to: TSKKSKSLKTPN*CSLLLSSTATS
Trigger: AGAAGTTGCCGTCGAAGACAACAGCAGTGAGCAGCAGTTTGGCGTCTTCAAGGACTTCGACTTCTTGGATGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CCA 72 bp ACTTTCTTAGCATTGATGGGGCTATTTATATCCACCTaGGGGGACAAGAGCTGCAGCCTGGTGTATGCGAAC +
Preference number: 6 (lower is better)
Translates to: TFLALMGLFIST*GDKSCSLVYAN
Trigger: GTTCGCATACACCAGGCTGCAGCTCTTGTCCCCCCAGGTGGATATAAATAGCCCCATCAATGCTAAGAAAGT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp CATGCGCGTTGGTGTTCATCCTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGCAGTTGTCTAGCCACT +
Preference number: 6 (lower is better)
Translates to: HARWCSSCICLR*HRMSSCSCLAT
Trigger: AGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATG
50% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CCA 72 bp GATGCGCGTTGGTGTTCATCCTGTATATGTCTTCGTTaGCACCGAATGTCCTCTTGCAGTTGTCTAGCCACT +
Preference number: 6 (lower is better)
Translates to: DARWCSSCICLR*HRMSSCSCLAT
Trigger: AGTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATC
50% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000202806.4
CDS CAA 72 bp GGTCACCAACTAGACTTAACCTCAAAGAGTTACTTCTaGTGTCCCCGTTGCATCCCAAATGGCCGCTGCTGT +
Preference number: 6 (lower is better)
Translates to: GHQLDLTSKSYF*CPRCIPNGRCC
Trigger: ACAGCAGCGGCCATTTGGGATGCAACGGGGACACAAGAAGTAACTCTTTGAGGTTAAGTCTAGTTGGTGACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp CTCTCTGACTTATCCAGAGGCAAGTGGGTGAGCAGTTaGCTCAGAAGCCTGAGAGCCAGGAGGTATTCATAT +
Preference number: 6 (lower is better)
Translates to: LSDLSRGKWVSS*LRSLRARRYSY
Trigger: ATATGAATACCTCCTGGCTCTCAGGCTTCTGAGCAAACTGCTCACCCACTTGCCTCTGGATAAGTCAGAGAG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp TCATGCGCGTTGGTGTTCATCCTGTATATGTCTTCGTaGGCACCGAATGTCCTCTTGCAGTTGTCTAGCCAC +
Preference number: 6 (lower is better)
Translates to: SCALVFILYMSS*APNVLLQLSSH
Trigger: GTGGCTAGACAACTGCAAGAGGACATTCGGTGCCAACGAAGACATATACAGGATGAACACCAACGCGCATGA
50% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
CDS CAA 90 bp TTGCATCCCAAATGGCCGCTGCTGTTAATGGGACTTGTGCTTAGATaGAGCTGGCCAGTGCTTTTCCTGTTAGCTGCATACTTGTTTCCC +
Preference number: 6 (lower is better)
Translates to: LHPKWPLLLMGLVLR*SWPVLFLLAAYLFP
Trigger: GGGAAACAAGTATGCAGCTAACAGGAAAAGCACTGGCCAGCTCAATCTAAGCACAAGTCCCATTAACAGCAGCGGCCATTTGGGATGCAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 90 bp GAGCCAGGAGGTATTCATATTCATAGTCGGATTCTAACAGAGATGTaGCTATCCAAAAGATGGTGGCCATCAGGTTGCTCGGCTCCGTCG +
Preference number: 6 (lower is better)
Translates to: EPGGIHIHSRILTEM*LSKRWWPSGCSAPS
Trigger: CGACGGAGCCGAGCAACCTGATGGCCACCATCTTTTGGATAGCAACATCTCTGTTAGAATCCGACTATGAATATGAATACCTCCTGGCTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 90 bp AAACTGCTGCTCACTGCTGTTGTCTTCGACGGCAACTTCTTCTTCTaGAATTATGTCCTCGGTGGTGGAGATCAAGCTGGTCTGTTGGTC +
Preference number: 6 (lower is better)
Translates to: KLLLTAVVFDGNFFF*NYVLGGGDQAGLLV
Trigger: GACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCCGTCGAAGACAACAGCAGTGAGCAGCAGTTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 90 bp GGGCATTCAGAACAGGCCATCATCACTTCCAATGAGCTTTTAAACTaGGTACCAATGCGCTGTAGACTCTCACCAAGAAAGCCCACAGCC +
Preference number: 6 (lower is better)
Translates to: GHSEQAIITSNELLN*VPMRCRLSPRKPTA
Trigger: GGCTGTGGGCTTTCTTGGTGAGAGTCTACAGCGCATTGGTACCAAGTTTAAAAGCTCATTGGAAGTGATGATGGCCTGTTCTGAATGCCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202697.4
ENSMUST00000202806.4
CDS TCA 72 bp CAAGCACGCCAATCACCTCTGCATATAAATCCGCAATaGTATGCACGTTCCCCGTGTTGGTCCCTGAATATC +
Preference number: 6 (lower is better)
Translates to: QARQSPLHINPQ*YARSPCWSLNI
Trigger: GATATTCAGGGACCAACACGGGGAACGTGCATATCATTGCGGATTTATATGCAGAGGTGATTGGCGTGCTTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp TGTAAAATCGTTAATGCCTGCTGTGAACGTGTAATCTaGGTGTGCCGTCTGCTTGACTGTCAACACCCTGGG +
Preference number: 6 (lower is better)
Translates to: CKIVNACCERVI*VCRLLDCQHPG
Trigger: CCCAGGGTGTTGACAGTCAAGCAGACGGCACACTCAGATTACACGTTCACAGCAGGCATTAACGATTTTACA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS TCA 72 bp GCTGAGATGACGCTCCAAGTGTATTCCTTCTGCATTTaGCTGCTTGAAGACGGAAACCACGTGCTTCAGGAA +
Preference number: 6 (lower is better)
Translates to: AEMTLQVYSFCI*LLEDGNHVLQE
Trigger: TTCCTGAAGCACGTGGTTTCCGTCTTCAAGCAGTCAAATGCAGAAGGAATACACTTGGAGCGTCATCTCAGC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS TCA 72 bp TCACTGCTGTTGTCTTCGACGGCAACTTCTTCTTCTTaGATTATGTCCTCGGTGGTGGAGATCAAGCTGGTC +
Preference number: 6 (lower is better)
Translates to: SLLLSSTATSSS*IMSSVVEIKLV
Trigger: GACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAGAAGAAGTTGCCGTCGAAGACAACAGCAGTGA
49% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS TCA 72 bp TGGAAGCGGCGGCAGCACAGAACTTATTCACTTTGCTaGCTGGTGCTGAAGCCATTTGTTGATGTAGACATC +
Preference number: 6 (lower is better)
Translates to: WKRRQHRTYSLC*LVLKPFVDVDI
Trigger: GATGTCTACATCAACAAATGGCTTCAGCACCAGTCAGCAAAGTGAATAAGTTCTGTGCTGCCGCCGCTTCCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000176910.3
CDS TCA 72 bp CTTCTGCAGAGCTCCAGCTCTGCTAGAATTCCCATTTaGTGCGCGTTGGTGTTCATCCTGTATATGTCTTCG +
Preference number: 6 (lower is better)
Translates to: LLQSSSSARIPI*CALVFILYMSS
Trigger: CGAAGACATATACAGGATGAACACCAACGCGCATCAAATGGGAATTCTAGCAGAGCTGGAGCTCTGCAGAAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENSMUST00000202806.4
CDS GCA 72 bp ACGCCAATCACCTCTGCATATAAATCCGCAATGATATaGACGTTCCCCGTGTTGGTCCCTGAATATCCTTCC +
Preference number: 6 (lower is better)
Translates to: TPITSAYKSAMI*TFPVLVPEYPS
Trigger: GGAAGGATATTCAGGGACCAACACGGGGAACGTGCATATCATTGCGGATTTATATGCAGAGGTGATTGGCGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
CDS CCA 72 bp CTCTTGATGCTAGGGTTCTTGGAAGAAACGTCCTCATaGTTCCAAAGGGGCCCTCGTTTTCTTGAGGTAATG +
Preference number: 6 (lower is better)
Translates to: LLMLGFLEETSS*FQRGPRFLEVM
Trigger: CATTACCTCAAGAAAACGAGGGCCCCTTTGGAACCATGAGGACGTTTCTTCCAAGAACCCTAGCATCAAGAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS CCA 72 bp CTTCTTGAATTATGTCCTCGGTGGTGGAGATCAAGCTaGTCTGTTGGTCCCCGACTTCCAAATCCTCATTTG +
Preference number: 6 (lower is better)
Translates to: LLELCPRWWRSS*SVGPRLPNPHL
Trigger: CAAATGAGGATTTGGAAGTCGGGGACCAACAGACCAGCTTGATCTCCACCACCGAGGACATAATTCAAGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
ENSMUST00000202697.4
CDS CAA 72 bp TCTTCAAAGTTCTCCTTTAGGGCCTTACTGTCAGGGTaGCCATCTGTGGGAGCGACCATTGTATTGCTACTG +
Preference number: 6 (lower is better)
Translates to: SSKFSFRALLSG*PSVGATIVLLL
Trigger: CAGTAGCAATACAATGGTCGCTCCCACAGATGGCAACCCTGACAGTAAGGCCCTAAAGGAGAACTTTGAAGA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000202381.4
CDS CAA 72 bp CCTCGTTTTCTTGAGGTAATGAACTCCATGAGGGTTTaGACTTTTCCATCCTGCTCCACTGAGAGGTCCACC +
Preference number: 6 (lower is better)
Translates to: PRFLEVMNSMRV*TFPSCSTERST
Trigger: GGTGGACCTCTCAGTGGAGCAGGATGGAAAAGTCAAAACCCTCATGGAGTTCATTACCTCAAGAAAACGAGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENSMUST00000094700.11
ENSMUST00000101127.12
ENSMUST00000201277.2
ENSMUST00000202381.4
CDS CAA 72 bp AAATGGCCGCTGCTGTTAATGGGACTTGTGCTTAGATaGAGCTGGCCAGTGCTTTTCCTGTTAGCTGCATAC +
Preference number: 6 (lower is better)
Translates to: KWPLLLMGLVLR*SWPVLFLLAAY
Trigger: GTATGCAGCTAACAGGAAAAGC