RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for BICD1 (Homo sapiens)

Ensembl gene IDs: ENSG00000151746

Ensembl transcript IDs: ENST00000395758.3, ENST00000547680.2, ENST00000548411.5, ENST00000550207.1, ENST00000551086.1, ENST00000551848.1, ENST00000552160.2, ENST00000552226.1, ENST00000614004.1, ENST00000652176.1

Found 1001 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp TTGGAGAGACAGTGGAGAGGGGCGCACTGGGAGCTGGAATGTGGCTaGTCCTCAGGGAGAGCTGTGTCAGGACTGACAGTTGGGCAGTCT +
Preference number: 1 (lower is better)
Translates to: LERQWRGAHWELECG*SSGRAVSGLTVGQS
Trigger: AGACTGCCCAACTGTCAGTCCTGACACAGCTCTCCCTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR CCA 90 bp CCAGATGTTCGTCCACAGGAGATGAAGACTAGGGGTGAGGAGGCTTaGAGAGACAGTGGAGAGGGGCGCACTGGGAGCTGGAATGTGGCT +
Preference number: 1 (lower is better)
Translates to: PDVRPQEMKTRGEEA*RDSGEGRTGSWNVA
Trigger: AGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCCTCCTCACCCCTAGTCTTCATCTCCTGTGGACGAACATCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR TCA 90 bp GATGGACCACTCCATTTCTGTGCCACCCATGTCCGCTCAATAAGCTaGGTGGCTCCTGGATCTCCTTTCTCAGTGCCCTACACTGGTAAC +
Preference number: 1 (lower is better)
Translates to: DGPLHFCATHVRSIS*VAPGSPFSVPYTGN
Trigger: GTTACCAGTGTAGGGCACTGAGAAAGGAGATCCAGGAGCCACTCAGCTTATTGAGCGGACATGGGTGGCACAGAAATGGAGTGGTCCATC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 90 bp GCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGTaGGGAGTTCCCTCTCTCACCAAGGAGTGGTTACATCCAGAGGAA +
Preference number: 1 (lower is better)
Translates to: AKQNEDCLAFVKWDW*GVPSLTKEWLHPEE
Trigger: TTCCTCTGGATGTAACCACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 90 bp CAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCACTTaGTGGTTAAGGAGCCCGAGAGTGTTAGACCTTTCAGCTCAGTTA +
Preference number: 1 (lower is better)
Translates to: QRQGIRARSNCVGST*WLRSPRVLDLSAQL
Trigger: TAACTGAGCTGAAAGGTCTAACACTCTCGGGCTCCTTAACCATCAAGTGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 90 bp AACGAAAGCTCCTGCAATGTGCTTTACGACTTACCATTTGGTCTCTaGTGGACCACTCCATTTCTGTGCCACCCATGTCCGCTCAATAAG +
Preference number: 1 (lower is better)
Translates to: NESSCNVLYDLPFGL*WTTPFLCHPCPLNK
Trigger: CTTATTGAGCGGACATGGGTGGCACAGAAATGGAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAAAGCACATTGCAGGAGCTTTCGTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTaGTATGGTTGGGAACTTCATGTCGAATCGTTTTGTTTCTGTTTC +
Preference number: 1 (lower is better)
Translates to: RNSKAMQVEKSRRLG*YGWELHVESFCFCF
Trigger: GAAACAGAAACAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CCA 90 bp AATCCTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTaGACTACGAAATTGTCGCTGAAACCTGGGTTTGAGATAACAGCG +
Preference number: 1 (lower is better)
Translates to: NPEIVGPQAQTSSLL*TTKLSLKPGFEITA
Trigger: CGCTGTTATCTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAGGATT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 90 bp TTTGATTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCTaGGACTTGATGACTCTTACTAATCTCCCTCCCCCGCAGGCCAAA +
Preference number: 1 (lower is better)
Translates to: FDLYIPTHLNVVLEC*DLMTLTNLPPPQAK
Trigger: TTTGGCCTGCGGGGGAGGGAGATTAGTAAGAGTCATCAAGTCTCAGCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAATCAAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 90 bp CGTCCTGGTTGCTTTGGTAATAGCGACCACTACTTAATAGGCGTATaGCTAACGAAAGCTCCTGCAATGTGCTTTACGACTTACCATTTG +
Preference number: 1 (lower is better)
Translates to: RPGCFGNSDHYLIGV*LTKAPAMCFTTYHL
Trigger: CAAATGGTAAGTCGTAAAGCACATTGCAGGAGCTTTCGTTAGTCATACGCCTATTAAGTAGTGGTCGCTATTACCAAAGCAACCAGGACG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 90 bp CTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCTGGGTTTaGGATAACAGCGGTTTTGAGAAGTTTGATTTATACATTCCAACC +
Preference number: 1 (lower is better)
Translates to: LITFVDYEIVAETWV*DNSGFEKFDLYIPT
Trigger: GGTTGGAATGTATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAG
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR GCA 90 bp GGTCATATGGACAAAAGTTTCCCTAAGAGAACATATTCATATCCTTaGCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGT +
Preference number: 1 (lower is better)
Translates to: GHMDKSFPKRTYSYP*PVKEKLINSTISKG
Trigger: ACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATATGAATATGTTCTCTTAGGGAAACTTTTGTCCATATGACC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR TCA 90 bp GTTATTTTCTTAGCACTGGAGTGCCTTTTCCAACCATTGAGTGCATaGTCAGATTACACAAATACAAGCACATATCATGTGTTCTCCCAT +
Preference number: 1 (lower is better)
Translates to: VIFLALECLFQPLSA*SDYTNTSTYHVFSH
Trigger: ATGGGAGAACACATGATATGTGCTTGTATTTGTGTAATCTGATCATGCACTCAATGGTTGGAAAAGGCACTCCAGTGCTAAGAAAATAAC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 90 bp TCTGGTTATTTTCTTAGCACTGGAGTGCCTTTTCCAACCATTGAGTaGATGATCAGATTACACAAATACAAGCACATATCATGTGTTCTC +
Preference number: 1 (lower is better)
Translates to: SGYFLSTGVPFPTIE*MIRLHKYKHISCVL
Trigger: GAGAACACATGATATGTGCTTGTATTTGTGTAATCTGATCATGCACTCAATGGTTGGAAAAGGCACTCCAGTGCTAAGAAAATAACCAGA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 90 bp CTGGAAAACAACTTCTTATCCTTTAATAACAAACTAAGGTATAATTaGTTCTGTGAAGTCTTTTCCGCTCCTCTAGGAAACCTTAGTTGC +
Preference number: 1 (lower is better)
Translates to: LENNFLSFNNKLRYN*FCEVFSAPLGNLSC
Trigger: GCAACTAAGGTTTCCTAGAGGAGCGGAAAAGACTTCACAGAAGCAATTATACCTTAGTTTGTTATTAAAGGATAAGAAGTTGTTTTCCAG
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000547680.2
3UTR GCA 90 bp TCACAGGATTATGAGCTCCCAGAACTGAAATGCATTCTCCTATCTTaGCACTTAATACTTACTAGACCACCAATGATATTCAATTTTTAC +
Preference number: 1 (lower is better)
Translates to: SQDYELPELKCILLS*HLILTRPPMIFNFY
Trigger: GTAAAAATTGAATATCATTGGTGGTCTAGTAAGTATTAAGTGGCAAGATAGGAGAATGCATTTCAGTTCTGGGAGCTCATAATCCTGTGA
37% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 90 bp CTTAAAATAAAAGAATCACAGGATTATGAGCTCCCAGAACTGAAATaGATTCTCCTATCTTGCCACTTAATACTTACTAGACCACCAATG +
Preference number: 1 (lower is better)
Translates to: LKIKESQDYELPELK*ILLSCHLILTRPPM
Trigger: CATTGGTGGTCTAGTAAGTATTAAGTGGCAAGATAGGAGAATGCATTTCAGTTCTGGGAGCTCATAATCCTGTGATTCTTTTATTTTAAG
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 90 bp ATGACAAACATATTGGAATCAACTTCCCTAGCTGAATTTGGAGTGTaGGGAAAGATGATACTGCAATATACGTATTTTACATGTCTTAGG +
Preference number: 1 (lower is better)
Translates to: MTNILESTSLAEFGV*GKMILQYTYFTCLR
Trigger: CCTAAGACATGTAAAATACGTATATTGCAGTATCATCTTTCCTCACACTCCAAATTCAGCTAGGGAAGTTGATTCCAATATGTTTGTCAT
36% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR TCA 90 bp GGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCGTCGTCTTAGAGTGCTaGGACTTGATGACTCTTACT +
Preference number: 2 (lower is better)
Translates to: GHGPASLRGEIKAVGSPSVVLEC*DLMTLT
Trigger: AGTAAGAGTCATCAAGTCTCAGCACTCTAAGACGAC...GCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR TCA 90 bp TCTAGTCAGGGTGACCTCATAAGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGTCAAATGGGATTGGTaGGGAGTTCCCTCTCTCACC +
Preference number: 2 (lower is better)
Translates to: SSQGDLIRLGHGPASLRGVKWDW*GVPSLT
Trigger: GGTGAGAGAGGGAACTCCTCACCAATCCCATTTGAC...ACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATGAGGTCACCCTGACTAGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGGGGCGCACTGGGAGCTaGAATGTGGCTGCTCCTCAG +
Preference number: 2 (lower is better)
Translates to: CTSNNREENTRWILGSILGRTGS*NVAAPQ
Trigger: CTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCC...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR-3UTR CCA 90 bp AGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCATCTCTCACCAAGGAGTaGTTACATCCAGAGGAAAGC +
Preference number: 2 (lower is better)
Translates to: RLGHGPASLRGEIKAVGSSLTKE*LHPEES
Trigger: GCTTTCCTCTGGATGTAACCACTCCTTGGTGAGAGA...TGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR TCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTTCGTCCACAGGAGATaGAGACTAGGGGTGAGGAGG +
Preference number: 2 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGFVHRR*RLGVRR
Trigger: CCTCCTCACCCCTAGTCTTCATCTCCTGTGGACGAA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000548411.5
3UTR-3UTR CCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAGGCTTGGAGAGACAGTaGAGAGGGGCGCACTGGGAG +
Preference number: 2 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKGLERQ*RGAHWE
Trigger: CTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCC...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR-3UTR TCA 90 bp CCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGACACAGTCTAAATCCTaGAATTGTGGGTCCTCAGGC +
Preference number: 2 (lower is better)
Translates to: PSLCQMGLVRSSLSHQGVTQSKS*NCGSSG
Trigger: GCCTGAGGACCCACAATTTCAGGATTTAGACTGTGT...CACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTACCACTCCATTTCTGTaGCACCCATGTCCGCTCAAT +
Preference number: 2 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGTTPFL*HPCPLN
Trigger: ATTGAGCGGACATGGGTGGCACAGAAATGGAGTGGT...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCTGGAGAGGGGCGCACTaGGAGCTGGAATGTGGCTGC +
Preference number: 2 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFWRGAH*ELECGC
Trigger: GCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCA...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR CAA 90 bp CCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCAAAGTaGTTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAG +
Preference number: 2 (lower is better)
Translates to: PRSEVKSRQWDHPAK*FFFCSPMTRMTKAK
Trigger: CTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR TCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGGCCCTTCAGAAGAAATaGTTCTGTGGAGGTGGGATC +
Preference number: 2 (lower is better)
Translates to: CTSNNREENTRWILGSILALQKK*FCGGGI
Trigger: GATCCCACCTCCACAGAATCATTTCTTCTGAAGGGC...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000395758.3
3UTR-3UTR GCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAGAGCTGGAATGTGGCTaGTCCTCAGGGAGAGCTGTG +
Preference number: 2 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQELECG*SSGRAV
Trigger: CACAGCTCTCCCTGAGGAGCAGCCACATTCCAGCTC...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000548411.5
3UTR-3UTR CCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCGGGCGCACTGGGAGCTaGAATGTGGCTGCTCCTCAG +
Preference number: 2 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLGRTGS*NVAAPQ
Trigger: CTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCC...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR-3UTR CCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGG +
Preference number: 2 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKTPAGS*AVSCVW
Trigger: CCACACACAGGATACTGCCCAAGATCCAGCGGGTGT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR CAA 90 bp CCTACTTCCTACCTACCATATCAATGTATTTGTGGCAGCCTGAGTTaGAACCCACCACAGTTCCTTACTGGAAATCCATCAGCTTCCCCC +
Preference number: 2 (lower is better)
Translates to: PTSYLPYQCICGSLS*NPPQFLTGNPSASP
Trigger: GGGGGAAGCTGATGGATTTCCAGTAAGGAACTGTGGTGGGTTCAAACTCAGGCTGCCACAAATACATTGATATGGTAGGTAGGAAGTAGG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTCTTAGGTCTCTCTTATaGTATCGAGGTAAAGCCAGC +
Preference number: 2 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGLRSLL*YRGKAS
Trigger: GCTGGCTTTACCTCGATAGCATAAGAGAGACCTAAG...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGACTGAGCCGGTGCCCTTaGATGAATTCACTCATGGAA +
Preference number: 2 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRLSRCP*MNSLME
Trigger: TTCCATGAGTGAATTCATCCAAGGGCACCGGCTCAG...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000395758.3
3UTR-3UTR CCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAGGCTTGGAGAGACAGTaGAGAGGGGCGCACTGGGAG +
Preference number: 2 (lower is better)
Translates to: DELNFRHNSSEGIITDNGGLERQ*RGAHWE
Trigger: CTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCC...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000548411.5
3UTR CAA 90 bp GTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATaGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGT +
Preference number: 2 (lower is better)
Translates to: VGPQAQTSSLLWTTK*SLKPGFEITAVLRS
Trigger: ACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR TCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTTCGTCCACAGGAGATaGAGACTAGGGGTGAGGAGG +
Preference number: 2 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSFVHRR*RLGVRR
Trigger: CCTCCTCACCCCTAGTCTTCATCTCCTGTGGACGAA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR-3UTR TCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTGCTGAATTTGGAGTGTaGGGAAAGATGATACTGCAA +
Preference number: 2 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGAEFGV*GKMILQ
Trigger: TTGCAGTATCATCTTTCCTCACACTCCAAATTCAGC...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR TCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTGTGTGGGCAGCACTTaGTGGTTAAGGAGCCCGAGA +
Preference number: 2 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYCVGST*WLRSPR
Trigger: TCTCGGGCTCCTTAACCATCAAGTGCTGCCCACACA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATGGAGAGGGGCGCACTaGGAGCTGGAATGTGGCTGC +
Preference number: 2 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQWRGAH*ELECGC
Trigger: GCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000548411.5
3UTR-3UTR CCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGAAGAAAACACCCGCTaGATCTTGGGCAGTATCCTG +
Preference number: 2 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDEENTR*ILGSIL
Trigger: CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTC...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR TCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCATTCCCTTCAAGTTATTaGGCCTTCTTTAACGTTATC +
Preference number: 2 (lower is better)
Translates to: RLPDKDKESGLGAIVWAAFPSSY*AFFNVI
Trigger: GATAACGTTAAAGAAGGCTCAATAACTTGAAGGGAA...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR GCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATAGGCCAAACAGCCATTaGCTCCCAAATTCCAGCTTA +
Preference number: 2 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNRPNSH*LPNSSL
Trigger: TAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCT...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGG +
Preference number: 2 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLTPAGS*AVSCVW
Trigger: CCACACACAGGATACTGCCCAAGATCCAGCGGGTGT...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGG +
Preference number: 2 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTTPAGS*AVSCVW
Trigger: CCACACACAGGATACTGCCCAAGATCCAGCGGGTGT...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGAAGAAAACACCCGCTaGATCTTGGGCAGTATCCTG +
Preference number: 2 (lower is better)
Translates to: KSTVSLILVLGRYNASEMEENTR*ILGSIL
Trigger: CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR GCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTCCTTGCTGAGCCGGTaGCCTTGGATGAATTCACTC +
Preference number: 2 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFSLLSR*PWMNSL
Trigger: GAGTGAATTCATCCAAGGGCACCGGCTCAGCAAGGA...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000395758.3
3UTR-3UTR GCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAACAGTTGGGCAGTCTTaGCTCCCGGCTAGTTGTGAG +
Preference number: 2 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVTVGQS*LPASCE
Trigger: CTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000395758.3
3UTR-3UTR GCA 90 bp ATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGAGGCCAAACAGCCATTaGCTCCCAAATTCCAGCTTA +
Preference number: 2 (lower is better)
Translates to: MTKAKQNEDCLAFVKWDWRPNSH*LPNSSL
Trigger: TAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCT...CCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR GCA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGACAAAACGTCCTGGTTaGTTTGGTAATAGCGACCAC +
Preference number: 2 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLTKRPG*FGNSDH
Trigger: GTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGT...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp TCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCAGGCAATTTTTCTCTTaGGGGAGGAAACAATGGACT +
Preference number: 2 (lower is better)
Translates to: SSGTNLITFVDYEIVAETRQFFS*GRKQWT
Trigger: AGTCCATTGTTTCCTCCCCCAAGAGAAAAATTGCCT...GGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CCA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGTTACGACTTACCATTTaGTCTCTGATGGACCACTCC +
Preference number: 2 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLLRLTI*SLMDHS
Trigger: GGAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAA...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CAA 90 bp TTGATGACTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATaGCCTCCCAAATTCCAGCTTATATATTCATTTCTTAGGCAATTT +
Preference number: 2 (lower is better)
Translates to: LMTLTNLPPPQAKQP*PPKFQLIYSFLRQF
Trigger: AAATTGCCTAAGAAATGAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAGTCATCAA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR CAA 90 bp CTAAATCCTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTaGTGGACTACGAAATTGTCGCTGAAACCTGGGTTTGAGATAACA +
Preference number: 2 (lower is better)
Translates to: LNPEIVGPQAQTSSL*WTTKLSLKPGFEIT
Trigger: TGTTATCTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAGGATTTAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR TCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAGTAAAGCCAGCCATCTaGGACACGTTTTCTGTTTCT +
Preference number: 2 (lower is better)
Translates to: TVSLILVLGRYNASEMKTVKPAI*DTFSVS
Trigger: AGAAACAGAAAACGTGTCTCAGATGGCTGGCTTTAC...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR TCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGTAAAGCCAGCCATCTaGGACACGTTTTCTGTTTCT +
Preference number: 2 (lower is better)
Translates to: KSTVSLILVLGRYNASEMVKPAI*DTFSVS
Trigger: AGAAACAGAAAACGTGTCTCAGATGGCTGGCTTTAC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR GCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAGCCGACTGGCAATACTaGCCCGTCATCACACACAGA +
Preference number: 2 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQADWQY*PVITHR
Trigger: TCTGTGTGTGATGACGGGGCAGTATTGCCAGTCGGC...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR TCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATGCCCTTCAGAAGAAATaGTTCTGTGGAGGTGGGATC +
Preference number: 2 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYALQKK*FCGGGI
Trigger: GATCCCACCTCCACAGAATCATTTCTTCTGAAGGGC...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR-3UTR CCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTATGATTCTGTGGAGGTaGGATCAGGGGGAACTCTTA +
Preference number: 2 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLMILWR*DQGELL
Trigger: TAAGAGTTCCCCCTGATCCCACCTCCACAGAATCAT...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000395758.3
3UTR-3UTR CCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGAATGATTCTGTGGAGGTaGGATCAGGGGGAACTCTTA +
Preference number: 2 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGMILWR*DQGELL
Trigger: TAAGAGTTCCCCCTGATCCCACCTCCACAGAATCAT...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR CAA 90 bp CAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTaGTTTCTGTTTCTGTACTTTAACCTGAACCCTTATTTTGGTGAA +
Preference number: 2 (lower is better)
Translates to: QKVRLLWLGTSCRIV*FLFLYFNLNPYFGE
Trigger: TTCACCAAAATAAGGGTTCAGGTTAAAGTACAGAAACAGAAACAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTG
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR TCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACATGTTTGTAGGCACCTaGGTGTTTGTCAAAAGTAGA +
Preference number: 2 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYMFVGT*VFVKSR
Trigger: TCTACTTTTGACAAACACTCAGGTGCCTACAAACAT...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACACTCTTTACTCCACGTTaGATAATAAATGACACTGTG +
Preference number: 2 (lower is better)
Translates to: TVSLILVLGRYNASEMKTLFTPR*IINDTV
Trigger: CACAGTGTCATTTATTATGCAACGTGGAGTAAAGAG...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGATACAAGTGGTTTCTCTaGGCAATATTCCCATGCCAA +
Preference number: 2 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGYKWFL*AIFPCQ
Trigger: TTGGCATGGGAATATTGCCCAGAGAAACCACTTGTA...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR-3UTR CCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATTGGGGGAGGAAACAATaGACTCTTTCAATCTTCTCT +
Preference number: 2 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYWGRKQ*TLSIFS
Trigger: AGAGAAGATTGAAAGAGTCCATTGTTTCCTCCCCCA...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000551848.1
3UTR-3UTR CCA 90 bp TGTATGTTCTTAAGAGTGACTGATAGGAAATCAAAGCACGTTCATTGTTTTCTCGTGAAATCAAGGCAGTaGGATCACCCAGCAAAGTTG +
Preference number: 2 (lower is better)
Translates to: CMFLRVTDRKSKHVHCFLVKSRQ*DHPAKL
Trigger: CAACTTTGCTGGGTGATCCCACTGCCTTGATTTCAC...GAGAAAACAATGAACGTGCTTTGATTTCCTATCAGTCACTCTTAAGAACATACA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
3UTR-3UTR CCA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCTACTTCCTCCTCCTCTaGAAAACAACTTCTTATCCT +
Preference number: 2 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSYFLLL*KTTSYP
Trigger: AGGATAAGAAGTTGTTTTCCAGAGGAGGAGGAAGTA...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
3UTR CAA 90 bp CCATATTCAGTTGGTAACATAAACCGAGATATAAGAATCGATATATaGGCTTCTGGTTATTTTCTTAGCACTGGAGTGCCTTTTCCAACC +
Preference number: 2 (lower is better)
Translates to: PYSVGNINRDIRIDI*ASGYFLSTGVPFPT
Trigger: GGTTGGAAAAGGCACTCCAGTGCTAAGAAAATAACCAGAAGCCAATATATCGATTCTTATATCTCGGTTTATGTTACCAACTGAATATGG
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR GCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGATCAAGAAAAGGACTGTaGGTATTCCATCCCATTTTA +
Preference number: 2 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGSRKGL*VFHPIL
Trigger: TAAAATGGGATGGAATACGCACAGTCCTTTTCTTGA...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR-3UTR GCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGATGGGCAATATTCCCATaGCAAATGAAAAAGCACAAA +
Preference number: 2 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGWAIFP*QMKKHK
Trigger: TTTGTGCTTTTTCATTTGGCATGGGAATATTGCCCA...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR-3UTR CCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAACATTCTTAGGTTATTaGACCAATGTTTCATGCTTG +
Preference number: 2 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQTFLGY*TNVSCL
Trigger: CAAGCATGAAACATTGGTCCAATAACCTAAGAATGT...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
34% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CCA 72 bp GCTTGGAGAGACAGTGGAGAGGGGCGCACTGGGAGCTaGAATGTGGCTGCTCCTCAGGGAGAGCTGTGTCAG +
Preference number: 3 (lower is better)
Translates to: AWRDSGEGRTGS*NVAAPQGELCQ
Trigger: CTGACACAGCTCTCCCTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR CCA 72 bp CGTCCACAGGAGATGAAGACTAGGGGTGAGGAGGCTTaGAGAGACAGTGGAGAGGGGCGCACTGGGAGCTGG +
Preference number: 3 (lower is better)
Translates to: RPQEMKTRGEEA*RDSGEGRTGSW
Trigger: CCAGCTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCCTCCTCACCCCTAGTCTTCATCTCCTGTGGACG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000548411.5
3UTR GCA 72 bp GGGAGAGCTGTGTCAGGACTGACAGTTGGGCAGTCTTaGCTCCCGGCTAGTTGTGAGCACTGTGGCGGTACG +
Preference number: 3 (lower is better)
Translates to: GRAVSGLTVGQS*LPASCEHCGGT
Trigger: CGTACCGCCACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACACAGCTCTCCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
3UTR TCA 72 bp CATAAGACTTGGACATGGCCCAGCCTCGCTCCGAGGTaGAATCAAGGCAGTGGGATCACCCAGCAAAGTTGT +
Preference number: 3 (lower is better)
Translates to: HKTWTWPSLAPR*NQGSGITQQSC
Trigger: ACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 72 bp CTCCATTTCTGTGCCACCCATGTCCGCTCAATAAGCTaGGTGGCTCCTGGATCTCCTTTCTCAGTGCCCTAC +
Preference number: 3 (lower is better)
Translates to: LHFCATHVRSIS*VAPGSPFSVPY
Trigger: GTAGGGCACTGAGAAAGGAGATCCAGGAGCCACTCAGCTTATTGAGCGGACATGGGTGGCACAGAAATGGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp TCTAGTCAGGGTGACCTCATAAGACTTGGACATGGCCCAGCCTCGCTCCGAGGTCAAACCTCATCACTTTaGTGGACTACGAAATTGTCG +
Preference number: 3 (lower is better)
Translates to: SSQGDLIRLGHGPASLRGQTSSL*WTTKLS
Trigger: CGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTG...ACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATGAGGTCACCCTGACTAGA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CAA 90 bp CAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCAAAGTTGTTTTTGTGGACTACGAAATaGTCGCTGAAACCTGGGTTT +
Preference number: 3 (lower is better)
Translates to: QPRSEVKSRQWDHPAKLFLWTTK*SLKPGF
Trigger: AAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAA...AAACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 72 bp TCCTGCAATGTGCTTTACGACTTACCATTTGGTCTCTaGTGGACCACTCCATTTCTGTGCCACCCATGTCCG +
Preference number: 3 (lower is better)
Translates to: SCNVLYDLPFGL*WTTPFLCHPCP
Trigger: CGGACATGGGTGGCACAGAAATGGAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAAAGCACATTGCAGGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CCA 72 bp CGAAAGCTCCTGCAATGTGCTTTACGACTTACCATTTaGTCTCTGATGGACCACTCCATTTCTGTGCCACCC +
Preference number: 3 (lower is better)
Translates to: RKLLQCALRLTI*SLMDHSISVPP
Trigger: GGGTGGCACAGAAATGGAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAAAGCACATTGCAGGAGCTTTCG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAACACCCGCTGGATCTaGGGCAGTATCCTGTGTGTG +
Preference number: 3 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKNTRWI*GSILCV
Trigger: CACACACAGGATACTGCCCAAGATCCAGCGGGTGTT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp TCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCCAGGCCAAACAGCCATaGCCTCCCAAATTCCAGCTT +
Preference number: 3 (lower is better)
Translates to: SSGTNLITFVDYEIVAETQAKQP*PPKFQL
Trigger: AAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTG...GGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR CCA 72 bp CATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGGCTACAAAACTTCCAC +
Preference number: 3 (lower is better)
Translates to: HLTTEKKTPAGS*AVSCVWLQNFH
Trigger: GTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACATTGTGTGGGCAGCACTaGATGGTTAAGGAGCCCGAG +
Preference number: 3 (lower is better)
Translates to: TVSLILVLGRYNASEMKTLCGQH*MVKEPE
Trigger: CTCGGGCTCCTTAACCATCAAGTGCTGCCCACACAA...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CCA 72 bp ATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTaGACTACGAAATTGTCGCTGAAACCTGGGTTTGAG +
Preference number: 3 (lower is better)
Translates to: IVGPQAQTSSLL*TTKLSLKPGFE
Trigger: CTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CAA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACACTACCAATTCTCAGGTaGGAGGTAAGGGAGAGGCAT +
Preference number: 3 (lower is better)
Translates to: YPCPVKEKLINSTISKGTLPILR*EVRERH
Trigger: ATGCCTCTCCCTTACCTCCAACCTGAGAATTGGTAG...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR-3UTR CAA 90 bp ACAAGAATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGCAGGCCAAACAGCCATaGCCTCCCAAATTCCAGCTT +
Preference number: 3 (lower is better)
Translates to: TRMTKAKQNEDCLAFVKWQAKQP*PPKFQL
Trigger: AAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTG...CCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCATTCTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 72 bp AATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGTaGGGAGTTCCCTCTCTCACCAAGGAGTGGTTACAT +
Preference number: 3 (lower is better)
Translates to: NEDCLAFVKWDW*GVPSLTKEWLH
Trigger: ATGTAACCACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAATCTTCATT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR GCA 72 bp AAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTaGTATGGTTGGGAACTTCATGTCGAATCGTTTTGT +
Preference number: 3 (lower is better)
Translates to: KAMQVEKSRRLG*YGWELHVESFC
Trigger: ACAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 72 bp AAAGAATGCAAATACAACATTGCCGACTGGCAATACTaGCCCGTCATCACACACAGACAATACTTCCTGCTG +
Preference number: 3 (lower is better)
Translates to: KECKYNIADWQY*PVITHRQYFLL
Trigger: CAGCAGGAAGTATTGTCTGTGTGTGATGACGGGGCAGTATTGCCAGTCGGCAATGTTGTATTTGCATTCTTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAACGTCCTGGTTGCTTaGGTAATAGCGACCACTACT +
Preference number: 3 (lower is better)
Translates to: KSTVSLILVLGRYNASEMNVLVA*VIATTT
Trigger: AGTAGTGGTCGCTATTACCAAAGCAACCAGGACGTT...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGTTAGGCTGCTATGGTaGGGAACTTCATGTCGAATC +
Preference number: 3 (lower is better)
Translates to: KSTVSLILVLGRYNASEMVRLLW*GTSCRI
Trigger: GATTCGACATGAAGTTCCCAACCATAGCAGCCTAAC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 72 bp TTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTaGCTCCCAAATTCCAGCTTATATATTCATTTCTTA +
Preference number: 3 (lower is better)
Translates to: LLISLPRRPNSH*LPNSSLYIHFL
Trigger: TAAGAAATGAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR CCA 72 bp AATTGTACATCTAACAACCGAGAAGAAAACACCCGCTaGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAA +
Preference number: 3 (lower is better)
Translates to: NCTSNNREENTR*ILGSILCVATK
Trigger: TTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR CCA 72 bp TTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTaGGACGGCTCTGATCACAAAGGGAAGGTGAAAATT +
Preference number: 3 (lower is better)
Translates to: LINSVGRKPLKS*DGSDHKGKVKI
Trigger: AATTTTCACCTTCCCTTTGTGATCAGAGCCGTCCCAGGACTTCAGGGGCTTCCTACCTACAGAATTTATTAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR CCA 72 bp CATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATaGTTGGGAACTTCATGTCGAATCGTTTTGTTTCTG +
Preference number: 3 (lower is better)
Translates to: HAGRKEQKVRLL*LGTSCRIVLFL
Trigger: CAGAAACAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp TCACTCCAAAGCCTCTCTACCTACTGTTCTGTCTGGAATTACTTCCTCCTCCTCACAGCATGTGTAACGTaGAACTGTAATTGTGTTTCT +
Preference number: 3 (lower is better)
Translates to: SLQSLSTYCSVWNYFLLLTACVT*NCNCVS
Trigger: AGAAACACAATTACAGTTCAACGTTACACATGCTGT...GAGGAGGAGGAAGTAATTCCAGACAGAACAGTAGGTAGAGAGGCTTTGGAGTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
3UTR TCA 72 bp TGCTTTGGTAATAGCGACCACTACTTAATAGGCGTATaGCTAACGAAAGCTCCTGCAATGTGCTTTACGACT +
Preference number: 3 (lower is better)
Translates to: CFGNSDHYLIGV*LTKAPAMCFTT
Trigger: AGTCGTAAAGCACATTGCAGGAGCTTTCGTTAGTCATACGCCTATTAAGTAGTGGTCGCTATTACCAAAGCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATGGAGTTCATTCTTTTaGGTTCTCACTAGTTCTGCC +
Preference number: 3 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQWSSFF*VLTSSA
Trigger: GGCAGAACTAGTGAGAACCAAAAAGAATGAACTCCA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 72 bp GAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTaGTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCA +
Preference number: 3 (lower is better)
Translates to: EKPQNVLSHQGL*FVFFSTFSRLP
Trigger: TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
3UTR-3UTR CAA 90 bp TTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAGCAGAATGAAGATTACATTCCAACCCACTaGAATGTCGTCTTAGAGTGC +
Preference number: 3 (lower is better)
Translates to: FFFCSPMTRMTKAKQNEDYIPTH*NVVLEC
Trigger: GCACTCTAAGACGACATTCAAGTGGGTTGGAATGTA...ATCTTCATTCTGCTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CAA 90 bp ACAAGAATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGCGGTTTTGAGAAGTTaGATTTATACATTCCAACCC +
Preference number: 3 (lower is better)
Translates to: TRMTKAKQNEDCLAFVKWAVLRS*IYTFQP
Trigger: GGGTTGGAATGTATAAATCAAACTTCTCAAAACCGC...CCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCATTCTTGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATCAATGACAAACATATaGGAATCAACTTCCCTAGCT +
Preference number: 3 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQSMTNI*ESTSLA
Trigger: AGCTAGGGAAGTTGATTCCAATATGTTTGTCATTGA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 72 bp TTTGTGGACTACGAAATTGTCGCTGAAACCTGGGTTTaGGATAACAGCGGTTTTGAGAAGTTTGATTTATAC +
Preference number: 3 (lower is better)
Translates to: FVDYEIVAETWV*DNSGFEKFDLY
Trigger: GTATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR TCA 72 bp ATAATACACTTTGTATTGGAAGAAATGTTTTGTGGGTaGCCCGGCTTTTCATGGAGTCCTAGATTCAGAGTT +
Preference number: 3 (lower is better)
Translates to: IIHFVLEEMFCG*PGFSWSPRFRV
Trigger: AACTCTGAATCTAGGACTCCATGAAAAGCCGGGTCACCCACAAAACATTTCTTCCAATACAAAGTGTATTAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 72 bp AAACCTTACAAGTGGTTTCTCTGGGCAATATTCCCATaGCAAATGAAAAAGCACAAAAACCTGCTTTCAAGA +
Preference number: 3 (lower is better)
Translates to: KPYKWFLWAIFP*QMKKHKNLLSR
Trigger: TCTTGAAAGCAGGTTTTTGTGCTTTTTCATTTGGCATGGGAATATTGCCCAGAGAAACCACTTGTAAGGTTT
39% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000552160.2
3UTR GCA 72 bp AATAGCACTCATATAAAGAACACAAAACGTCCTGGTTaGTTTGGTAATAGCGACCACTACTTAATAGGCGTA +
Preference number: 3 (lower is better)
Translates to: NSTHIKNTKRPG*FGNSDHYLIGV
Trigger: TACGCCTATTAAGTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGTGCTATT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 72 bp TATGAGCTCCCAGAACTGAAATGCATTCTCCTATCTTaGCACTTAATACTTACTAGACCACCAATGATATTC +
Preference number: 3 (lower is better)
Translates to: YELPELKCILLS*HLILTRPPMIF
Trigger: GAATATCATTGGTGGTCTAGTAAGTATTAAGTGGCAAGATAGGAGAATGCATTTCAGTTCTGGGAGCTCATA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR GCA 72 bp TTTCTTAGCACTGGAGTGCCTTTTCCAACCATTGAGTaGATGATCAGATTACACAAATACAAGCACATATCA +
Preference number: 3 (lower is better)
Translates to: FLSTGVPFPTIE*MIRLHKYKHIS
Trigger: TGATATGTGCTTGTATTTGTGTAATCTGATCATGCACTCAATGGTTGGAAAAGGCACTCCAGTGCTAAGAAA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CCA 72 bp AACCTTAGTTGCTTCCTCTGCATTGTTCTCATAACTTaGATTACAGCATGTGTAACGTTGAACTGTAATTGT +
Preference number: 3 (lower is better)
Translates to: NLSCFLCIVLIT*ITACVTLNCNC
Trigger: ACAATTACAGTTCAACGTTACACATGCTGTAATCCAAGTTATGAGAACAATGCAGAGGAAGCAACTAAGGTT
38% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
3UTR TCA 72 bp TTACAGACAATGGAAAATGTCACTCGGGAGCTAGATTaGTCTTGTAGTTCCATAGAAGTTGATTTTAAGGTA +
Preference number: 3 (lower is better)
Translates to: LQTMENVTRELD*SCSSIEVDFKV
Trigger: TACCTTAAAATCAACTTCTATGGAACTACAAGATCAATCTAGCTCCCGAGTGACATTTTCCATTGTCTGTAA
36% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 72 bp ATATTGGAATCAACTTCCCTAGCTGAATTTGGAGTGTaGGGAAAGATGATACTGCAATATACGTATTTTACA +
Preference number: 3 (lower is better)
Translates to: ILESTSLAEFGV*GKMILQYTYFT
Trigger: TGTAAAATACGTATATTGCAGTATCATCTTTCCTCACACTCCAAATTCAGCTAGGGAAGTTGATTCCAATAT
35% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR TCA 72 bp AAATACAAAAACAAAACCCAGCAGTTAATGAGCTACTaGTTAGAAAGTAAGTGCCTAAACAATACCAGCGTA +
Preference number: 3 (lower is better)
Translates to: KYKNKTQQLMSY*LESKCLNNTSV
Trigger: TACGCTGGTATTGTTTAGGCACTTACTTTCTAATCAGTAGCTCATTAACTGCTGGGTTTTGTTTTTGTATTT
35% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CCA 72 bp AGTTGGATATATGAATGGGATCTAATGGATTATGTGTaGACCAGAAAGATTAAGCCAAGCTCCTTTATTTAT +
Preference number: 3 (lower is better)
Translates to: SWIYEWDLMDYV*TRKIKPSSFIY
Trigger: ATAAATAAAGGAGCTTGGCTTAATCTTTCTGGTCCACACATAATCCATTAGATCCCATTCATATATCCAACT
35% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCGGTGGGGGAGATGGATaGGAAGCTGGCGGGGAAAGG +
Preference number: 4 (lower is better)
Translates to: GHGPASLRGEIKAVGSPSGGGDG*EAGGER
Trigger: CCTTTCCCCGCCAGCTTCGCATCCATCTCCCCCACC...GCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTCGGTGCACCCGCTCATaGTGCTCCGTCAGTGCCCCC +
Preference number: 4 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCRCTRS*CSVSAP
Trigger: GGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCG...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR TCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAGTGCGGCCGGATGAATaGGCAGCGCGATGCCCCGCC +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQVRPDE*AARCPA
Trigger: GGCGGGGCATCGCGCTGCTCATTCATCCGGCCGCAC...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACATAGCCCCGGTGGATaGAGGCAGGAGGGGGTTACG +
Preference number: 4 (lower is better)
Translates to: RLGHGPASLRGEIKAVGSHSPGG*RQEGVT
Trigger: CGTAACCCCCTCCTGCCTCCATCCACCGGGGCTATG...TGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp ACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTGGCGGTACGGAGGTCCTGGGACGGCTCTaGTCACAAAGGGAAGGTGAA +
Preference number: 4 (lower is better)
Translates to: TVGQSCLPASCEHCGGTEVLGRL*SQREGE
Trigger: TTCACCTTCCCTTTGTGATCAGAGCCGTCCCAGGAC...CTCCGTACCGCCACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CCA 90 bp GTTGTGAGCACTGTGGCGGTACGGAGGCAGCAGGCTGCTGACAATCTGGTGGAGACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGG +
Preference number: 4 (lower is better)
Translates to: VVSTVAVRRQQAADNLVETPAGS*AVSCVW
Trigger: CCACACACAGGATACTGCCCAAGATCCAGCGGGTGT...CTCCACCAGATTGTCAGCAGCCTGCTGCCTCCGTACCGCCACAGTGCTCACAAC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR TCA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTGCTCCAGCTCCTGTTTaGGGCTGTCGTACTCAGCCT +
Preference number: 4 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCAPAPV*GCRTQP
Trigger: AGGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGC...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTATGCTGCTCCGTCAGTaGCCCCTTGGTGTGTTCCAG +
Preference number: 4 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCMLLRQ*PLGVFQ
Trigger: CTGGAACACACCAAGGGGGCACTGACGGAGCAGCAT...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR TCA 90 bp CCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGGAAAGTGCGGCCGGATaGATGAGCAGCGCGATGCCC +
Preference number: 4 (lower is better)
Translates to: PSLCQMGLVRSSLSHQGVESAAG*MSSAMP
Trigger: GGGCATCGCGCTGCTCATTCATCCGGCCGCACTTTC...CACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGCGGTCAGCAGCCGTaGGGCATGGCCCGGGCTGCG +
Preference number: 4 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNCGQQP*GMARAA
Trigger: CGCAGCCCGGGCCATGCCGCACGGCTGCTGACCGCA...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAGCTTATATATTCGCCTGGATCTTCTCGTaGGTGGTCTCCGTGAGCTCC +
Preference number: 4 (lower is better)
Translates to: PSPAGQTAIASQIPAYIFAWIFS*VVSVSS
Trigger: GGAGCTCACGGAGACCACCCACGAGAAGATCCAGGC...GAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp GTTGTGAGCACTGTGGCGGTACGGAGGCAGCAGGCTGCTGACAATCTGGTGGAGCTGAGCCGGTGCCCTTaGATGAATTCACTCATGGAA +
Preference number: 4 (lower is better)
Translates to: VVSTVAVRRQQAADNLVELSRCP*MNSLME
Trigger: TTCCATGAGTGAATTCATCCAAGGGCACCGGCTCAG...CTCCACCAGATTGTCAGCAGCCTGCTGCCTCCGTACCGCCACAGTGCTCACAAC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCAGGGCGCACTGGGAGCTaGAATGTGGCTGCTCCTCAG +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAAGRTGS*NVAAPQ
Trigger: CTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCC...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGATGCCCCGCCGGCTCTaGTGGCAGCGGCAGCTACAC +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILMPRRL*WQRQLH
Trigger: GTGTAGCTGCCGCTGCCACCAGAGCCGGCGGGGCAT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGCTGCCACTGCGGGTaGCTCTGCTCTGCCTATAGT +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTGCHCG*LCSAYS
Trigger: ACTATAGGCAGAGCAGAGTCACCCGCAGTGGCAGCC...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCAGGCTGCCACTGCGGGTaGCTCTGCTCTGCCTATAGT +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAAGCHCG*LCSAYS
Trigger: ACTATAGGCAGAGCAGAGTCACCCGCAGTGGCAGCC...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTGCACCCGCTCATGCTaGTCCGTCAGTGCCCCCTTG +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVCTRSC*SVSAPL
Trigger: CAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTGCACCCGCTCATGCTaGTCCGTCAGTGCCCCCTTG +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGCTRSC*SVSAPL
Trigger: CAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GACATCCCCAGGAGGCTGAGTCTTCTGGAAGGCAGGGACCATGTGTTAGTCTTCCTCAATGTGGCGATCTaGTCCCGTTTGGTGCTCAGC +
Preference number: 4 (lower is better)
Translates to: DIPRRLSLLEGRDHVLVFLNVAI*SRLVLS
Trigger: GCTGAGCACCAAACGGGAGCAGATCGCCACATTGAG...GAAGACTAACACATGGTCCCTGCCTTCCAGAAGACTCAGCCTCCTGGGGATGTC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGGCCTGGATCTTCTCGTaGGTGGTCTCCGTGAGCTCC +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWAWIFS*VVSVSS
Trigger: GGAGCTCACGGAGACCACCCACGAGAAGATCCAGGC...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGCCTGGATCTTCTCGTaGGTGGTCTCCGTGAGCTCC +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTAWIFS*VVSVSS
Trigger: GGAGCTCACGGAGACCACCCACGAGAAGATCCAGGC...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGCCGTCAGTGCCCCCTTaGTGTGTTCCAGCTGTGTCT +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRPSVPP*CVPAVS
Trigger: AGACACAGCTGGAACACACCAAGGGGGCACTGACGG...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGACACCGCCCTCAATGTaGCGATCTGCTCCCGTTTGG +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRTPPSM*RSAPVW
Trigger: CCAAACGGGAGCAGATCGCCACATTGAGGGCGGTGT...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CCACACAGTCTAAATCCTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTATGCCCCGCCGGCTCTaGTGGCAGCGGCAGCTACAC +
Preference number: 4 (lower is better)
Translates to: PHSLNPEIVGPQAQTSSLMPRRL*WQRQLH
Trigger: GTGTAGCTGCCGCTGCCACCAGAGCCGGCGGGGCAT...AAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAGGATTTAGACTGTGTGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAATGCCCCGCCGGCTCTaGTGGCAGCGGCAGCTACAC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRMPRRL*WQRQLH
Trigger: GTGTAGCTGCCGCTGCCACCAGAGCCGGCGGGGCAT...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCGAGCCGCTGCTCTTTaGCGAGACAGTTGCAAGGAC +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWRAAAL*RDSCKD
Trigger: GTCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCG...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCGAGGCAGCAGGCTGCTaGCAATCTGGTGGAGCCACG +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSEAAGC*QSGGAT
Trigger: CGTGGCTCCACCAGATTGTCAGCAGCCTGCTGCCTC...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR TCA 90 bp ATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGGTGCGGCCGGATGAATaGGCAGCGCGATGCCCCGCC +
Preference number: 4 (lower is better)
Translates to: MTKAKQNEDCLAFVKWDWVRPDE*AARCPA
Trigger: GGCGGGGCATCGCGCTGCTCATTCATCCGGCCGCAC...CCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACATCCAGAGGAAAGCTaGGGTGCCACACAGTCTAAA +
Preference number: 4 (lower is better)
Translates to: RLGHGPASLRGEIKAVGSHPEES*GATQSK
Trigger: TTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATG...TGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGGTGCACCCGCTCATaGTGCTCCGTCAGTGCCCCC +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKRCTRS*CSVSAP
Trigger: GGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCG...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAACTCATGGCATTGACGTaGTCTGTGAGCCGGTGCACC +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQLMALT*SVSRCT
Trigger: GGTGCACCGGCTCACAGAGCACGTCAATGCCATGAG...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTGGCGGTACGGAGTTGGACTTGGTTCTTTaGTGGCCTCTGTGCTTTCTT +
Preference number: 4 (lower is better)
Translates to: TVGQSCLPASCEHCGGTELDLVL*WPLCFL
Trigger: AAGAAAGCACAGAGGCCAGCAAAGAACCAAGTCCAA...CTCCGTACCGCCACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTCGGTCCACAGCTTTCTaGAGATGCTTGATTTGGTCC +
Preference number: 4 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCRSTAF*RCLIWS
Trigger: GGACCAAATCAAGCATCTGCAGAAAGCTGTGGACCG...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp GACATCCCCAGGAGGCTGAGTCTTCTGGAAGGCAGGGACCATGTGTTAGTCTTCTCTGCTCCCGTTTGGTaGTCAGCAGGGACTTTAGCT +
Preference number: 4 (lower is better)
Translates to: DIPRRLSLLEGRDHVLVFSAPVW*SAGTLA
Trigger: AGCTAAAGTCCCTGCTGAGCACCAAACGGGAGCAGA...GAAGACTAACACATGGTCCCTGCCTTCCAGAAGACTCAGCCTCCTGGGGATGTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR GCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGAGCTGGAATGTGGCTaGTCCTCAGGGAGAGCTGTG +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTELECG*SSGRAV
Trigger: CACAGCTCTCCCTGAGGAGCAGCCACATTCCAGCTC...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGATTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAACCCTGCAGCAGCCGGTaGGGAATGATGCAGTCTCGG +
Preference number: 4 (lower is better)
Translates to: RLPSLCQMGLVRSSLSHQPCSSR*GMMQSR
Trigger: CCGAGACTGCATCATTCCGCACCGGCTGCTGCAGGG...TTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAATCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR GCA 90 bp TCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCCTCTCTCGCTCCACCTaGTCCCTCTGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: SSGTNLITFVDYEIVAETLSRST*SLWPCS
Trigger: GCTGCAGGGCCAGAGGGAGCAGGTGGAGCGAGAGAG...GGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR GCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGGCCGACTGGCAATACTaGCCCGTCATCACACACAGA +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRADWQY*PVITHR
Trigger: TCTGTGTGTGATGACGGGGCAGTATTGCCAGTCGGC...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCATAGCCCCGGTGGATaGAGGCAGGAGGGGGTTACG +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTHSPGG*RQEGVT
Trigger: CGTAACCCCCTCCTGCCTCCATCCACCGGGGCTATG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCCTGAAATTGTGGGTCCTCATAGCCCCGGTGGATaGAGGCAGGAGGGGGTTACG +
Preference number: 4 (lower is better)
Translates to: IQRKAEVPHSLNPEIVGPHSPGG*RQEGVT
Trigger: CGTAACCCCCTCCTGCCTCCATCCACCGGGGCTATG...AGGACCCACAATTTCAGGATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACACCGCCCTCAATGTaGCGATCTGCTCCCGTTTGG +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSTPPSM*RSAPVW
Trigger: CCAAACGGGAGCAGATCGCCACATTGAGGGCGGTGT...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTCAGGACTGACAGTTaGGCAGTCTTGCCTCCCGGC +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVVRTDS*AVLPPG
Trigger: GCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGAC...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCGGGCGCACTGGGAGCTaGAATGTGGCTGCTCCTCAG +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFGRTGS*NVAAPQ
Trigger: CTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCC...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTGGAGAGGGGCGCACTaGGAGCTGGAATGTGGCTGC +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSWRGAH*ELECGC
Trigger: GCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR TCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCGTGGGTGGTCTCCGTaGGCTCCTTGGTTAGCCTCT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTRGWSP*APWLAS
Trigger: AGAGGCTAACCAAGGAGCTCACGGAGACCACCCACG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCGTGGGTGGTCTCCGTaGGCTCCTTGGTTAGCCTCT +
Preference number: 4 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNRGWSP*APWLAS
Trigger: AGAGGCTAACCAAGGAGCTCACGGAGACCACCCACG...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTGGCTGCCACTGCGGGTaGCTCTGCTCTGCCTATAGT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTGCHCG*LCSAYS
Trigger: ACTATAGGCAGAGCAGAGTCACCCGCAGTGGCAGCC...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATGCCGGTGCCCTTGGATaGATTCACTCATGGAAGGGG +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDAGALG*IHSWKG
Trigger: CCCCTTCCATGAGTGAATTCATCCAAGGGCACCGGC...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR TCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACGTGCGGCCGGATGAATaGGCAGCGCGATGCCCCGCC +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYVRPDE*AARCPA
Trigger: GGCGGGGCATCGCGCTGCTCATTCATCCGGCCGCAC...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCGTCCGCTCAATAAGCTaGGTGGCTCCTGGATCTCCT +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSVRSIS*VAPGSP
Trigger: AGGAGATCCAGGAGCCACTCAGCTTATTGAGCGGAC...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGTCCGCTCAATAAGCTaGGTGGCTCCTGGATCTCCT +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTVRSIS*VAPGSP
Trigger: AGGAGATCCAGGAGCCACTCAGCTTATTGAGCGGAC...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTTGCACCCGCTCATGCTaGTCCGTCAGTGCCCCCTTG +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSCTRSC*SVSAPL
Trigger: CAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCA...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGCTCTGTGAGCCGGTaGACCCGCTCATGCTGCTCC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRCSVSR*TRSCCS
Trigger: GGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGAGCTCCTTGCTGCTTTaGAGGCCCCTCATGGCATTG +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWSSLLL*RPLMAL
Trigger: CAATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCT...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTCAATGTGGCGATCTaGTCCCGTTTGGTGCTCAGC +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWLNVAI*SRLVLS
Trigger: GCTGAGCACCAAACGGGAGCAGATCGCCACATTGAG...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATTGCGGTCAGCAGCCGTaGGGCATGGCCCGGGCTGCG +
Preference number: 4 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYCGQQP*GMARAA
Trigger: CGCAGCCCGGGCCATGCCGCACGGCTGCTGACCGCA...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGCGGTCAGCAGCCGTaGGGCATGGCCCGGGCTGCG +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLCGQQP*GMARAA
Trigger: CGCAGCCCGGGCCATGCCGCACGGCTGCTGACCGCA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCTCTCTCGCTCCACCTaGTCCCTCTGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDLSRST*SLWPCS
Trigger: GCTGCAGGGCCAGAGGGAGCAGGTGGAGCGAGAGAG...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATACACCGCCCTCAATGTaGCGATCTGCTCCCGTTTGG +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDTPPSM*RSAPVW
Trigger: CCAAACGGGAGCAGATCGCCACATTGAGGGCGGTGT...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGAAGTCCTCCAGCCTCTaGGTCAGGGCGAGTTTTTGC +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWKSSSL*VRASFC
Trigger: GCAAAAACTCGCCCTGACCCAGAGGCTGGAGGACTT...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTGTCAGGACTGACAGTTaGGCAGTCTTGCCTCCCGGC +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTVRTDS*AVLPPG
Trigger: GCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGAC...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGGGCGCACTGGGAGCTaGAATGTGGCTGCTCCTCAG +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSGRTGS*NVAAPQ
Trigger: CTGAGGAGCAGCCACATTCCAGCTCCCAGTGCGCCC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCAAAGTTGTTTCATCATACTGCTGTTTaGGGGTCAGCTTCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: QPRSEVKSRQWDHPAKLFHHTAV*GSASPP
Trigger: TGGAGGAGAAGCTGACCCTCAAACAGCAGTATGATG...AAACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCGCTCCAGCTCCTGTTTaGGGCTGTCGTACTCAGCCT +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFAPAPV*GCRTQP
Trigger: AGGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGC...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATGCTCCAGCTCCTGTTTaGGGCTGTCGTACTCAGCCT +
Preference number: 4 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNAPAPV*GCRTQP
Trigger: AGGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGC...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AGATTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAAGCCTCGCTCCGAGGTaGAATCAAGGCAGTGGGATC +
Preference number: 4 (lower is better)
Translates to: RLPSLCQMGLVRSSLSHQSLAPR*NQGSGI
Trigger: GATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCT...TTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAATCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGGGTGGGCACGGTGACTaGTGCCTCCCCACTTACTTT +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILGGHGD*CLPTYF
Trigger: AAAGTAAGTGGGGAGGCATCAGTCACCGTGCCCACC...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR GCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAATGCCTCTTTGAGCTaGTCCAGCTCCTGTTTGAGG +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRNASLS*SSSCLR
Trigger: CCTCAAACAGGAGCTGGAGCAGCTCAAAGAGGCATT...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCGAAGGACTGCCCAAATaGCTCTTTGAGCTGCTCCAG +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSEGLPK*LFELLQ
Trigger: CTGGAGCAGCTCAAAGAGGCATTTGGGCAGTCCTTC...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGTGGATGGAGAAGGACTaGCCAAATGCCTCTTTGAGC +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRWMEKD*PNASLS
Trigger: GCTCAAAGAGGCATTTGGGCAGTCCTTCTCCATCCA...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTCTGCTCCCGTTTGGTaGTCAGCAGGGACTTTAGCT +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWSAPVW*SAGTLA
Trigger: AGCTAAAGTCCCTGCTGAGCACCAAACGGGAGCAGA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACACAAGTTTGCCTTTGCTaGGTCGGGACTGCTCATGGT +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTQVCLC*VGTAHG
Trigger: ACCATGAGCAGTCCCGACGCAGCAAAGGCAAACTTG...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGGAGGTGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGACAGTTGGGCAGTCTTaGCTCCCGGCTAGTTGTGAG +
Preference number: 4 (lower is better)
Translates to: WRWDQGELLINSVGRKPLTVGQS*LPASCE
Trigger: CTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT...CAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCACCTCCA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp AGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCAGAAACTGACGAGAAATaGAACATGGAGAACAGGGCA +
Preference number: 4 (lower is better)
Translates to: RLGHGPASLRGEIKAVGSETDEK*NMENRA
Trigger: TGCCCTGTTCTCCATGTTGCATTTCTCGTCAGTTTC...TGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp ATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCCTGAAATTGTGGGTCCTGGGCCCTCTTTGAGCTaGTCCAGCTCCTGTTTGAGG +
Preference number: 4 (lower is better)
Translates to: IQRKAEVPHSLNPEIVGPGPSLS*SSSCLR
Trigger: CCTCAAACAGGAGCTGGAGCAGCTCAAAGAGGGCCC...AGGACCCACAATTTCAGGATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000550207.1
CDS-3UTR GCA 90 bp GGTGACCTCATAAGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGAGGCCAAACAGCCATTaGCTCCCAAATTCCAGCTTA +
Preference number: 4 (lower is better)
Translates to: GDLIRLGHGPASLRGEIKRPNSH*LPNSSL
Trigger: TAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCT...CTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATGAGGTCACC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACATGCTCCCTCTGGCCCTaGAGCAGCCGGTGCGGAATG +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTCSLWP*SSRCGM
Trigger: CATTCCGCACCGGCTGCTGCAGGGCCAGAGGGAGCA...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCACATAGCCCCGGTGGATaGAGGCAGGAGGGGGTTACG +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPHSPGG*RQEGVT
Trigger: CGTAACCCCCTCCTGCCTCCATCCACCGGGGCTATG...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACACAACCTTCCGGTGGATaGAGAAGGACTGCCCAAATG +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTQPSGG*RRTAQM
Trigger: CATTTGGGCAGTCCTTCTCCATCCACCGGAAGGTTG...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCATGACACACCCCGCCTaGCTAATCGTGGGGACAAAA +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSMTHPA*LIVGTK
Trigger: TTTTGTCCCCACGATTAGCCAGGCGGGGTGTGTCAT...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAAGCCCCTGAAGTCCTaGGACGGCTCTGATCACAAA +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQKPLKS*DGSDHK
Trigger: TTTGTGATCAGAGCCGTCCCAGGACTTCAGGGGCTT...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAGTCAGGGTGACCTCATAAGACTTGGACATGGCCCAGCCTCGCTCCGAGGTGGAAATGGGAAGGGATaGGTGGAAACGGAAAAGAAA +
Preference number: 4 (lower is better)
Translates to: SSQGDLIRLGHGPASLRGGNGKG*VETEKK
Trigger: TTTCTTTTCCGTTTCCACCCATCCCTTCCCATTTCC...ACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATGAGGTCACCCTGACTAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAAAGGGAGAAGGAAATaGGAAGGGATGGGTGGAAAC +
Preference number: 4 (lower is better)
Translates to: LLLISLPRRPNSHCLPNSKGRRK*EGMGGN
Trigger: GTTTCCACCCATCCCTTCCCATTTCCTTCTCCCTTT...GGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGCGTGGGTGGTCTCCGTaGGCTCCTTGGTTAGCCTCT +
Preference number: 4 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLRGWSP*APWLAS
Trigger: AGAGGCTAACCAAGGAGCTCACGGAGACCACCCACG...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATCGTGGGTGGTCTCCGTaGGCTCCTTGGTTAGCCTCT +
Preference number: 4 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNRGWSP*APWLAS
Trigger: AGAGGCTAACCAAGGAGCTCACGGAGACCACCCACG...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCCATCATACTGCTGTTTaGGGGTCAGCTTCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSHHTAV*GSASPP
Trigger: TGGAGGAGAAGCTGACCCTCAAACAGCAGTATGATG...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACATGCAACTGGTTCAGATaGGGTCCTTGTTTCTACCGG +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTCNWFR*GPCFYR
Trigger: CCGGTAGAAACAAGGACCTCATCTGAACCAGTTGCA...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTCGAGCCGCTGCTCTTTaGCGAGACAGTTGCAAGGAC +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSRAAAL*RDSCKD
Trigger: GTCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCG...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCACATTGCTCTCAGGGATaGGAAGGTTGCAGCATCTTC +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAAHCSQG*EGCSIF
Trigger: GAAGATGCTGCAACCTTCTCATCCCTGAGAGCAATG...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGCCGGTGCCCTTGGATaGATTCACTCATGGAAGGGG +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSAGALG*IHSWKG
Trigger: CCCCTTCCATGAGTGAATTCATCCAAGGGCACCGGC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR TCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTTCGTCCACAGGAGATaGAGACTAGGGGTGAGGAGG +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFFVHRR*RLGVRR
Trigger: CCTCCTCACCCCTAGTCTTCATCTCCTGTGGACGAA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CCAAATTCCAGCTTATATATTCATTTCTTAGGCAATTTTTCTCTTGGGGGAGGAGTGCGGCCGGATGAATaGGCAGCGCGATGCCCCGCC +
Preference number: 4 (lower is better)
Translates to: PNSSLYIHFLGNFSLGGGVRPDE*AARCPA
Trigger: GGCGGGGCATCGCGCTGCTCATTCATCCGGCCGCAC...TCCTCCCCCAAGAGAAAAATTGCCTAAGAAATGAATATATAAGCTGGAATTTGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp CTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCGTCGTCTTAGAGTGCTaGGACTTGATGACTCTTACT +
Preference number: 4 (lower is better)
Translates to: LLLISLPRRPNSHCLPNSVVLEC*DLMTLT
Trigger: AGTAAGAGTCATCAAGTCTCAGCACTCTAAGACGAC...GGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCGCATACCTTTTCCTCTaGGTGCCACTGCTGACCCGA +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSAYLFL*VPLLTR
Trigger: TCGGGTCAGCAGTGGCACTCAGAGGAAAAGGTATGC...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTGTGTGGGCAGCACTTaGTGGTTAAGGAGCCCGAGA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTCVGST*WLRSPR
Trigger: TCTCGGGCTCCTTAACCATCAAGTGCTGCCCACACA...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCAGACAATACTTCCTGCTaGACTCCCAGTCCCACCAAA +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAADNTSC*TPSPTK
Trigger: TTTGGTGGGACTGGGAGTTCAGCAGGAAGTATTGTC...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGGGTGGGGGAGATGGATaGGAAGCTGGCGGGGAAAGG +
Preference number: 4 (lower is better)
Translates to: MTKAKQNEDCLAFVKWDWGGGDG*EAGGER
Trigger: CCTTTCCCCGCCAGCTTCGCATCCATCTCCCCCACC...CCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCAT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp CTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCTCCAGTTCATCATACTaGTGTTTGAGGGTCAGCTTC +
Preference number: 4 (lower is better)
Translates to: LLLISLPRRPNSHCLPNSSSSSY*CLRVSF
Trigger: GAAGCTGACCCTCAAACAGCAGTATGATGAACTGGA...GGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCCAGATCCTGCACGACTaGGGTGAGCCTCTCGTTTTC +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSQILHD*GEPLVF
Trigger: GAAAACGAGAGGCTCACCGCAGTCGTGCAGGATCTG...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCGGTGCACCCGCTCATaGTGCTCCGTCAGTGCCCCC +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTRCTRS*CSVSAP
Trigger: GGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGACTCATGGCATTGACGTaGTCTGTGAGCCGGTGCACC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRLMALT*SVSRCT
Trigger: GGTGCACCGGCTCACAGAGCACGTCAATGCCATGAG...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGAGCTGGAATGTGGCTaGTCCTCAGGGAGAGCTGTG +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSELECG*SSGRAV
Trigger: CACAGCTCTCCCTGAGGAGCAGCCACATTCCAGCTC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAGCTTATATATTCAGGCCAAACAGCCATTaGCTCCCAAATTCCAGCTTA +
Preference number: 4 (lower is better)
Translates to: PSPAGQTAIASQIPAYIFRPNSH*LPNSSL
Trigger: TAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCT...GAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGGATCTCCTTTCTCAGTaGCCTACACTGGTAACTGTC +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRDLLSQ*PTLVTV
Trigger: GACAGTTACCAGTGTAGGGCACTGAGAAAGGAGATC...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCTCTCACCACTCTCCTTaGTGGTCTTCTCAAGGCTTG +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSSHHSP*WSSQGL
Trigger: CAAGCCTTGAGAAGACCACCAAGGAGAGTGGTGAGA...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAATGTGGGGGTCTTAGTTaGACTTGGTTCTTTGCTGGC +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQCGGLS*TWFFAG
Trigger: GCCAGCAAAGAACCAAGTCCAACTAAGACCCCCACA...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCAAGTCCTCCAGCCTCTaGGTCAGGGCGAGTTTTTGC +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFKSSSL*VRASFC
Trigger: GCAAAAACTCGCCCTGACCCAGAGGCTGGAGGACTT...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTAAGCCCCTGAAGTCCTaGGACGGCTCTGATCACAAA +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGKPLKS*DGSDHK
Trigger: TTTGTGATCAGAGCCGTCCCAGGACTTCAGGGGCTT...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATGGAGAGGGGCGCACTaGGAGCTGGAATGTGGCTGC +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQWRGAH*ELECGC
Trigger: GCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGGCTTGGAGAGACAGTaGAGAGGGGCGCACTGGGAG +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMGLERQ*RGAHWE
Trigger: CTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAGTCAGGGTGACCTCATAAGACTTGGACATGGCCCAGCCTCGCTCCGAGGTAGGCAATTTTTCTCTTaGGGGAGGAAACAATGGACT +
Preference number: 4 (lower is better)
Translates to: SSQGDLIRLGHGPASLRGRQFFS*GRKQWT
Trigger: AGTCCATTGTTTCCTCCCCCAAGAGAAAAATTGCCT...ACCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATGAGGTCACCCTGACTAGA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCCGTGGGTGGTCTCCGTaGGCTCCTTGGTTAGCCTCT +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVRGWSP*APWLAS
Trigger: AGAGGCTAACCAAGGAGCTCACGGAGACCACCCACG...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATCATCATACTGCTGTTTaGGGGTCAGCTTCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDHHTAV*GSASPP
Trigger: TGGAGGAGAAGCTGACCCTCAAACAGCAGTATGATG...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGCCTGCACGACTGCGGTaGGCCTCTCGTTTTCTGCCT +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMPARLR*ASRFLP
Trigger: AGGCAGAAAACGAGAGGCTCACCGCAGTCGTGCAGG...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTGCAACTGGTTCAGATaGGGTCCTTGTTTCTACCGG +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVCNWFR*GPCFYR
Trigger: CCGGTAGAAACAAGGACCTCATCTGAACCAGTTGCA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACACTTTCTGCAGATGCTTaGTTTGGTCCCGGATTATGG +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTLSADA*FGPGLW
Trigger: CCATAATCCGGGACCAAATCAAGCATCTGCAGAAAG...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCGAGCCGCTGCTCTTTaGCGAGACAGTTGCAAGGAC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDRAAAL*RDSCKD
Trigger: GTCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCG...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAGCAGGGACTTTAGCTTaGGGATCTCTTCCATTAAGG +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQAGTLA*GSLPLR
Trigger: CCTTAATGGAAGAGATCCTCAAGCTAAAGTCCCTGC...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATGCCCTTCAGAAGAAATaGTTCTGTGGAGGTGGGATC +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDALQKK*FCGGGI
Trigger: GATCCCACCTCCACAGAATCATTTCTTCTGAAGGGC...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR TCA 90 bp GACATCCCCAGGAGGCTGAGTCTTCTGGAAGGCAGGGACCATGTGTTAGTCTTCACTCACTGGATTTGCTaGTTTCTGCTTTCACCACTT +
Preference number: 4 (lower is better)
Translates to: DIPRRLSLLEGRDHVLVFTHWIC*FLLSPL
Trigger: AAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGT...GAAGACTAACACATGGTCCCTGCCTTCCAGAAGACTCAGCCTCCTGGGGATGTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAACTGCAATACCTCTTCTaGGGCCATAGCCCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKLQYLF*GHSPGG
Trigger: TCCACCGGGGCTATGGCCGCAGAAGAGGTATTGCAG...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGTCCAGTTCATCATACTaGTGTTTGAGGGTCAGCTTC +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRSSSSY*CLRVSF
Trigger: GAAGCTGACCCTCAAACAGCAGTATGATGAACTGGA...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCGAAGGACTGCCCAAATaGCTCTTTGAGCTGCTCCAG +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFEGLPK*LFELLQ
Trigger: CTGGAGCAGCTCAAAGAGGCATTTGGGCAGTCCTTC...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTTCGATGCTGACTCCTaGAGAAGCGTTTCCTCCCGA +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILFDADS*RSVSSR
Trigger: TCGGGAGGAAACGCTTCTGCAGGAGTCAGCATCGAA...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCATGTTTCAGCTCGTTCTaGATCTCCAAGATCTTCCCC +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAACFSSF*ISKIFP
Trigger: GGGGAAGATCTTGGAGATGCAGAACGAGCTGAAACA...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAGAGCCTCTCGTTTTCTaGCTGTACATTAGTGACCAC +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQEPLVF*LYISDH
Trigger: GTGGTCACTAATGTACAGGCAGAAAACGAGAGGCTC...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTTTCTCCTTCAGATCCTaGACGACTGCGGTGAGCCTC +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSFSFRS*TTAVSL
Trigger: GAGGCTCACCGCAGTCGTGCAGGATCTGAAGGAGAA...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTTTTCCCGCTCTACCTaGATAAGCTGCTGCTTCAAC +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWFSRST*ISCCFN
Trigger: GTTGAAGCAGCAGCTTATGCAGGTAGAGCGGGAAAA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCAGCTCCTTGCTGCTTTaGAGGCCCCTCATGGCATTG +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSSSLLL*RPLMAL
Trigger: CAATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGAGCTGGAATGTGGCTaGTCCTCAGGGAGAGCTGTG +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDELECG*SSGRAV
Trigger: CACAGCTCTCCCTGAGGAGCAGCCACATTCCAGCTC...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGAAACGGAAAAGAAAGTaGGGCCGGATGAATGAGCAG +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWKRKRK*GRMNEQ
Trigger: CTGCTCATTCATCCGGCCGCACTTTCTTTTCCGTTT...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGCCTGGATCTTCTCGTaGGTGGTCTCCGTGAGCTCC +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVAWIFS*VVSVSS
Trigger: GGAGCTCACGGAGACCACCCACGAGAAGATCCAGGC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTTCAGCAACCTTCCGGTaGATGGAGAAGGACTGCCCA +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSSATFR*MEKDCP
Trigger: TGGGCAGTCCTTCTCCATCCACCGGAAGGTTGCTGA...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGGGTTCTGCTTCAACGTaGACACTAGTTTCTGCAATG +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRGSAST*TLVSAM
Trigger: CATTGCAGAAACTAGTGTCCACGTTGAAGCAGAACC...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGATGGCATCTTCCAGCTaGCTGTTCAGCAGTACCGTC +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILMASSS*LFSSTV
Trigger: GACGGTACTGCTGAACAGCCAGCTGGAAGATGCCAT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCAGGGCTTCTTCCAGTTaGTGCTCAGCAATCTCTTTC +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSRASSS*CSAISF
Trigger: GAAAGAGATTGCTGAGCACCAACTGGAAGAAGCCCT...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGGTTGGCCAAAAGAATaGCCTTTTCCCGCTCTACCT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVGWPKE*PFPALP
Trigger: AGGTAGAGCGGGAAAAGGCCATTCTTTTGGCCAACC...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGCACCACTCTCCTTGGTaGTCTTCTCAAGGCTTGTCA +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVHHSPW*SSQGLS
Trigger: TGACAAGCCTTGAGAAGACCACCAAGGAGAGTGGTG...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTCTCACCACTCTCCTTaGTGGTCTTCTCAAGGCTTG +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDSHHSP*WSSQGL
Trigger: CAAGCCTTGAGAAGACCACCAAGGAGAGTGGTGAGA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCGTCACTAACTCATCCTaGGCCGTATTAAGGGTACTG +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSVTNSS*AVLRVL
Trigger: CAGTACCCTTAATACGGCCCAGGATGAGTTAGTGAC...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGGGTCTTAGTTGGACTTaGTTCTTTGCTGGCCTCTGT +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWGLSWT*FFAGLC
Trigger: ACAGAGGCCAGCAAAGAACCAAGTCCAACTAAGACC...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTGTGGGGGTCTTAGTTaGACTTGGTTCTTTGCTGGC +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDCGGLS*TWFFAG
Trigger: GCCAGCAAAGAACCAAGTCCAACTAAGACCCCCACA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCCAGCTGTCTGCTTGTTaGCTTTCAACACCGCCCTCA +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSQLSAC*LSTPPS
Trigger: TGAGGGCGGTGTTGAAAGCCAACAAGCAGACAGCTG...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCAGCTGTCTGCTTGTTaGCTTTCAACACCGCCCTCA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTQLSAC*LSTPPS
Trigger: TGAGGGCGGTGTTGAAAGCCAACAAGCAGACAGCTG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCAAGTCCTCCAGCCTCTaGGTCAGGGCGAGTTTTTGC +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSKSSSL*VRASFC
Trigger: GCAAAAACTCGCCCTGACCCAGAGGCTGGAGGACTT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCCGTCGGGACTGCTCATaGTCAAACTCTAAGTCCTCC +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSRRDCS*SNSKSS
Trigger: GGAGGACTTAGAGTTTGACCATGAGCAGTCCCGACG...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000552160.2
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCATGATTCTGTGGAGGTaGGATCAGGGGGAACTCTTA +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSMILWR*DQGELL
Trigger: TAAGAGTTCCCCCTGATCCCACCTCCACAGAATCAT...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR CCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTCTGAGCCGGTGCCCTTaGATGAATTCACTCATGGAA +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGLSRCP*MNSLME
Trigger: TTCCATGAGTGAATTCATCCAAGGGCACCGGCTCAG...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTGGAGAGGGGCGCACTaGGAGCTGGAATGTGGCTGC +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSWRGAH*ELECGC
Trigger: GCAGCCACATTCCAGCTCCCAGTGCGCCCCTCTCCA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CCAAATTCCAGCTTATATATTCATTTCTTAGGCAATTTTTCTCTTGGGGGAGGAATGCCCCGCCGGCTCTaGTGGCAGCGGCAGCTACAC +
Preference number: 4 (lower is better)
Translates to: PNSSLYIHFLGNFSLGGGMPRRL*WQRQLH
Trigger: GTGTAGCTGCCGCTGCCACCAGAGCCGGCGGGGCAT...TCCTCCCCCAAGAGAAAAATTGCCTAAGAAATGAATATATAAGCTGGAATTTGG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCTGGGGGAGGAAACAATaGACTCTTTCAATCTTCTCT +
Preference number: 4 (lower is better)
Translates to: LLLISLPRRPNSHCLPNSWGRKQ*TLSIFS
Trigger: AGAGAAGATTGAAAGAGTCCATTGTTTCCTCCCCCA...GGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGGTGAAATCAAGGCAGTaGGATCACCCAGCAAAGTTG +
Preference number: 4 (lower is better)
Translates to: PSLCQMGLVRSSLSHQGVVKSRQ*DHPAKL
Trigger: CAACTTTGCTGGGTGATCCCACTGCCTTGATTTCAC...CACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAAATGTTCAGCTCACTaGATAAGTCAGAGACAGGGT +
Preference number: 4 (lower is better)
Translates to: GSILCVATKLPPQMFVHRKCSAH*ISQRQG
Trigger: ACCCTGTCTCTGACTTATTCAGTGAGCTGAACATTT...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCGAGCTAACTCCTCACTaGATGTCACTAACTCATCCT +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSELTPH*MSLTHP
Trigger: AGGATGAGTTAGTGACATTCAGTGAGGAGTTAGCTC...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGATCCAATACTGGAGATaGCGGTGGGGCAGTAATAAC +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVIQYWR*RWGSNN
Trigger: GTTATTACTGCCCCACCGTCATCTCCAGTATTGGAT...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAATTCGTCCACAGGAGATaGAGACTAGGGGTGAGGAGG +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKFVHRR*RLGVRR
Trigger: CCTCCTCACCCCTAGTCTTCATCTCCTGTGGACGAA...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAGCAGAATGAAGATGAAAGTGCGGCCGGATaGATGAGCAGCGCGATGCCC +
Preference number: 4 (lower is better)
Translates to: FFFCSPMTRMTKAKQNEDESAAG*MSSAMP
Trigger: GGGCATCGCGCTGCTCATTCATCCGGCCGCACTTTC...ATCTTCATTCTGCTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp CCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAGCTTATATATTCCACTACCCACGTATTTaGTATACACCACTCTTTCAG +
Preference number: 4 (lower is better)
Translates to: PSPAGQTAIASQIPAYIFHYPRI*YTPLFQ
Trigger: CTGAAAGAGTGGTGTATATCAAATACGTGGGTAGTG...GAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACACTATGGTGGGCACGGTaGCTGATGCCTCCCCACTTA +
Preference number: 4 (lower is better)
Translates to: YPCPVKEKLINSTISKGTLWWAR*LMPPHL
Trigger: TAAGTGGGGAGGCATCAGTCACCGTGCCCACCATAG...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAACTATGGTGGGCACGGTaGCTGATGCCTCCCCACTTA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQLWWAR*LMPPHL
Trigger: TAAGTGGGGAGGCATCAGTCACCGTGCCCACCATAG...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR TCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCAGTAAAGCCAGCCATCTaGGACACGTTTTCTGTTTCT +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAAVKPAI*DTFSVS
Trigger: AGAAACAGAAAACGTGTCTCAGATGGCTGGCTTTAC...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGAAATGTTTTGTGGGTaGCCCGGCTTTTCATGGAGT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVEMFCG*PGFSWS
Trigger: ACTCCATGAAAAGCCGGGTCACCCACAAAACATTTC...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCGGTGGGGGAGATGGATaGGAAGCTGGCGGGGAAAGG +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLGGGDG*EAGGER
Trigger: CCTTTCCCCGCCAGCTTCGCATCCATCTCCCCCACC...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAGAAGGACTGCCCAAATaGCTCTTTGAGCTGCTCCAG +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKREGLPK*LFELLQ
Trigger: CTGGAGCAGCTCAAAGAGGCATTTGGGCAGTCCTTC...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTGTTTCAGCTCGTTCTaGATCTCCAAGATCTTCCCC +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDCFSSF*ISKIFP
Trigger: GGGGAAGATCTTGGAGATGCAGAACGAGCTGAAACA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTTTTCCCGCTCTACCTaGATAAGCTGCTGCTTCAAC +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDFSRST*ISCCFN
Trigger: GTTGAAGCAGCAGCTTATGCAGGTAGAGCGGGAAAA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTGCTCTGTGAGCCGGTaGACCCGCTCATGCTGCTCC +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFCSVSR*TRSCCS
Trigger: GGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCA...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTTGCTGCGTCGGGACTaGTCATGGTCAAACTCTAAG +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFLLRRD*SWSNSK
Trigger: CTTAGAGTTTGACCATGAGCAGTCCCGACGCAGCAA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTTCCAAGTTTGCCTTTaGTGCGTCGGGACTGCTCAT +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFFQVCL*CVGTAH
Trigger: ATGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTGCTCTTTCCAAGTTTaGCTTTGCTGCGTCGGGACT +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSCSFQV*LCCVGT
Trigger: AGTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000552160.2
CDS-3UTR GCA 90 bp CTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAAGCAGAATGAAGATTaGCTAGCCTTTGTCAAATGG +
Preference number: 4 (lower is better)
Translates to: LLLISLPRRPNSHCLPNSKQNED*LAFVKW
Trigger: CCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTT...GGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp CCAAATTCCAGCTTATATATTCATTTCTTAGGCAATTTTTCTCTTGGGGGAGGATGCTCCCTCTGGCCCTaGAGCAGCCGGTGCGGAATG +
Preference number: 4 (lower is better)
Translates to: PNSSLYIHFLGNFSLGGGCSLWP*SSRCGM
Trigger: CATTCCGCACCGGCTGCTGCAGGGCCAGAGGGAGCA...TCCTCCCCCAAGAGAAAAATTGCCTAAGAAATGAATATATAAGCTGGAATTTGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR GCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTACCACTCCATTTCTGTaGCACCCATGTCCGCTCAAT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTTTPFL*HPCPLN
Trigger: ATTGAGCGGACATGGGTGGCACAGAAATGGAGTGGT...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAATGCAAATACAACATTaGCGACTGGCAATACTGCCC +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQMQIQH*RLAILP
Trigger: GGGCAGTATTGCCAGTCGGCAATGTTGTATTTGCAT...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCATAGCCCCGGTGGATaGAGGCAGGAGGGGGTTACG +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTHSPGG*RQEGVT
Trigger: CGTAACCCCCTCCTGCCTCCATCCACCGGGGCTATG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTCTCTTTCAATCGGATaGCATCTTCCAGCTGGCTGT +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDSLSIG*HLPAGC
Trigger: ACAGCCAGCTGGAAGATGCCATCCGATTGAAAGAGA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCACCACTCTCCTTGGTaGTCTTCTCAAGGCTTGTCA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTHHSPW*SSQGLS
Trigger: TGACAAGCCTTGAGAAGACCACCAAGGAGAGTGGTG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTGTCACTAACTCATCCTaGGCCGTATTAAGGGTACTG +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGVTNSS*AVLRVL
Trigger: CAGTACCCTTAATACGGCCCAGGATGAGTTAGTGAC...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGACGTCGGGACTGCTCATaGTCAAACTCTAAGTCCTCC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRRRDCS*SNSKSS
Trigger: GGAGGACTTAGAGTTTGACCATGAGCAGTCCCGACG...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTATGATTCTGTGGAGGTaGGATCAGGGGGAACTCTTA +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGMILWR*DQGELL
Trigger: TAAGAGTTCCCCCTGATCCCACCTCCACAGAATCAT...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGGCTTGGAGAGACAGTaGAGAGGGGCGCACTGGGAG +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFGLERQ*RGAHWE
Trigger: CTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCC...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTGCAGTATCCTGTGTGTaGCTACAAAACTTCCACCCC +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTAVSCV*LQNFHP
Trigger: GGGGTGGAAGTTTTGTAGCCACACACAGGATACTGC...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCCTGAAATTGTGGGTCCTACGAGAAATGCAACATaGAGAACAGGGCAGAGGGTC +
Preference number: 4 (lower is better)
Translates to: IQRKAEVPHSLNPEIVGPTRNAT*RTGQRV
Trigger: GACCCTCTGCCCTGTTCTCCATGTTGCATTTCTCGT...AGGACCCACAATTTCAGGATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAATGGGAAGGGATGGGTaGAAACGGAAAAGAAAGTGC +
Preference number: 4 (lower is better)
Translates to: LPSLCQMGLVRSSLSHQGMGRDG*KRKRKC
Trigger: GCACTTTCTTTTCCGTTTCCACCCATCCCTTCCCAT...TCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGGGAAATGGGAAGGGATaGGTGGAAACGGAAAAGAAA +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWGNGKG*VETEKK
Trigger: TTTCTTTTCCGTTTCCACCCATCCCTTCCCATTTCC...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAGCTTATATATTCTGGGGGAGGAAACAATaGACTCTTTCAATCTTCTCT +
Preference number: 4 (lower is better)
Translates to: PSPAGQTAIASQIPAYIFWGRKQ*TLSIFS
Trigger: AGAGAAGATTGAAAGAGTCCATTGTTTCCTCCCCCA...GAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp GAGGAAACAATGGACTCTTTCAATCTTCTCTTACCAACAAAGGGCCCTAGAAGACATAAGACTTGGACATaGCCCAGCCTCGCTCCGAGG +
Preference number: 4 (lower is better)
Translates to: EETMDSFNLLLPTKGPRRHKTWT*PSLAPR
Trigger: CCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATG...TCTTCTAGGGCCCTTTGTTGGTAAGAGAAGATTGAAAGAGTCCATTGTTTCCTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCAAGGTTAGGCTGCTATaGTTGGGAACTTCATGTCGA +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSKVRLL*LGTSCR
Trigger: TCGACATGAAGTTCCCAACCATAGCAGCCTAACCTT...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCGGAAGAAATGTTTTGTaGGTGACCCGGCTTTTCATG +
Preference number: 4 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSGRNVL*VTRLFM
Trigger: CATGAAAAGCCGGGTCACCCACAAAACATTTCTTCC...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCCATCATACTGCTGTTTaGGGGTCAGCTTCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: SSGTNLITFVDYEIVAETHHTAV*GSASPP
Trigger: TGGAGGAGAAGCTGACCCTCAAACAGCAGTATGATG...GGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCCCTGCACGACTGCGGTaGGCCTCTCGTTTTCTGCCT +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLPARLR*ASRFLP
Trigger: AGGCAGAAAACGAGAGGCTCACCGCAGTCGTGCAGG...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGGTATTAAGGGTACTGTaGTTTTCGTTGGCTATGCTG +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWVLRVL*FSLAML
Trigger: CAGCATAGCCAACGAAAATCACAGTACCCTTAATAC...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCTTTCTGCAGATGCTTaGTTTGGTCCCGGATTATGG +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFLSADA*FGPGLW
Trigger: CCATAATCCGGGACCAAATCAAGCATCTGCAGAAAG...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGACATTGCTCTCAGGGATaGGAAGGTTGCAGCATCTTC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRHCSQG*EGCSIF
Trigger: GAAGATGCTGCAACCTTCTCATCCCTGAGAGCAATG...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAGCCCTTCAGAAGAAATaGTTCTGTGGAGGTGGGATC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRALQKK*FCGGGI
Trigger: GATCCCACCTCCACAGAATCATTTCTTCTGAAGGGC...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR TCA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATGCTGAAACCTGGGTTTaGGATAACAGCGGTTTTGAG +
Preference number: 4 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNAETWV*DNSGFE
Trigger: CTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGC...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp ATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCCTGAAATTGTGGGTCCTGCTGAAACCTGGGTTTaGGATAACAGCGGTTTTGAG +
Preference number: 4 (lower is better)
Translates to: IQRKAEVPHSLNPEIVGPAETWV*DNSGFE
Trigger: CTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGC...AGGACCCACAATTTCAGGATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATGTCAAATGGGATTGGTaGGGAGTTCCCTCTCTCACC +
Preference number: 4 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNVKWDW*GVPSLT
Trigger: GGTGAGAGAGGGAACTCCTCACCAATCCCATTTGAC...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCAGAAGAGCCTCATTTaGAATGCAACACTACCCACG +
Preference number: 4 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNQKSLI*NATLPT
Trigger: CGTGGGTAGTGTTGCATTTCAAATGAGGCTCTTCTG...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTTCCCCCAATGTCTCTaGGGGACAGATTGTAACTTT +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDFPQCL*GTDCNF
Trigger: AAAGTTACAATCTGTCCCTCAGAGACATTGGGGGAA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAGGTGGGGGAGATGGATaGGAAGCTGGCGGGGAAAGG +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGGGGDG*EAGGER
Trigger: CCTTTCCCCGCCAGCTTCGCATCCATCTCCCCCACC...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTCCAGTTCATCATACTaGTGTTTGAGGGTCAGCTTC +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVSSSSY*CLRVSF
Trigger: GAAGCTGACCCTCAAACAGCAGTATGATGAACTGGA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCAATGCCTCTTTGAGCTaGTCCAGCTCCTGTTTGAGG +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSNASLS*SSSCLR
Trigger: CCTCAAACAGGAGCTGGAGCAGCTCAAAGAGGCATT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGGATGGAGAAGGACTaGCCAAATGCCTCTTTGAGC +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSWMEKD*PNASLS
Trigger: GCTCAAAGAGGCATTTGGGCAGTCCTTCTCCATCCA...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTCTCATGGCATTGACGTaGTCTGTGAGCCGGTGCACC +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSLMALT*SVSRCT
Trigger: GGTGCACCGGCTCACAGAGCACGTCAATGCCATGAG...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGCTTTGCTGGCCTCTGTaGTTTCTTTTGCAACTGGTT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVLCWPL*FLLQLV
Trigger: AACCAGTTGCAAAAGAAAGCACAGAGGCCAGCAAAG...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCGTCAGGGCGAGTTTTTaGTGGATAGCCATTCGTAAC +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFVRASF*WIAIRN
Trigger: GTTACGAATGGCTATCCAGCAAAAACTCGCCCTGAC...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTTGCTGCGTCGGGACTaGTCATGGTCAAACTCTAAG +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSLLRRD*SWSNSK
Trigger: CTTAGAGTTTGACCATGAGCAGTCCCGACGCAGCAA...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATTCCAAGTTTGCCTTTaGTGCGTCGGGACTGCTCAT +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRFQVCL*CVGTAH
Trigger: ATGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTTGCTCTTTCCAAGTTTaGCTTTGCTGCGTCGGGACT +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSCSFQV*LCCVGT
Trigger: AGTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCA...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGCTCTTTCCAAGTTTaGCTTTGCTGCGTCGGGACT +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSCSFQV*LCCVGT
Trigger: AGTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCA...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATTCCTTGCTGAGCCGGTaGCCTTGGATGAATTCACTC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDSLLSR*PWMNSL
Trigger: GAGTGAATTCATCCAAGGGCACCGGCTCAGCAAGGA...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR GCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGACAGTTGGGCAGTCTTaGCTCCCGGCTAGTTGTGAG +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMTVGQS*LPASCE
Trigger: CTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAACAGTTGGGCAGTCTTaGCTCCCGGCTAGTTGTGAG +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTTVGQS*LPASCE
Trigger: CTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GAGGAAACAATGGACTCTTTCAATCTTCTCTTACCAACAAAGGGCCCTAGAAGAAGGGGCTCCGGATTCTaGTTATTCAGAGACGCCCGT +
Preference number: 4 (lower is better)
Translates to: EETMDSFNLLLPTKGPRRRGSGF*LFRDAR
Trigger: ACGGGCGTCTCTGAATAAGCAGAATCCGGAGCCCCT...TCTTCTAGGGCCCTTTGTTGGTAAGAGAAGATTGAAAGAGTCCATTGTTTCCTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAAGGGGCTCCGGATTCTaGTTATTCAGAGACGCCCGT +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTRGSGF*LFRDAR
Trigger: ACGGGCGTCTCTGAATAAGCAGAATCCGGAGCCCCT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTGAAACTGACGAGAAATaGAACATGGAGAACAGGGCA +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGETDEK*NMENRA
Trigger: TGCCCTGTTCTCCATGTTGCATTTCTCGTCAGTTTC...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR GCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATCTCACCTCTTTGAGCTaGTCCAGCTCCTGTTTGAGG +
Preference number: 4 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNLTSLS*SSSCLR
Trigger: CCTCAAACAGGAGCTGGAGCAGCTCAAAGAGGTGAG...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGAGCAGAAGGTTAGGCTaGTATGGTTGGGAACTTCAT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVSRRLG*YGWELH
Trigger: ATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCT...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGCCGACTGGCAATACTaGCCCGTCATCACACACAGA +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVADWQY*PVITHR
Trigger: TCTGTGTGTGATGACGGGGCAGTATTGCCAGTCGGC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACATTCTTAGCACTGGAGTaGCTTTTCCAACCATTGAGT +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTFLALE*LFQPLS
Trigger: ACTCAATGGTTGGAAAAGGCACTCCAGTGCTAAGAA...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATGCCTGGATCTTCTCGTaGGTGGTCTCCGTGAGCTCC +
Preference number: 4 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYAWIFS*VVSVSS
Trigger: GGAGCTCACGGAGACCACCCACGAGAAGATCCAGGC...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGGTTCTGCTTCAACGTaGACACTAGTTTCTGCAATG +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVGSAST*TLVSAM
Trigger: CATTGCAGAAACTAGTGTCCACGTTGAAGCAGAACC...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCCTTCGTATTCAACCTaGTTCTGCTTCAACGTGGAC +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTPSYST*FCFNVD
Trigger: GTCCACGTTGAAGCAGAACCAGGTTGAATACGAAGG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTCTCTTTCAATCGGATaGCATCTTCCAGCTGGCTGT +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFSLSIG*HLPAGC
Trigger: ACAGCCAGCTGGAAGATGCCATCCGATTGAAAGAGA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCTCCTTTCCTTAAGGTaGGAGTCCGATAGTCTCCAT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTLLSLR*ESDSLH
Trigger: ATGGAGACTATCGGACTCCCACCTTAAGGAAAGGAG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCTCCTTTCCTTAAGGTaGGAGTCCGATAGTCTCCAT +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFLLSLR*ESDSLH
Trigger: ATGGAGACTATCGGACTCCCACCTTAAGGAAAGGAG...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGGTTGGCCAAAAGAATaGCCTTTTCCCGCTCTACCT +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSGWPKE*PFPALP
Trigger: AGGTAGAGCGGGAAAAGGCCATTCTTTTGGCCAACC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTGACTCCTGTAGGTTaGCCAAAAGAATGGCCTTTT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVVTPVG*PKEWPF
Trigger: AAAAGGCCATTCTTTTGGCCAACCTACAGGAGTCAC...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCCCGTCAGTGCCCCCTTaGTGTGTTCCAGCTGTGTCT +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFPSVPP*CVPAVS
Trigger: AGACACAGCTGGAACACACCAAGGGGGCACTGACGG...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCTCACCACTCTCCTTaGTGGTCTTCTCAAGGCTTG +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRSHHSP*WSSQGL
Trigger: CAAGCCTTGAGAAGACCACCAAGGAGAGTGGTGAGA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGGTCACTAACTCATCCTaGGCCGTATTAAGGGTACTG +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILVTNSS*AVLRVL
Trigger: CAGTACCCTTAATACGGCCCAGGATGAGTTAGTGAC...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAGGGACAAAAGTCCTCTaGGATCATCGGGCCCTTTCA +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPGTKVL*DHRALS
Trigger: TGAAAGGGCCCGATGATCCCAGAGGACTTTTGTCCC...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAGGGACAAAAGTCCTCTaGGATCATCGGGCCCTTTCA +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKGTKVL*DHRALS
Trigger: TGAAAGGGCCCGATGATCCCAGAGGACTTTTGTCCC...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACATGCAGATGCTTGATTTaGTCCCGGATTATGGCATTA +
Preference number: 4 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTCRCLI*SRIMAL
Trigger: TAATGCCATAATCCGGGACCAAATCAAGCATCTGCA...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGTCAGGACTGACAGTTaGGCAGTCTTGCCTCCCGGC +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFVRTDS*AVLPPG
Trigger: GCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGAC...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAGGCTTGGAGAGACAGTaGAGAGGGGCGCACTGGGAG +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVGLERQ*RGAHWE
Trigger: CTCCCAGTGCGCCCCTCTCCACTGTCTCTCCAAGCC...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAGCAGTATCCTGTGTGTaGCTACAAAACTTCCACCCC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRAVSCV*LQNFHP
Trigger: GGGGTGGAAGTTTTGTAGCCACACACAGGATACTGC...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGG +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMTPAGS*AVSCVW
Trigger: CCACACACAGGATACTGCCCAAGATCCAGCGGGTGT...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGAGGCAATTTTTCTCTTaGGGGAGGAAACAATGGACT +
Preference number: 4 (lower is better)
Translates to: PSLCQMGLVRSSLSHQGVRQFFS*GRKQWT
Trigger: AGTCCATTGTTTCCTCCCCCAAGAGAAAAATTGCCT...CACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp CTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGGTTACATCTCTCACCAAGGAGTaGTTACATCCAGAGGAAAGC +
Preference number: 4 (lower is better)
Translates to: LCQMGLVRSSLSHQGVVTSLTKE*LHPEES
Trigger: GCTTTCCTCTGGATGTAACCACTCCTTGGTGAGAGA...TGTAACCACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTTACGACTTACCATTTaGTCTCTGATGGACCACTCC +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDLRLTI*SLMDHS
Trigger: GGAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTTACGACTTACCATTTaGTCTCTGATGGACCACTCC +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGLRLTI*SLMDHS
Trigger: GGAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAACATCATACTGCTGTTTaGGGGTCAGCTTCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKHHTAV*GSASPP
Trigger: TGGAGGAGAAGCTGACCCTCAAACAGCAGTATGATG...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATGCTCCAGCTCCTGTTTaGGGCTGTCGTACTCAGCCT +
Preference number: 4 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYAPAPV*GCRTQP
Trigger: AGGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGC...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTTTGAGTCCATCTACTaGGATGCTGATATGGTTATC +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWFESIY*DADMVI
Trigger: GATAACCATATCAGCATCTCAGTAGATGGACTCAAA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGAGAGGCCCATGGATATaGCCGTTCATTTTGTCATCA +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILRGPWI*PFILSS
Trigger: TGATGACAAAATGAACGGTCATATCCATGGGCCTCT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATGTATTAAGGGTACTGTaGTTTTCGTTGGCTATGCTG +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDVLRVL*FSLAML
Trigger: CAGCATAGCCAACGAAAATCACAGTACCCTTAATAC...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATTGCAACTGGTTCAGATaGGGTCCTTGTTTCTACCGG +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDCNWFR*GPCFYR
Trigger: CCGGTAGAAACAAGGACCTCATCTGAACCAGTTGCA...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGAGGTGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGTCTCATCCAACTGGGTaGCATATTCATCACATCTTG +
Preference number: 4 (lower is better)
Translates to: WRWDQGELLINSVGRKPLSHPTG*HIHHIL
Trigger: CAAGATGTGATGAATATGTCACCCAGTTGGATGAGA...CAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCACCTCCA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000552160.2
CDS-3UTR TCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAGAGGCAGCAGGCTGCTaGCAATCTGGTGGAGCCACG +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQEAAGC*QSGGAT
Trigger: CGTGGCTCCACCAGATTGTCAGCAGCCTGCTGCCTC...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR TCA 90 bp ATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGCACCGCCCGAGAAACTaGCGAGAAATGCAACATGGA +
Preference number: 4 (lower is better)
Translates to: MTKAKQNEDCLAFVKWDWHRPRN*REMQHG
Trigger: TCCATGTTGCATTTCTCGTCAGTTTCTCGGGCGGTG...CCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAGAAAGTGCGGCCGGATaGATGAGCAGCGCGATGCCC +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRESAAG*MSSAMP
Trigger: GGGCATCGCGCTGCTCATTCATCCGGCCGCACTTTC...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAGAAAGTGCGGCCGGATaGATGAGCAGCGCGATGCCC +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQESAAG*MSSAMP
Trigger: GGGCATCGCGCTGCTCATTCATCCGGCCGCACTTTC...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGGTCAAATGGGATTGGTaGGGAGTTCCCTCTCTCACC +
Preference number: 4 (lower is better)
Translates to: MTKAKQNEDCLAFVKWDWVKWDW*GVPSLT
Trigger: GGTGAGAGAGGGAACTCCTCACCAATCCCATTTGAC...CCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATAGCCTCGCTCCGAGGTaGAATCAAGGCAGTGGGATC +
Preference number: 4 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYSLAPR*NQGSGI
Trigger: GATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCT...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp TTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCTGAGACTTGATGACGGCAACTCACCTCTTTaGGCTGCTCCAGCTCCTGTT +
Preference number: 4 (lower is better)
Translates to: FIHSNPLECRLRVLRLDDGNSPL*AAPAPV
Trigger: AACAGGAGCTGGAGCAGCTCAAAGAGGTGAGTTGCC...GTCATCAAGTCTCAGCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR TCA 90 bp CATTCCCTGAATATATTATTCTATTTTGTCACTCCAAAGCCTCTCTACCTACTGACATCCCCAGGAGGCTaGGTCTTCTGGAAGGCAGGG +
Preference number: 4 (lower is better)
Translates to: HSLNILFYFVTPKPLYLLTSPGG*VFWKAG
Trigger: CCCTGCCTTCCAGAAGACTCAGCCTCCTGGGGATGT...CAGTAGGTAGAGAGGCTTTGGAGTGACAAAATAGAATAATATATTCAGGGAATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR TCA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCACAAATACGTGGTGCTTaGGAAAGGGGGAAAAATAAA +
Preference number: 4 (lower is better)
Translates to: RLPDKDKESGLGAIVWAAQIRGA*ERGKNK
Trigger: TTTATTTTTCCCCCTTTCTCAAGCACCACGTATTTG...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTACCAAACAAAACCGATaGGACGATCTACGAACATGT +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGTKQNR*DDLRTC
Trigger: ACATGTTCGTAGATCGTCTCATCGGTTTTGTTTGGT...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAATGCCTCTTTGAGCTaGTCCAGCTCCTGTTTGAGG +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPNASLS*SSSCLR
Trigger: CCTCAAACAGGAGCTGGAGCAGCTCAAAGAGGCATT...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTTCTCCTTCAGATCCTaGACGACTGCGGTGAGCCTC +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYFSFRS*TTAVSL
Trigger: GAGGCTCACCGCAGTCGTGCAGGATCTGAAGGAGAA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAGTCCTGAAGGAGCCGTaGCTCCCGGAACTTATATTC +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTVLKEP*LPELIF
Trigger: GAATATAAGTTCCGGGAGGCACGGCTCCTTCAGGAC...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTATTCAACCTGGTTCTaGTTCAACGTGGACACTAGT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVYSTWF*FNVDTS
Trigger: ACTAGTGTCCACGTTGAAGCAGAACCAGGTTGAATA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTTTTCCCGCTCTACCTaGATAAGCTGCTGCTTCAAC +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSFSRST*ISCCFN
Trigger: GTTGAAGCAGCAGCTTATGCAGGTAGAGCGGGAAAA...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAGCTCCTTGCTGCTTTaGAGGCCCCTCATGGCATTG +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFSSLLL*RPLMAL
Trigger: CAATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTCAAGGCTTGTCACCTaGTCATCATACATCTGGATT +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGSRLVT*SSYIWI
Trigger: AATCCAGATGTATGATGAGCAGGTGACAAGCCTTGA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTTGGACTTGGTTCTTTaGTGGCCTCTGTGCTTTCTT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTLDLVL*WPLCFL
Trigger: AAGAAAGCACAGAGGCCAGCAAAGAACCAAGTCCAA...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTACAGCTTTCTGCAGATaGTTGATTTGGTCCCGGATT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTTAFCR*LIWSRI
Trigger: AATCCGGGACCAAATCAAGCATCTGCAGAAAGCTGT...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGCGGTCCACAGCTTTCTaGAGATGCTTGATTTGGTCC +
Preference number: 4 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLRSTAF*RCLIWS
Trigger: GGACCAAATCAAGCATCTGCAGAAAGCTGTGGACCG...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTCTGCTCCCGTTTGGTaGTCAGCAGGGACTTTAGCT +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVSAPVW*SAGTLA
Trigger: AGCTAAAGTCCCTGCTGAGCACCAAACGGGAGCAGA...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTCTCAATGTGGCGATCTaGTCCCGTTTGGTGCTCAGC +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSLNVAI*SRLVLS
Trigger: GCTGAGCACCAAACGGGAGCAGATCGCCACATTGAG...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCATTGCTGCGTCGGGACTaGTCATGGTCAAACTCTAAG +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPLLRRD*SWSNSK
Trigger: CTTAGAGTTTGACCATGAGCAGTCCCGACGCAGCAA...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACACAAGTTTGCCTTTGCTaGGTCGGGACTGCTCATGGT +
Preference number: 4 (lower is better)
Translates to: YPCPVKEKLINSTISKGTQVCLC*VGTAHG
Trigger: ACCATGAGCAGTCCCGACGCAGCAAAGGCAAACTTG...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGCAAGTTTGCCTTTGCTaGGTCGGGACTGCTCATGGT +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMQVCLC*VGTAHG
Trigger: ACCATGAGCAGTCCCGACGCAGCAAAGGCAAACTTG...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTCCTTGCTGAGCCGGTaGCCTTGGATGAATTCACTC +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLSLLSR*PWMNSL
Trigger: GAGTGAATTCATCCAAGGGCACCGGCTCAGCAAGGA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR GCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTCACATCAGGGTCTGTaGTTCGTGTTCTTCTCAACT +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSSHQGL*FVFFST
Trigger: AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp TCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCAAACGGAAAAGAAAGTaGGGCCGGATGAATGAGCAG +
Preference number: 4 (lower is better)
Translates to: SSGTNLITFVDYEIVAETKRKRK*GRMNEQ
Trigger: CTGCTCATTCATCCGGCCGCACTTTCTTTTCCGTTT...GGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGACAAAACGTCCTGGTTaGTTTGGTAATAGCGACCAC +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILTKRPG*FGNSDH
Trigger: GTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGATGCAAATACAACATTaGCGACTGGCAATACTGCCC +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILMQIQH*RLAILP
Trigger: GGGCAGTATTGCCAGTCGGCAATGTTGTATTTGCAT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTTCTTAGCACTGGAGTaGCTTTTCCAACCATTGAGT +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGFLALE*LFQPLS
Trigger: ACTCAATGGTTGGAAAAGGCACTCCAGTGCTAAGAA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGCAACCTTCCGGTGGATaGAGAAGGACTGCCCAAATG +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMQPSGG*RRTAQM
Trigger: CATTTGGGCAGTCCTTCTCCATCCACCGGAAGGTTG...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCTCTTTCAATCGGATaGCATCTTCCAGCTGGCTGT +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRSLSIG*HLPAGC
Trigger: ACAGCCAGCTGGAAGATGCCATCCGATTGAAAGAGA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTTTGTCATCATTGTTTaGTTCACTCCCATCCTCGGC +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILFVIIV*FTPILG
Trigger: GCCGAGGATGGGAGTGAACCAAACAATGATGACAAA...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGGTGACTCCTGTAGGTTaGCCAAAAGAATGGCCTTTT +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILVTPVG*PKEWPF
Trigger: AAAAGGCCATTCTTTTGGCCAACCTACAGGAGTCAC...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCACACCGCCCTCAATGTaGCGATCTGCTCCCGTTTGG +
Preference number: 4 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSTPPSM*RSAPVW
Trigger: CCAAACGGGAGCAGATCGCCACATTGAGGGCGGTGT...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACACACCCGCTGGATCTTaGGCAGTATCCTGTGTGTGG +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYTPAGS*AVSCVW
Trigger: CCACACACAGGATACTGCCCAAGATCCAGCGGGTGT...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCGTGAAATCAAGGCAGTaGGATCACCCAGCAAAGTTG +
Preference number: 4 (lower is better)
Translates to: SSGTNLITFVDYEIVAETVKSRQ*DHPAKL
Trigger: CAACTTTGCTGGGTGATCCCACTGCCTTGATTTCAC...GGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAGCAGAATGAAGATCATAAGACTTGGACATaGCCCAGCCTCGCTCCGAGG +
Preference number: 4 (lower is better)
Translates to: FFFCSPMTRMTKAKQNEDHKTWT*PSLAPR
Trigger: CCTCGGAGCGAGGCTGGGCCATGTCCAAGTCTTATG...ATCTTCATTCTGCTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TGGAGGTGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGTACAAGTGGTTTCTCTaGGCAATATTCCCATGCCAA +
Preference number: 4 (lower is better)
Translates to: WRWDQGELLINSVGRKPLYKWFL*AIFPCQ
Trigger: TTGGCATGGGAATATTGCCCAGAGAAACCACTTGTA...CAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCACCTCCA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp TCACTCCAAAGCCTCTCTACCTACTGTTCTGTCTGGAATTACTTCCTCCTCCTCACCTACTGTTCTGTCTaGAATTACTTCCTCCTCCTC +
Preference number: 4 (lower is better)
Translates to: SLQSLSTYCSVWNYFLLLTYCSV*NYFLLL
Trigger: GAGGAGGAGGAAGTAATTCCAGACAGAACAGTAGGT...GAGGAGGAGGAAGTAATTCCAGACAGAACAGTAGGTAGAGAGGCTTTGGAGTGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTTAGGCTGCTATGGTTaGGAACTTCATGTCGAATCG +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFLGCYG*ELHVES
Trigger: CGATTCGACATGAAGTTCCCAACCATAGCAGCCTAA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTAAGGTTAGGCTGCTATaGTTGGGAACTTCATGTCGA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTKVRLL*LGTSCR
Trigger: TCGACATGAAGTTCCCAACCATAGCAGCCTAACCTT...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAATACAACATTGCCGACTaGCAATACTGCCCCGTCATC +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKYNIAD*QYCPVI
Trigger: GATGACGGGGCAGTATTGCCAGTCGGCAATGTTGTA...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CAA 72 bp ACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTaGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCA +
Preference number: 4 (lower is better)
Translates to: TSNNREENTRWI*GSILCVATKLP
Trigger: TGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTTTGAGTCCATCTACTaGGATGCTGATATGGTTATC +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGFESIY*DADMVI
Trigger: GATAACCATATCAGCATCTCAGTAGATGGACTCAAA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCATCCTCGGCAAATTTaGGTCCATCTACTGAGATGC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDHPRQI*VHLLRC
Trigger: GCATCTCAGTAGATGGACTCAAATTTGCCGAGGATG...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAGAGCTAACTCCTCACTaGATGTCACTAACTCATCCT +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRELTPH*MSLTHP
Trigger: AGGATGAGTTAGTGACATTCAGTGAGGAGTTAGCTC...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGAGCTAACTCCTCACTaGATGTCACTAACTCATCCT +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSELTPH*MSLTHP
Trigger: AGGATGAGTTAGTGACATTCAGTGAGGAGTTAGCTC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATATCCAATACTGGAGATaGCGGTGGGGCAGTAATAAC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDIQYWR*RWGSNN
Trigger: GTTATTACTGCCCCACCGTCATCTCCAGTATTGGAT...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAGCAGGGACTTTAGCTTaGGGATCTCTTCCATTAAGG +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKAGTLA*GSLPLR
Trigger: CCTTAATGGAAGAGATCCTCAAGCTAAAGTCCCTGC...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTCTCATCCAACTGGGTaGCATATTCATCACATCTTG +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSSHPTG*HIHHIL
Trigger: CAAGATGTGATGAATATGTCACCCAGTTGGATGAGA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000552160.2
CDS-3UTR TCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCGTCCTGGGACGGCTCTaGTCACAAAGGGAAGGTGAA +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLVLGRL*SQREGE
Trigger: TTCACCTTCCCTTTGTGATCAGAGCCGTCCCAGGAC...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR TCA 90 bp GCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCTGGGTTTACACAGTCTAAATCCTaGAATTGTGGGTCCTCAGGC +
Preference number: 4 (lower is better)
Translates to: AQTSSLLWTTKLSLKPGFTQSKS*NCGSSG
Trigger: GCCTGAGGACCCACAATTTCAGGATTTAGACTGTGT...AAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATACACAGTCTAAATCCTaGAATTGTGGGTCCTCAGGC +
Preference number: 4 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNTQSKS*NCGSSG
Trigger: GCCTGAGGACCCACAATTTCAGGATTTAGACTGTGT...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp GCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCTGGGTTTCAGAAGAGCCTCATTTaGAATGCAACACTACCCACG +
Preference number: 4 (lower is better)
Translates to: AQTSSLLWTTKLSLKPGFQKSLI*NATLPT
Trigger: CGTGGGTAGTGTTGCATTTCAAATGAGGCTCTTCTG...AAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp GTAGAACACAGCTTCATTCTTAATATCCACCTTTATCTACCAATTCTCAGGTTGGGTGGGCACGGTGACTaGTGCCTCCCCACTTACTTT +
Preference number: 4 (lower is better)
Translates to: VEHSFILNIHLYLPILRLGGHGD*CLPTYF
Trigger: AAAGTAAGTGGGGAGGCATCAGTCACCGTGCCCACC...CAACCTGAGAATTGGTAGATAAAGGTGGATATTAAGAATGAAGCTGTGTTCTAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTCTGAGTGCCACTGCTaGCCCGAATGTTGGGTGTCT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTSECHC*PECWVS
Trigger: AGACACCCAACATTCGGGTCAGCAGTGGCACTCAGA...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGTAAAGCCAGCCATCTaGGACACGTTTTCTGTTTCT +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSVKPAI*DTFSVS
Trigger: AGAAACAGAAAACGTGTCTCAGATGGCTGGCTTTAC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAACCAGAGTTGGATATATaGATGGGATCTAATGGATTA +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQPELDI*MGSNGL
Trigger: TAATCCATTAGATCCCATTCATATATCCAACTCTGG...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGATGAGCTCCCAGAACTaGAATGCATTCTCCTATCTT +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILMSSQN*NAFSYL
Trigger: AAGATAGGAGAATGCATTTCAGTTCTGGGAGCTCAT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAACATACCTTCTATTTCTaGAGTATTCCTGAGGACATT +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQHTFYF*SIPEDI
Trigger: AATGTCCTCAGGAATACTTCAGAAATAGAAGGTATG...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGACTCGGGAGCTAGATTaGTCTTGTAGTTCCATAGAA +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILTRELD*SCSSIE
Trigger: TTCTATGGAACTACAAGATCAATCTAGCTCCCGAGT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTGCCTTTTCCAACCATTaGGTGCATGATCAGATTACA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTAFSNH*VHDQIT
Trigger: TGTAATCTGATCATGCACTCAATGGTTGGAAAAGGC...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCCAGTTCATCATACTaGTGTTTGAGGGTCAGCTTC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRSSSSY*CLRVSF
Trigger: GAAGCTGACCCTCAAACAGCAGTATGATGAACTGGA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTGGATGGAGAAGGACTaGCCAAATGCCTCTTTGAGC +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVWMEKD*PNASLS
Trigger: GCTCAAAGAGGCATTTGGGCAGTCCTTCTCCATCCA...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTTCGATGCTGACTCCTaGAGAAGCGTTTCCTCCCGA +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYFDADS*RSVSSR
Trigger: TCGGGAGGAAACGCTTCTGCAGGAGTCAGCATCGAA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTCAGATCCTGCACGACTaGGGTGAGCCTCTCGTTTTC +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLQILHD*GEPLVF
Trigger: GAAAACGAGAGGCTCACCGCAGTCGTGCAGGATCTG...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTCTCCTTCAGATCCTaGACGACTGCGGTGAGCCTC +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLFSFRS*TTAVSL
Trigger: GAGGCTCACCGCAGTCGTGCAGGATCTGAAGGAGAA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCGCTTCTTCCAGTTGGTaGTCAGCAATCTCTTTCAAT +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFASSSW*SAISFN
Trigger: ATTGAAAGAGATTGCTGAGCACCAACTGGAAGAAGC...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATACCTGCATAAGCTGCTaGTTCAACTTCTGTATTTCT +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDTCISC*FNFCIS
Trigger: AGAAATACAGAAGTTGAAGCAGCAGCTTATGCAGGT...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TGGAGGTGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGTCTACCTGCATAAGCTaGTGCTTCAACTTCTGTATT +
Preference number: 4 (lower is better)
Translates to: WRWDQGELLINSVGRKPLSTCIS*CFNFCI
Trigger: AATACAGAAGTTGAAGCAGCAGCTTATGCAGGTAGA...CAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCACCTCCA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR GCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAATGCTGCTCCGTCAGTaGCCCCTTGGTGTGTTCCAG +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVMLLRQ*PLGVFQ
Trigger: CTGGAACACACCAAGGGGGCACTGACGGAGCAGCAT...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCAAGGCTTGTCACCTaGTCATCATACATCTGGATT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTSRLVT*SSYIWI
Trigger: AATCCAGATGTATGATGAGCAGGTGACAAGCCTTGA...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCCGGTCCACAGCTTTCTaGAGATGCTTGATTTGGTCC +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVRSTAF*RCLIWS
Trigger: GGACCAAATCAAGCATCTGCAGAAAGCTGTGGACCG...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTTCATCACATCTTGTTaGAAACATTGCTCTCAGGGA +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDFITSC*KHCSQG
Trigger: TCCCTGAGAGCAATGTTTGCAACAAGATGTGATGAA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGCTGCTAACTGTCTCTaGATCTCATCCAACTGGGTG +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVAANCL*ISSNWV
Trigger: CACCCAGTTGGATGAGATGCAGAGACAGTTAGCAGC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAGCTGCTAACTGTCTCTaGATCTCATCCAACTGGGTG +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTAANCL*ISSNWV
Trigger: CACCCAGTTGGATGAGATGCAGAGACAGTTAGCAGC...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGGTCAGGGCGAGTTTTTaGTGGATAGCCATTCGTAAC +
Preference number: 4 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLVRASF*WIAIRN
Trigger: GTTACGAATGGCTATCCAGCAAAAACTCGCCCTGAC...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CCACACAGTCTAAATCCTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTGAAACTGACGAGAAATaGAACATGGAGAACAGGGCA +
Preference number: 4 (lower is better)
Translates to: PHSLNPEIVGPQAQTSSLETDEK*NMENRA
Trigger: TGCCCTGTTCTCCATGTTGCATTTCTCGTCAGTTTC...AAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAGGATTTAGACTGTGTGG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCATGAAGATCGCTGCATaGATACCTTTTCCTCTGAGT +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSMKIAA*IPFPLS
Trigger: ACTCAGAGGAAAAGGTATGCATGCAGCGATCTTCAT...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAACCACTCCATTTCTGTaGCACCCATGTCCGCTCAAT +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTTTPFL*HPCPLN
Trigger: ATTGAGCGGACATGGGTGGCACAGAAATGGAGTGGT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCCCCCACTAAGGGATTaGATACCTTCTATTTCTGAA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTPPLRD*IPSISE
Trigger: TTCAGAAATAGAAGGTATGCAATCCCTTAGTGGGGG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGCATTGCATATTTCTATaGACTCTCGCCCTTACACTA +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVHCIFL*TLALTL
Trigger: TAGTGTAAGGGCGAGAGTGCATAGAAATATGCAATG...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCAGCAACCTTCCGGTaGATGGAGAAGGACTGCCCA +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLSATFR*MEKDCP
Trigger: TGGGCAGTCCTTCTCCATCCACCGGAAGGTTGCTGA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCAGCAACCTTCCGGTaGATGGAGAAGGACTGCCCA +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLSATFR*MEKDCP
Trigger: TGGGCAGTCCTTCTCCATCCACCGGAAGGTTGCTGA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTGGTTCTGCTTCAACGTaGACACTAGTTTCTGCAATG +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSGSAST*TLVSAM
Trigger: CATTGCAGAAACTAGTGTCCACGTTGAAGCAGAACC...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCATGGCATCTTCCAGCTaGCTGTTCAGCAGTACCGTC +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFMASSS*LFSSTV
Trigger: GACGGTACTGCTGAACAGCCAGCTGGAAGATGCCAT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAACTGAGATGCTGATATaGTTATCATTGAGGCTGATA +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQTEMLI*LSLRLI
Trigger: TATCAGCCTCAATGATAACCATATCAGCATCTCAGT...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGGTTGGCCAAAAGAATaGCCTTTTCCCGCTCTACCT +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVGWPKE*PFPALP
Trigger: AGGTAGAGCGGGAAAAGGCCATTCTTTTGGCCAACC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTACCGTCAGTGCCCCCTTaGTGTGTTCCAGCTGTGTCT +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVPSVPP*CVPAVS
Trigger: AGACACAGCTGGAACACACCAAGGGGGCACTGACGG...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTGGGACAAAAGTCCTCTaGGATCATCGGGCCCTTTCA +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSGTKVL*DHRALS
Trigger: TGAAAGGGCCCGATGATCCCAGAGGACTTTTGTCCC...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCATGACACACCCCGCCTaGCTAATCGTGGGGACAAAA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFMTHPA*LIVGTK
Trigger: TTTTGTCCCCACGATTAGCCAGGCGGGGTGTGTCAT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTGTCTTTATCAATCATaGGGGCTAGCTCCCGAGCCG +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSCLYQS*GLAPEP
Trigger: CGGCTCGGGAGCTAGCCCCCATGATTGATAAAGACA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGCAGTATCCTGTGTGTaGCTACAAAACTTCCACCCC +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMAVSCV*LQNFHP
Trigger: GGGGTGGAAGTTTTGTAGCCACACACAGGATACTGC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTGAAGAAAACACCCGCTaGATCTTGGGCAGTATCCTG +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLEENTR*ILGSIL
Trigger: CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTC...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGAAGAAAACACCCGCTaGATCTTGGGCAGTATCCTG +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVEENTR*ILGSIL
Trigger: CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATAAAGGGAGAAGGAAATaGGAAGGGATGGGTGGAAAC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDKGRRK*EGMGGN
Trigger: GTTTCCACCCATCCCTTCCCATTTCCTTCTCCCTTT...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATTCAGGTCCAAATACGTaGTGCTTGAGAAAGGGGGAA +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDSGPNT*CLRKGE
Trigger: TTCCCCCTTTCTCAAGCACCACGTATTTGGACCTGA...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATACCACAGTTCCTTACTaGAAATCCATCAGCTTCCCC +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDTTVPY*KSISFP
Trigger: GGGGAAGCTGATGGATTTCCAGTAAGGAACTGTGGT...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAACCACAGTTCCTTACTaGAAATCCATCAGCTTCCCC +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKTTVPY*KSISFP
Trigger: GGGGAAGCTGATGGATTTCCAGTAAGGAACTGTGGT...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTGTACAAATCAGAGTTaGCCACACAATACACATGTT +
Preference number: 4 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWCTNQS*PHNTHV
Trigger: AACATGTGTATTGTGTGGCCAACTCTGATTTGTACA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CAA 72 bp CTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATaGCCTCCCAAATTCCAGCTTATATATTCATTTCTT +
Preference number: 4 (lower is better)
Translates to: LTNLPPPQAKQP*PPKFQLIYSFL
Trigger: AAGAAATGAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR CAA 72 bp CAGGCACAAACCTCATCACTTTTGTGGACTACGAAATaGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTT +
Preference number: 4 (lower is better)
Translates to: QAQTSSLLWTTK*SLKPGFEITAV
Trigger: AACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR CAA 72 bp GAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTaGTGGACTACGAAATTGTCGCTGAAACCTGGGTTT +
Preference number: 4 (lower is better)
Translates to: EIVGPQAQTSSL*WTTKLSLKPGF
Trigger: AAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
3UTR CAA 72 bp GAGGTGAAATCAAGGCAGTGGGATCACCCAGCAAAGTaGTTTTTCTTCTGCAGCCCAATGACAAGAATGACT +
Preference number: 4 (lower is better)
Translates to: EVKSRQWDHPAK*FFFCSPMTRMT
Trigger: AGTCATTCTTGTCATTGGGCTGCAGAAGAAAAACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTTTGAGTCCATCTACTaGGATGCTGATATGGTTATC +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTFESIY*DADMVI
Trigger: GATAACCATATCAGCATCTCAGTAGATGGACTCAAA...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAGAGGCCCATGGATATaGCCGTTCATTTTGTCATCA +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPRGPWI*PFILSS
Trigger: TGATGACAAAATGAACGGTCATATCCATGGGCCTCT...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTAAATGTTCAGCTCACTaGATAAGTCAGAGACAGGGT +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSKCSAH*ISQRQG
Trigger: ACCCTGTCTCTGACTTATTCAGTGAGCTGAACATTT...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGGATCTCTAAACCATTaGTGTCCACCTCATAGTCAT +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSGSLNH*CPPHSH
Trigger: ATGACTATGAGGTGGACATCAATGGTTTAGAGATCC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATGTCCTGGGACGGCTCTaGTCACAAAGGGAAGGTGAA +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYVLGRL*SQREGE
Trigger: TTCACCTTCCCTTTGTGATCAGAGCCGTCCCAGGAC...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGATTCGTCCACAGGAGATaGAGACTAGGGGTGAGGAGG +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGFVHRR*RLGVRR
Trigger: CCTCCTCACCCCTAGTCTTCATCTCCTGTGGACGAA...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCACCGCCCGAGAAACTaGCGAGAAATGCAACATGGA +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFHRPRN*REMQHG
Trigger: TCCATGTTGCATTTCTCGTCAGTTTCTCGGGCGGTG...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR TCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATTCTGAGTGCCACTGCTaGCCCGAATGTTGGGTGTCT +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYSECHC*PECWVS
Trigger: AGACACCCAACATTCGGGTCAGCAGTGGCACTCAGA...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATGAGTGTGAGGAAAGATaGTACTGCAATATACGTATT +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDECEER*YCNIRI
Trigger: AATACGTATATTGCAGTATCATCTTTCCTCACACTC...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATTTGTGCAAGAAAAATaGCCACAGTCTGGCCAATTC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRFVQEK*PQSGQF
Trigger: GAATTGGCCAGACTGTGGTCATTTTTCTTGCACAAA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTGGGATAAAAATACACTaGGGATTAGAGCCATGCAGT +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSGIKIH*GLEPCS
Trigger: ACTGCATGGCTCTAATCCTCAGTGTATTTTTATCCC...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTCCAGTTCATCATACTaGTGTTTGAGGGTCAGCTTC +
Preference number: 4 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNSSSSY*CLRVSF
Trigger: GAAGCTGACCCTCAAACAGCAGTATGATGAACTGGA...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTTCGATGCTGACTCCTaGAGAAGCGTTTCCTCCCGA +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFFDADS*RSVSSR
Trigger: TCGGGAGGAAACGCTTCTGCAGGAGTCAGCATCGAA...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTACAGATCCTGCACGACTaGGGTGAGCCTCTCGTTTTC +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVQILHD*GEPLVF
Trigger: GAAAACGAGAGGCTCACCGCAGTCGTGCAGGATCTG...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCGTCCTGAAGGAGCCGTaGCTCCCGGAACTTATATTC +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLVLKEP*LPELIF
Trigger: GAATATAAGTTCCGGGAGGCACGGCTCCTTCAGGAC...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAGTGGACACTAGTTTCTaGAATGTGATATTTTCTTCT +
Preference number: 4 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQVDTSF*NVIFSS
Trigger: AGAAGAAAATATCACATTGCAGAAACTAGTGTCCAC...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAGCTTCTTCCAGTTGGTaGTCAGCAATCTCTTTCAAT +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRASSSW*SAISFN
Trigger: ATTGAAAGAGATTGCTGAGCACCAACTGGAAGAAGC...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTGCTTCTTCCAGTTGGTaGTCAGCAATCTCTTTCAAT +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSASSSW*SAISFN
Trigger: ATTGAAAGAGATTGCTGAGCACCAACTGGAAGAAGC...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAATGCTGCTCCGTCAGTaGCCCCTTGGTGTGTTCCAG +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRMLLRQ*PLGVFQ
Trigger: CTGGAACACACCAAGGGGGCACTGACGGAGCAGCAT...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGACTGCCACCCTGTATTTaGATTCAAGGATCTCTAAAC +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRLPPCI*IQGSLN
Trigger: GTTTAGAGATCCTTGAATGCAAATACAGGGTGGCAG...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTAATCACCTCAGTTACTaGCACCCTGTATTTGCATTC +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSNHLSY*HPVFAF
Trigger: GAATGCAAATACAGGGTGGCAGTAACTGAGGTGATT...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCAATCACCTCAGTTACTaGCACCCTGTATTTGCATTC +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSNHLSY*HPVFAF
Trigger: GAATGCAAATACAGGGTGGCAGTAACTGAGGTGATT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTGATTTTCGTTGGCTATaGTGGTCATCTTTTGCAACT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTDFRWL*WSSFAT
Trigger: AGTTGCAAAAGATGACCAGCATAGCCAACGAAAATC...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATTTGGACTTGGTTCTTTaGTGGCCTCTGTGCTTTCTT +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDLDLVL*WPLCFL
Trigger: AAGAAAGCACAGAGGCCAGCAAAGAACCAAGTCCAA...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACAGCTTTCTGCAGATaGTTGATTTGGTCCCGGATT +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKTAFCR*LIWSRI
Trigger: AATCCGGGACCAAATCAAGCATCTGCAGAAAGCTGT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCTGCTCCCGTTTGGTaGTCAGCAGGGACTTTAGCT +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLSAPVW*SAGTLA
Trigger: AGCTAAAGTCCCTGCTGAGCACCAAACGGGAGCAGA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGACTCAATGTGGCGATCTaGTCCCGTTTGGTGCTCAGC +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGLNVAI*SRLVLS
Trigger: GCTGAGCACCAAACGGGAGCAGATCGCCACATTGAG...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTGCTGCTAACTGTCTCTaGATCTCATCCAACTGGGTG +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSAANCL*ISSNWV
Trigger: CACCCAGTTGGATGAGATGCAGAGACAGTTAGCAGC...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACAGTCAGGGCGAGTTTTTaGTGGATAGCCATTCGTAAC +
Preference number: 4 (lower is better)
Translates to: YPCPVKEKLINSTISKGTVRASF*WIAIRN
Trigger: GTTACGAATGGCTATCCAGCAAAAACTCGCCCTGAC...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCTTCCAAGTTTGCCTTTaGTGCGTCGGGACTGCTCAT +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFFQVCL*CVGTAH
Trigger: ATGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAA...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTGCTCTTTCCAAGTTTaGCTTTGCTGCGTCGGGACT +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYCSFQV*LCCVGT
Trigger: AGTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CCAAATTCCAGCTTATATATTCATTTCTTAGGCAATTTTTCTCTTGGGGGAGGAAGGGGCTCCGGATTCTaGTTATTCAGAGACGCCCGT +
Preference number: 4 (lower is better)
Translates to: PNSSLYIHFLGNFSLGGGRGSGF*LFRDAR
Trigger: ACGGGCGTCTCTGAATAAGCAGAATCCGGAGCCCCT...TCCTCCCCCAAGAGAAAAATTGCCTAAGAAATGAATATATAAGCTGGAATTTGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp ATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCCTGAAATTGTGGGTCCTGAGCCTCATTTGAAATaGAACACTACCCACGTATTT +
Preference number: 4 (lower is better)
Translates to: IQRKAEVPHSLNPEIVGPEPHLK*NTTHVF
Trigger: AAATACGTGGGTAGTGTTGCATTTCAAATGAGGCTC...AGGACCCACAATTTCAGGATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCACATATTCATATCCTTaGCCCGTTAAAGAGAAGCTG +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSTYSYP*PVKEKL
Trigger: CAGCTTCTCTTTAACGGGGCAAGGATATGAATATGT...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp TGGAGGTGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGTCAAGAAAAGGACTGTaGGTATTCCATCCCATTTTA +
Preference number: 4 (lower is better)
Translates to: WRWDQGELLINSVGRKPLSRKGL*VFHPIL
Trigger: TAAAATGGGATGGAATACGCACAGTCCTTTTCTTGA...CAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCACCTCCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTGATCTCCTTTCTCAGTaGCCTACACTGGTAACTGTC +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLDLLSQ*PTLVTV
Trigger: GACAGTTACCAGTGTAGGGCACTGAGAAAGGAGATC...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACAAAACGTCCTGGTTaGTTTGGTAATAGCGACCAC +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKTKRPG*FGNSDH
Trigger: GTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTCTCTTTACTCCACGTTaGATAATAAATGACACTGTG +
Preference number: 4 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGLFTPR*IINDTV
Trigger: CACAGTGTCATTTATTATGCAACGTGGAGTAAAGAG...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAGGTCCAAATACGTGGTaGTTGAGAAAGGGGGAAAAA +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKGPNTW*LRKGEK
Trigger: TTTTTCCCCCTTTCTCAAGCACCACGTATTTGGACC...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAACCTTCGTATTCAACCTaGTTCTGCTTCAACGTGGAC +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQPSYST*FCFNVD
Trigger: GTCCACGTTGAAGCAGAACCAGGTTGAATACGAAGG...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAAGGGCTTCTTCCAGTTaGTGCTCAGCAATCTCTTTC +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTRASSS*CSAISF
Trigger: GAAAGAGATTGCTGAGCACCAACTGGAAGAAGCCCT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATACTGAGATGCTGATATaGTTATCATTGAGGCTGATA +
Preference number: 4 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDTEMLI*LSLRLI
Trigger: TATCAGCCTCAATGATAACCATATCAGCATCTCAGT...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGACTGAGATGCTGATATaGTTATCATTGAGGCTGATA +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVTEMLI*LSLRLI
Trigger: TATCAGCCTCAATGATAACCATATCAGCATCTCAGT...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAATTTGTCATCATTGTTTaGTTCACTCCCATCCTCGGC +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKFVIIV*FTPILG
Trigger: GCCGAGGATGGGAGTGAACCAAACAATGATGACAAA...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAACTCCTTTCCTTAAGGTaGGAGTCCGATAGTCTCCAT +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQLLSLR*ESDSLH
Trigger: ATGGAGACTATCGGACTCCCACCTTAAGGAAAGGAG...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCCACCACTCTCCTTGGTaGTCTTCTCAAGGCTTGTCA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFHHSPW*SSQGLS
Trigger: TGACAAGCCTTGAGAAGACCACCAAGGAGAGTGGTG...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTACTGTGATTTTCGTTaGCTATGCTGGTCATCTTTT +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVYCDFR*LCWSSF
Trigger: AAAAGATGACCAGCATAGCCAACGAAAATCACAGTA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTGTTGTAGATATTCATTaGCTCTTTGCGGATGTCACT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTVVDIH*LFADVT
Trigger: AGTGACATCCGCAAAGAGCCAATGAATATCTACAAC...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGTCTTTATCAATCATaGGGGCTAGCTCCCGAGCCG +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLCLYQS*GLAPEP
Trigger: CGGCTCGGGAGCTAGCCCCCATGATTGATAAAGACA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTGCATCTCATCCAACTaGGTGACATATTCATCACAT +
Preference number: 4 (lower is better)
Translates to: WDQGELLINSVGRKPLKSCISSN*VTYSSH
Trigger: ATGTGATGAATATGTCACCCAGTTGGATGAGATGCA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000552160.2
CDS-3UTR CCA 90 bp GTAGAACACAGCTTCATTCTTAATATCCACCTTTATCTACCAATTCTCAGGTTGAAGTCCTCCAGCCTCTaGGTCAGGGCGAGTTTTTGC +
Preference number: 4 (lower is better)
Translates to: VEHSFILNIHLYLPILRLKSSSL*VRASFC
Trigger: GCAAAAACTCGCCCTGACCCAGAGGCTGGAGGACTT...CAACCTGAGAATTGGTAGATAAAGGTGGATATTAAGAATGAAGCTGTGTTCTAC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCGTCGGGACTGCTCATaGTCAAACTCTAAGTCCTCC +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTRRDCS*SNSKSS
Trigger: GGAGGACTTAGAGTTTGACCATGAGCAGTCCCGACG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCGTCGGGACTGCTCATaGTCAAACTCTAAGTCCTCC +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFRRDCS*SNSKSS
Trigger: GGAGGACTTAGAGTTTGACCATGAGCAGTCCCGACG...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACAATGATTCTGTGGAGGTaGGATCAGGGGGAACTCTTA +
Preference number: 4 (lower is better)
Translates to: YPCPVKEKLINSTISKGTMILWR*DQGELL
Trigger: TAAGAGTTCCCCCTGATCCCACCTCCACAGAATCAT...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAATGGGAAGGGATGGGTaGAAACGGAAAAGAAAGTGC +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQMGRDG*KRKRKC
Trigger: GCACTTTCTTTTCCGTTTCCACCCATCCCTTCCCAT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCACTGTGCCTGCTTGTTaGCTTTCAACACCGCCCTCA +
Preference number: 4 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSTVPAC*LSTPPS
Trigger: TGAGGGCGGTGTTGAAAGCCAACAAGCAGGCACAGT...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTACAACATTGCCGACTaGCAATACTGCCCCGTCATC +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYYNIAD*QYCPVI
Trigger: GATGACGGGGCAGTATTGCCAGTCGGCAATGTTGTA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGATCTCTAAACCATTaGTGTCCACCTCATAGTCAT +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDGSLNH*CPPHSH
Trigger: ATGACTATGAGGTGGACATCAATGGTTTAGAGATCC...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCCTTTCTGCAGATGCTTaGTTTGGTCCCGGATTATGG +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFLSADA*FGPGLW
Trigger: CCATAATCCGGGACCAAATCAAGCATCTGCAGAAAG...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGCAGGGACTTTAGCTTaGGGATCTCTTCCATTAAGG +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFAGTLA*GSLPLR
Trigger: CCTTAATGGAAGAGATCCTCAAGCTAAAGTCCCTGC...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GATAACAGCGGTTTTGAGAAGTTTGATTTATACATTCCAACCCACTTGAATGTCCACCGCCCGAGAAACTaGCGAGAAATGCAACATGGA +
Preference number: 4 (lower is better)
Translates to: DNSGFEKFDLYIPTHLNVHRPRN*REMQHG
Trigger: TCCATGTTGCATTTCTCGTCAGTTTCTCGGGCGGTG...GACATTCAAGTGGGTTGGAATGTATAAATCAAACTTCTCAAAACCGCTGTTATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp GAGGAAACAATGGACTCTTTCAATCTTCTCTTACCAACAAAGGGCCCTAGAAGAGTCGTCTTAGAGTGCTaGGACTTGATGACTCTTACT +
Preference number: 4 (lower is better)
Translates to: EETMDSFNLLLPTKGPRRVVLEC*DLMTLT
Trigger: AGTAAGAGTCATCAAGTCTCAGCACTCTAAGACGAC...TCTTCTAGGGCCCTTTGTTGGTAAGAGAAGATTGAAAGAGTCCATTGTTTCCTC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR TCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATCATCCAGAGGAAAGCTaGGGTGCCACACAGTCTAAA +
Preference number: 4 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYHPEES*GATQSK
Trigger: TTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATG...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR TCA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTTCCCTTCAAGTTATTaGGCCTTCTTTAACGTTATC +
Preference number: 4 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFFPSSY*AFFNVI
Trigger: GATAACGTTAAAGAAGGCTCAATAACTTGAAGGGAA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTTCCCTTCAAGTTATTaGGCCTTCTTTAACGTTATC +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILFPSSY*AFFNVI
Trigger: GATAACGTTAAAGAAGGCTCAATAACTTGAAGGGAA...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAATGTTTGTAGGCACCTaGGTGTTTGTCAAAAGTAGA +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRMFVGT*VFVKSR
Trigger: TCTACTTTTGACAAACACTCAGGTGCCTACAAACAT...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCACAACGCCAGTGAAATaGAGACAATGTTTAGGAACA +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSTTPVK*RQCLGT
Trigger: TGTTCCTAAACATTGTCTTCATTTCACTGGCGTTGT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCGACAATACTTCCTGCTaGACTCCCAGTCCCACCAAA +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLDNTSC*TPSPTK
Trigger: TTTGGTGGGACTGGGAGTTCAGCAGGAAGTATTGTC...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCCAGAGTTGGATATATaGATGGGATCTAATGGATTA +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTPELDI*MGSNGL
Trigger: TAATCCATTAGATCCCATTCATATATCCAACTCTGG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAGTCCTGAAGGAGCCGTaGCTCCCGGAACTTATATTC +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGVLKEP*LPELIF
Trigger: GAATATAAGTTCCGGGAGGCACGGCTCCTTCAGGAC...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGAATCGCTTAATCTCATaGTTTAAGCCTTCGTATTCA +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVNRLIS*FKPSYS
Trigger: TGAATACGAAGGCTTAAAGCATGAGATTAAGCGATT...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAACTGCCACCCTGTATTTaGATTCAAGGATCTCTAAAC +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKLPPCI*IQGSLN
Trigger: GTTTAGAGATCCTTGAATGCAAATACAGGGTGGCAG...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACTGCCACCCTGTATTTaGATTCAAGGATCTCTAAAC +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKLPPCI*IQGSLN
Trigger: GTTTAGAGATCCTTGAATGCAAATACAGGGTGGCAG...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGATTGCTGCGTCGGGACTaGTCATGGTCAAACTCTAAG +
Preference number: 4 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGLLRRD*SWSNSK
Trigger: CTTAGAGTTTGACCATGAGCAGTCCCGACGCAGCAA...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGACAAGTTTGCCTTTGCTaGGTCGGGACTGCTCATGGT +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGQVCLC*VGTAHG
Trigger: ACCATGAGCAGTCCCGACGCAGCAAAGGCAAACTTG...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTAAACGGAAAAGAAAGTaGGGCCGGATGAATGAGCAG +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSKRKRK*GRMNEQ
Trigger: CTGCTCATTCATCCGGCCGCACTTTCTTTTCCGTTT...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CCACACAGTCTAAATCCTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTAAGCAGAATGAAGATTaGCTAGCCTTTGTCAAATGG +
Preference number: 4 (lower is better)
Translates to: PHSLNPEIVGPQAQTSSLKQNED*LAFVKW
Trigger: CCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTT...AAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAGGATTTAGACTGTGTGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp ATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATCCTGAAATTGTGGGTCCTAAGTTGTTTTTCTTCTaGAGCCCAATGACAAGAATG +
Preference number: 4 (lower is better)
Translates to: IQRKAEVPHSLNPEIVGPKLFFF*SPMTRM
Trigger: CATTCTTGTCATTGGGCTGCAGAAGAAAAACAACTT...AGGACCCACAATTTCAGGATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCAGAAGGCACTGTGCCTaGTTGTTGGCTTTCAACACC +
Preference number: 4 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSRRHCA*LLAFNT
Trigger: GGTGTTGAAAGCCAACAAGCAGGCACAGTGCCTTCT...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGAACTAACGAAAGCTCCTaGAATGTGCTTTACGACTTA +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRTNESS*NVLYDL
Trigger: TAAGTCGTAAAGCACATTGCAGGAGCTTTCGTTAGT...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAACCCCCACTAAGGGATTaGATACCTTCTATTTCTGAA +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKPPLRD*IPSISE
Trigger: TTCAGAAATAGAAGGTATGCAATCCCTTAGTGGGGG...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTTTCCAACCATTGAGTaGATGATCAGATTACACAAA +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVFPTIE*MIRLHK
Trigger: TTTGTGTAATCTGATCATGCACTCAATGGTTGGAAA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTACAACCTTCCGGTGGATaGAGAAGGACTGCCCAAATG +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVQPSGG*RRTAQM
Trigger: CATTTGGGCAGTCCTTCTCCATCCACCGGAAGGTTG...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAATGGCATCTTCCAGCTaGCTGTTCAGCAGTACCGTC +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVMASSS*LFSSTV
Trigger: GACGGTACTGCTGAACAGCCAGCTGGAAGATGCCAT...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGTGACTCCTGTAGGTTaGCCAAAAGAATGGCCTTTT +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVVTPVG*PKEWPF
Trigger: AAAAGGCCATTCTTTTGGCCAACCTACAGGAGTCAC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCATTTCGTTGGCTATGCTaGTCATCTTTTGCAACTCCT +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPFRWLC*SSFATP
Trigger: AGGAGTTGCAAAAGATGACCAGCATAGCCAACGAAA...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTACTGTGATTTTCGTTaGCTATGCTGGTCATCTTTT +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILYCDFR*LCWSSF
Trigger: AAAAGATGACCAGCATAGCCAACGAAAATCACAGTA...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTGGTCTTAGTTGGACTTaGTTCTTTGCTGGCCTCTGT +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSGLSWT*FFAGLC
Trigger: ACAGAGGCCAGCAAAGAACCAAGTCCAACTAAGACC...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAATGCAGATGCTTGATTTaGTCCCGGATTATGGCATTA +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKCRCLI*SRIMAL
Trigger: TAATGCCATAATCCGGGACCAAATCAAGCATCTGCA...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CATTCCCTGAATATATTATTCTATTTTGTCACTCCAAAGCCTCTCTACCTACTGTGTCTTTATCAATCATaGGGGCTAGCTCCCGAGCCG +
Preference number: 4 (lower is better)
Translates to: HSLNILFYFVTPKPLYLLCLYQS*GLAPEP
Trigger: CGGCTCGGGAGCTAGCCCCCATGATTGATAAAGACA...CAGTAGGTAGAGAGGCTTTGGAGTGACAAAATAGAATAATATATTCAGGGAATG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATAAGCCCCTGAAGTCCTaGGACGGCTCTGATCACAAA +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYKPLKS*DGSDHK
Trigger: TTTGTGATCAGAGCCGTCCCAGGACTTCAGGGGCTT...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp TTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCTGAGACTTGATGACATGGGAAGGGATGGGTaGAAACGGAAAAGAAAGTGC +
Preference number: 4 (lower is better)
Translates to: FIHSNPLECRLRVLRLDDMGRDG*KRKRKC
Trigger: GCACTTTCTTTTCCGTTTCCACCCATCCCTTCCCAT...GTCATCAAGTCTCAGCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTGGAAATGGGAAGGGATaGGTGGAAACGGAAAAGAAA +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLGNGKG*VETEKK
Trigger: TTTCTTTTCCGTTTCCACCCATCCCTTCCCATTTCC...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCTGAGACTTGATGACAAAGGGAGAAGGAAATaGGAAGGGATGGGTGGAAAC +
Preference number: 4 (lower is better)
Translates to: FIHSNPLECRLRVLRLDDKGRRK*EGMGGN
Trigger: GTTTCCACCCATCCCTTCCCATTTCCTTCTCCCTTT...GTCATCAAGTCTCAGCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAAAGGGAGAAGGAAATaGGAAGGGATGGGTGGAAAC +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFKGRRK*EGMGGN
Trigger: GTTTCCACCCATCCCTTCCCATTTCCTTCTCCCTTT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GAAGTCTTTTCCGCTCCTCTAGGAAACCTTAGTTGCTTCCTCTGCATTGTTCTCTACTTCCTCCTCCTCTaGAAAACAACTTCTTATCCT +
Preference number: 4 (lower is better)
Translates to: EVFSAPLGNLSCFLCIVLYFLLL*KTTSYP
Trigger: AGGATAAGAAGTTGTTTTCCAGAGGAGGAGGAAGTA...GAGAACAATGCAGAGGAAGCAACTAAGGTTTCCTAGAGGAGCGGAAAAGACTTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CCA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGACATTCTTAGGTTATTaGACCAATGTTTCATGCTTG +
Preference number: 4 (lower is better)
Translates to: SNNREENTRWILGSILCVTFLGY*TNVSCL
Trigger: CAAGCATGAAACATTGGTCCAATAACCTAAGAATGT...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAATCACAGGAATAATCTaGCTCAGCAGTTTATCCAGG +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKITGII*LSSLSR
Trigger: CCTGGATAAACTGCTGAGCCAGATTATTCCTGTGAT...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTGTACAAATCAGAGTTaGCCACACAATACACATGTT +
Preference number: 4 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTCTNQS*PHNTHV
Trigger: AACATGTGTATTGTGTGGCCAACTCTGATTTGTACA...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CAA 72 bp TACCTACCATATCAATGTATTTGTGGCAGCCTGAGTTaGAACCCACCACAGTTCCTTACTGGAAATCCATCA +
Preference number: 4 (lower is better)
Translates to: YLPYQCICGSLS*NPPQFLTGNPS
Trigger: TGATGGATTTCCAGTAAGGAACTGTGGTGGGTTCAAACTCAGGCTGCCACAAATACATTGATATGGTAGGTA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCATCCTCGGCAAATTTaGGTCCATCTACTGAGATGC +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTHPRQI*VHLLRC
Trigger: GCATCTCAGTAGATGGACTCAAATTTGCCGAGGATG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAGAGGCCCATGGATATaGCCGTTCATTTTGTCATCA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFRGPWI*PFILSS
Trigger: TGATGACAAAATGAACGGTCATATCCATGGGCCTCT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTATCCAATACTGGAGATaGCGGTGGGGCAGTAATAAC +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTIQYWR*RWGSNN
Trigger: GTTATTACTGCCCCACCGTCATCTCCAGTATTGGAT...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTACAGCATGTGTAACGTTGAACTGTAATTGTGTTTCTATCCTGACATCCCCAGCAGGGACTTTAGCTTaGGGATCTCTTCCATTAAGG +
Preference number: 4 (lower is better)
Translates to: ITACVTLNCNCVSILTSPAGTLA*GSLPLR
Trigger: CCTTAATGGAAGAGATCCTCAAGCTAAAGTCCCTGC...TGGGGATGTCAGGATAGAAACACAATTACAGTTCAACGTTACACATGCTGTAAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR TCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATCATTGCTCTCAGGGATaGGAAGGTTGCAGCATCTTC +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYHCSQG*EGCSIF
Trigger: GAAGATGCTGCAACCTTCTCATCCCTGAGAGCAATG...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTACATTGCTCTCAGGGATaGGAAGGTTGCAGCATCTTC +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVHCSQG*EGCSIF
Trigger: GAAGATGCTGCAACCTTCTCATCCCTGAGAGCAATG...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTCTCATCCAACTGGGTaGCATATTCATCACATCTTG +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLSHPTG*HIHHIL
Trigger: CAAGATGTGATGAATATGTCACCCAGTTGGATGAGA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATCACTGCACCGTACTATaGAGATCGCTGCATGCATAC +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYHCTVL*RSLHAY
Trigger: GTATGCATGCAGCGATCTTCATAGTACGGTGCAGTG...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGCTGAATTTGGAGTGTaGGGAAAGATGATACTGCAA +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMAEFGV*GKMILQ
Trigger: TTGCAGTATCATCTTTCCTCACACTCCAAATTCAGC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAGCTGAATTTGGAGTGTaGGGAAAGATGATACTGCAA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQAEFGV*GKMILQ
Trigger: TTGCAGTATCATCTTTCCTCACACTCCAAATTCAGC...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAATCAACTTCCCTAGCTaGATTTGGAGTGTGAGGAAA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQINFPS*IWSVRK
Trigger: TTTCCTCACACTCCAAATTCAGCTAGGGAAGTTGAT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACATTTGTGCAAGAAAAATaGCCACAGTCTGGCCAATTC +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTFVQEK*PQSGQF
Trigger: GAATTGGCCAGACTGTGGTCATTTTTCTTGCACAAA...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCCAGTTAATGAGCTACTaGTTAGAAAGTAAGTGCCTA +
Preference number: 4 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSQLMSY*LESKCL
Trigger: TAGGCACTTACTTTCTAATCAGTAGCTCATTAACTG...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATATGTTTGTAGGCACCTaGGTGTTTGTCAAAAGTAGA +
Preference number: 4 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDMFVGT*VFVKSR
Trigger: TCTACTTTTGACAAACACTCAGGTGCCTACAAACAT...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTACCAAACAAAACCGATaGGACGATCTACGAACATGT +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLTKQNR*DDLRTC
Trigger: ACATGTTCGTAGATCGTCTCATCGGTTTTGTTTGGT...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTGAAATGTTTTGTGGGTaGCCCGGCTTTTCATGGAGT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTEMFCG*PGFSWS
Trigger: ACTCCATGAAAAGCCGGGTCACCCACAAAACATTTC...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAGGGATAAAAATACACTaGGGATTAGAGCCATGCAGT +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTGIKIH*GLEPCS
Trigger: ACTGCATGGCTCTAATCCTCAGTGTATTTTTATCCC...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAGCCTTTTCCAACCATTaGGTGCATGATCAGATTACA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQAFSNH*VHDQIT
Trigger: TGTAATCTGATCATGCACTCAATGGTTGGAAAAGGC...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCGAGCCTCTCGTTTTCTaGCTGTACATTAGTGACCAC +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLEPLVF*LYISDH
Trigger: GTGGTCACTAATGTACAGGCAGAAAACGAGAGGCTC...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTGAGCCTCTCGTTTTCTaGCTGTACATTAGTGACCAC +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLEPLVF*LYISDH
Trigger: GTGGTCACTAATGTACAGGCAGAAAACGAGAGGCTC...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATATTCAACCTGGTTCTaGTTCAACGTGGACACTAGT +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQYSTWF*FNVDTS
Trigger: ACTAGTGTCCACGTTGAAGCAGAACCAGGTTGAATA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAAATCACCTCAGTTACTaGCACCCTGTATTTGCATTC +
Preference number: 4 (lower is better)
Translates to: TVSLILVLGRYNASEMKTNHLSY*HPVFAF
Trigger: GAATGCAAATACAGGGTGGCAGTAACTGAGGTGATT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAATATTCATTGGCTCTTTaGGGATGTCACTTGTATCCA +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKYSLAL*GCHLYP
Trigger: TGGATACAAGTGACATCCGCAAAGAGCCAATGAATA...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATGCTGCTAACTGTCTCTaGATCTCATCCAACTGGGTG +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYAANCL*ISSNWV
Trigger: CACCCAGTTGGATGAGATGCAGAGACAGTTAGCAGC...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGTCAGGGCGAGTTTTTaGTGGATAGCCATTCGTAAC +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFVRASF*WIAIRN
Trigger: GTTACGAATGGCTATCCAGCAAAAACTCGCCCTGAC...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTAGAACACAGCTTCATTCTTAATATCCACCTTTATCTACCAATTCTCAGGTTGTTCCAAGTTTGCCTTTaGTGCGTCGGGACTGCTCAT +
Preference number: 4 (lower is better)
Translates to: VEHSFILNIHLYLPILRLFQVCL*CVGTAH
Trigger: ATGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAA...CAACCTGAGAATTGGTAGATAAAGGTGGATATTAAGAATGAAGCTGTGTTCTAC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp TTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAGCAGAATGAAGATAAACGGAAAAGAAAGTaGGGCCGGATGAATGAGCAG +
Preference number: 4 (lower is better)
Translates to: FFFCSPMTRMTKAKQNEDKRKRK*GRMNEQ
Trigger: CTGCTCATTCATCCGGCCGCACTTTCTTTTCCGTTT...ATCTTCATTCTGCTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp CCACACAGTCTAAATCCTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTAAGTTGTTTTTCTTCTaGAGCCCAATGACAAGAATG +
Preference number: 4 (lower is better)
Translates to: PHSLNPEIVGPQAQTSSLKLFFF*SPMTRM
Trigger: CATTCTTGTCATTGGGCTGCAGAAGAAAAACAACTT...AAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAGGATTTAGACTGTGTGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp ATTACAGCATGTGTAACGTTGAACTGTAATTGTGTTTCTATCCTGACATCCCCACATCAGAAGGCACTGTaGCTGCTTGTTGGCTTTCAA +
Preference number: 4 (lower is better)
Translates to: ITACVTLNCNCVSILTSPHQKAL*LLVGFQ
Trigger: TTGAAAGCCAACAAGCAGGCACAGTGCCTTCTGATG...TGGGGATGTCAGGATAGAAACACAATTACAGTTCAACGTTACACATGCTGTAAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR GCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACCTTAGGTCTCTCTTATaGTATCGAGGTAAAGCCAGC +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYLRSLL*YRGKAS
Trigger: GCTGGCTTTACCTCGATAGCATAAGAGAGACCTAAG...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACTAACGAAAGCTCCTaGAATGTGCTTTACGACTTA +
Preference number: 4 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKTNESS*NVLYDL
Trigger: TAAGTCGTAAAGCACATTGCAGGAGCTTTCGTTAGT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTCTCTTTACTCCACGTTaGATAATAAATGACACTGTG +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSLFTPR*IINDTV
Trigger: CACAGTGTCATTTATTATGCAACGTGGAGTAAAGAG...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCCTTCGTATTCAACCTaGTTCTGCTTCAACGTGGAC +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFPSYST*FCFNVD
Trigger: GTCCACGTTGAAGCAGAACCAGGTTGAATACGAAGG...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCAGGGCTTCTTCCAGTTaGTGCTCAGCAATCTCTTTC +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLRASSS*CSAISF
Trigger: GAAAGAGATTGCTGAGCACCAACTGGAAGAAGCCCT...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTTTGTCATCATTGTTTaGTTCACTCCCATCCTCGGC +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYFVIIV*FTPILG
Trigger: GCCGAGGATGGGAGTGAACCAAACAATGATGACAAA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGATGTCTTTATCAATCATaGGGGCTAGCTCCCGAGCCG +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRCLYQS*GLAPEP
Trigger: CGGCTCGGGAGCTAGCCCCCATGATTGATAAAGACA...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGACAGCTGTCTGCTTGTTaGCTTTCAACACCGCCCTCA +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRQLSAC*LSTPPS
Trigger: TGAGGGCGGTGTTGAAAGCCAACAAGCAGACAGCTG...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCATGCATCTCATCCAACTaGGTGACATATTCATCACAT +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPCISSN*VTYSSH
Trigger: ATGTGATGAATATGTCACCCAGTTGGATGAGATGCA...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAAGGGCGAGTTTTTGCTaGATAGCCATTCGTAACAAA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQRASFC*IAIRNK
Trigger: TTTGTTACGAATGGCTATCCAGCAAAAACTCGCCCT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTTGAGAAGTTTGATTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCACGAGAAATGCAACATaGAGAACAGGGCAGAGGGTC +
Preference number: 4 (lower is better)
Translates to: FEKFDLYIPTHLNVVLECTRNAT*RTGQRV
Trigger: GACCCTCTGCCCTGTTCTCCATGTTGCATTTCTCGT...GCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAATCAAACTTCTCAAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAACGAGAAATGCAACATaGAGAACAGGGCAGAGGGTC +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGTRNAT*RTGQRV
Trigger: GACCCTCTGCCCTGTTCTCCATGTTGCATTTCTCGT...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CCA 90 bp TTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAGCAGAATGAAGATTCTCTCACCAAGGAGTaGTTACATCCAGAGGAAAGC +
Preference number: 4 (lower is better)
Translates to: FFFCSPMTRMTKAKQNEDSLTKE*LHPEES
Trigger: GCTTTCCTCTGGATGTAACCACTCCTTGGTGAGAGA...ATCTTCATTCTGCTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTCAGGTCCAAATACGTaGTGCTTGAGAAAGGGGGAA +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTSGPNT*CLRKGE
Trigger: TTCCCCCTTTCTCAAGCACCACGTATTTGGACCTGA...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGAGTCGTGTTTTCATATaGTATTTATCAGTAGGTGGA +
Preference number: 4 (lower is better)
Translates to: CTSNNREENTRWILGSILSRVFI*YLSVGG
Trigger: TCCACCTACTGATAAATACCATATGAAAACACGACT...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTACATCCTCGGCAAATTTaGGTCCATCTACTGAGATGC +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVHPRQI*VHLLRC
Trigger: GCATCTCAGTAGATGGACTCAAATTTGCCGAGGATG...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTAAATGTTCAGCTCACTaGATAAGTCAGAGACAGGGT +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSKCSAH*ISQRQG
Trigger: ACCCTGTCTCTGACTTATTCAGTGAGCTGAACATTT...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACATTAACGCCTCACCAGTaGCAACATTATTTATACTGG +
Preference number: 4 (lower is better)
Translates to: YPCPVKEKLINSTISKGTLTPHQ*QHYLYW
Trigger: CCAGTATAAATAATGTTGTCACTGGTGAGGCGTTAA...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR TCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTACCATTTGGTCTCTaGTGGACCACTCCATTTCTG +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLLPFGL*WTTPFL
Trigger: CAGAAATGGAGTGGTCCATCAGAGACCAAATGGTAA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGACAACGCCAGTGAAATaGAGACAATGTTTAGGAACA +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMTTPVK*RQCLGT
Trigger: TGTTCCTAAACATTGTCTTCATTTCACTGGCGTTGT...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCCCCCAATGTCTCTaGGGGACAGATTGTAACTTT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTFPQCL*GTDCNF
Trigger: AAAGTTACAATCTGTCCCTCAGAGACATTGGGGGAA...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCACCTGCATAAGCTGCTaGTTCAACTTCTGTATTTCT +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVTCISC*FNFCIS
Trigger: AGAAATACAGAAGTTGAAGCAGCAGCTTATGCAGGT...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCTTTGCTGGCCTCTGTaGTTTCTTTTGCAACTGGTT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTLCWPL*FLLQLV
Trigger: AACCAGTTGCAAAAGAAAGCACAGAGGCCAGCAAAG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTATTCATTGGCTCTTTaGGGATGTCACTTGTATCCA +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVYSLAL*GCHLYP
Trigger: TGGATACAAGTGACATCCGCAAAGAGCCAATGAATA...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTATTCATTGGCTCTTTaGGGATGTCACTTGTATCCA +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLYSLAL*GCHLYP
Trigger: TGGATACAAGTGACATCCGCAAAGAGCCAATGAATA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTACAGCTTTCTGCAGATaGTTGATTTGGTCCCGGATT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTTAFCR*LIWSRI
Trigger: AATCCGGGACCAAATCAAGCATCTGCAGAAAGCTGT...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTTCATCACATCTTGTTaGAAACATTGCTCTCAGGGA +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLFITSC*KHCSQG
Trigger: TCCCTGAGAGCAATGTTTGCAACAAGATGTGATGAA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGTTCATCACATCTTGTTaGAAACATTGCTCTCAGGGA +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMFITSC*KHCSQG
Trigger: TCCCTGAGAGCAATGTTTGCAACAAGATGTGATGAA...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCACATCAGGGTCTGTaGTTCGTGTTCTTCTCAACT +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLSHQGL*FVFFST
Trigger: AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTCTTAGGTCTCTCTTATaGTATCGAGGTAAAGCCAGC +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLLRSLL*YRGKAS
Trigger: GCTGGCTTTACCTCGATAGCATAAGAGAGACCTAAG...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAAAAGCTCCTGCAATGTaGTTTACGACTTACCATTTG +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQKAPAM*FTTYHL
Trigger: CAAATGGTAAGTCGTAAAGCACATTGCAGGAGCTTT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTAGCAGAAGGTTAGGCTaGTATGGTTGGGAACTTCAT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTSRRLG*YGWELH
Trigger: ATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCT...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTAAGCTCCTTTATTTATaGCACTCAGCACTCAGGCCA +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLKLLYL*HSALRP
Trigger: TGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTT...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGCATTCTCCTATCTTaGCACTTAATACTTACTAGA +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRCILLS*HLILTR
Trigger: TCTAGTAAGTATTAAGTGGCAAGATAGGAGAATGCA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACCAATGTTTCATaGTTGTTTCAAACAGAAGAA +
Preference number: 4 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRWTNVS*LFQTEE
Trigger: TTCTTCTGTTTGAAACAAGCATGAAACATTGGTCCA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTTGGACCAATGTTTCATaGTTGTTTCAAACAGAAGAA +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSWTNVS*LFQTEE
Trigger: TTCTTCTGTTTGAAACAAGCATGAAACATTGGTCCA...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCATACTGTGATTTTCGTTaGCTATGCTGGTCATCTTTT +
Preference number: 4 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPYCDFR*LCWSSF
Trigger: AAAAGATGACCAGCATAGCCAACGAAAATCACAGTA...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AAATCCACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGGTTGTAGATATTCATTaGCTCTTTGCGGATGTCACT +
Preference number: 4 (lower is better)
Translates to: KSTVSLILVLGRYNASEMVVDIH*LFADVT
Trigger: AGTGACATCCGCAAAGAGCCAATGAATATCTACAAC...CATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGTGGATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCTGCAGATGCTTGATTTaGTCCCGGATTATGGCATTA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFCRCLI*SRIMAL
Trigger: TAATGCCATAATCCGGGACCAAATCAAGCATCTGCA...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAGGGCGAGTTTTTGCTaGATAGCCATTCGTAACAAA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFRASFC*IAIRNK
Trigger: TTTGTTACGAATGGCTATCCAGCAAAAACTCGCCCT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTTTTCTTCTGCAGCCCAATGACAAGAATGACTAAAGCCAAGCAGAATGAAGATGGAAATGGGAAGGGATaGGTGGAAACGGAAAAGAAA +
Preference number: 4 (lower is better)
Translates to: FFFCSPMTRMTKAKQNEDGNGKG*VETEKK
Trigger: TTTCTTTTCCGTTTCCACCCATCCCTTCCCATTTCC...ATCTTCATTCTGCTTGGCTTTAGTCATTCTTGTCATTGGGCTGCAGAAGAAAAA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp ACAAGAATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGACCTCATCACTTTTGTaGACTACGAAATTGTCGCTG +
Preference number: 4 (lower is better)
Translates to: TRMTKAKQNEDCLAFVKWTSSLL*TTKLSL
Trigger: CAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGT...CCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCATTCTTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTAGTCGTGTTTTCATATaGTATTTATCAGTAGGTGGA +
Preference number: 4 (lower is better)
Translates to: SNCTSNNREENTRWILGSSRVFI*YLSVGG
Trigger: TCCACCTACTGATAAATACCATATGAAAACACGACT...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTGTATTAAGGGTACTGTaGTTTTCGTTGGCTATGCTG +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLVLRVL*FSLAML
Trigger: CAGCATAGCCAACGAAAATCACAGTACCCTTAATAC...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAACAACCATTGAGTGCATaGTCAGATTACACAAATACA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQQPLSA*SDYTNT
Trigger: TGTATTTGTGTAATCTGATCATGCACTCAATGGTTG...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTATTCAACCTGGTTCTaGTTCAACGTGGACACTAGT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTYSTWF*FNVDTS
Trigger: ACTAGTGTCCACGTTGAAGCAGAACCAGGTTGAATA...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAAATCGCTTAATCTCATaGTTTAAGCCTTCGTATTCA +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKNRLIS*FKPSYS
Trigger: TGAATACGAAGGCTTAAAGCATGAGATTAAGCGATT...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
40% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCAAGGCTTGTCACCTaGTCATCATACATCTGGATT +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLSRLVT*SSYIWI
Trigger: AATCCAGATGTATGATGAGCAGGTGACAAGCCTTGA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGATCACATCAGGGTCTGTaGTTCGTGTTCTTCTCAACT +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGSHQGL*FVFFST
Trigger: AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCTCCTCTAAGACTGGCTaGACAAATCATACCTATGAA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFSSKTG*TNHTYE
Trigger: TTCATAGGTATGATTTGTGCAGCCAGTCTTAGAGGA...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAGGTCTTAGTTGGACTTaGTTCTTTGCTGGCCTCTGT +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRGLSWT*FFAGLC
Trigger: ACAGAGGCCAGCAAAGAACCAAGTCCAACTAAGACC...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTTGTAGATATTCATTaGCTCTTTGCGGATGTCACT +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFVVDIH*LFADVT
Trigger: AGTGACATCCGCAAAGAGCCAATGAATATCTACAAC...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTGCATCTCATCCAACTaGGTGACATATTCATCACAT +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSCISSN*VTYSSH
Trigger: ATGTGATGAATATGTCACCCAGTTGGATGAGATGCA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCTGCATCTCATCCAACTaGGTGACATATTCATCACAT +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFCISSN*VTYSSH
Trigger: ATGTGATGAATATGTCACCCAGTTGGATGAGATGCA...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAATGGGAAGGGATGGGTaGAAACGGAAAAGAAAGTGC +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQMGRDG*KRKRKC
Trigger: GCACTTTCTTTTCCGTTTCCACCCATCCCTTCCCAT...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGACAGTTAACTAAAATCTaGCCACTGCACCGTACTATG +
Preference number: 4 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGQLTKI*PLHRTM
Trigger: CATAGTACGGTGCAGTGGCCAGATTTTAGTTAACTG...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAAAAATGACCACAGTCTaGCCAATTCCAGATTTCAAA +
Preference number: 4 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQKMTTV*PIPDFK
Trigger: TTTGAAATCTGGAATTGGCCAGACTGTGGTCATTTT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
40% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTATTAGGCTGCTATGGTTaGGAACTTCATGTCGAATCG +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVLGCYG*ELHVES
Trigger: CGATTCGACATGAAGTTCCCAACCATAGCAGCCTAA...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAGGAAGAAATGTTTTGTaGGTGACCCGGCTTTTCATG +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGGRNVL*VTRLFM
Trigger: CATGAAAAGCCGGGTCACCCACAAAACATTTCTTCC...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAACAATATCAGAATCATaGATGGTTCATCACATAAGC +
Preference number: 4 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKTISES*MVHHIS
Trigger: GCTTATGTGATGAACCATCCATGATTCTGATATTGT...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CAA 72 bp AGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTaGTTTCTGTTTCTGTACTTTAACCTGAACCCTTAT +
Preference number: 4 (lower is better)
Translates to: RLLWLGTSCRIV*FLFLYFNLNPY
Trigger: ATAAGGGTTCAGGTTAAAGTACAGAAACAGAAACAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACGAGTGTGAGGAAAGATaGTACTGCAATATACGTATT +
Preference number: 4 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYECEER*YCNIRI
Trigger: AATACGTATATTGCAGTATCATCTTTCCTCACACTC...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAATCAACTTCCCTAGCTaGATTTGGAGTGTGAGGAAA +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGINFPS*IWSVRK
Trigger: TTTCCTCACACTCCAAATTCAGCTAGGGAAGTTGAT...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTATACTTAATAGGCGTATaGCTAACGAAAGCTCCTGCA +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVYLIGV*LTKAPA
Trigger: TGCAGGAGCTTTCGTTAGTCATACGCCTATTAAGTA...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCAAATACGTGGTGCTTaGGAAAGGGGGAAAAATAAA +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFQIRGA*ERGKNK
Trigger: TTTATTTTTCCCCCTTTCTCAAGCACCACGTATTTG...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
39% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAATGAGCTCCCAGAACTaGAATGCATTCTCCTATCTT +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGMSSQN*NAFSYL
Trigger: AAGATAGGAGAATGCATTTCAGTTCTGGGAGCTCAT...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTCATACCTTCTATTTCTaGAGTATTCCTGAGGACATT +
Preference number: 4 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSHTFYF*SIPEDI
Trigger: AATGTCCTCAGGAATACTTCAGAAATAGAAGGTATG...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTAATCGCTTAATCTCATaGTTTAAGCCTTCGTATTCA +
Preference number: 4 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLNRLIS*FKPSYS
Trigger: TGAATACGAAGGCTTAAAGCATGAGATTAAGCGATT...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTACCTGCATAAGCTGCTaGTTCAACTTCTGTATTTCT +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFTCISC*FNFCIS
Trigger: AGAAATACAGAAGTTGAAGCAGCAGCTTATGCAGGT...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTGATTTTCGTTGGCTATaGTGGTCATCTTTTGCAACT +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTDFRWL*WSSFAT
Trigger: AGTTGCAAAAGATGACCAGCATAGCCAACGAAAATC...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGACTTTGCTGGCCTCTGTaGTTTCTTTTGCAACTGGTT +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRLCWPL*FLLQLV
Trigger: AACCAGTTGCAAAAGAAAGCACAGAGGCCAGCAAAG...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGATTCATCACATCTTGTTaGAAACATTGCTCTCAGGGA +
Preference number: 4 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGFITSC*KHCSQG
Trigger: TCCCTGAGAGCAATGTTTGCAACAAGATGTGATGAA...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATGAGCCTCATTTGAAATaGAACACTACCCACGTATTT +
Preference number: 4 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYEPHLK*NTTHVF
Trigger: AAATACGTGGGTAGTGTTGCATTTCAAATGAGGCTC...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR GCA 90 bp CATTCCCTGAATATATTATTCTATTTTGTCACTCCAAAGCCTCTCTACCTACTGGGATTTGCTGATTTCTaGTTTCACCACTTTCTCCAC +
Preference number: 4 (lower is better)
Translates to: HSLNILFYFVTPKPLYLLGFADF*FHHFLH
Trigger: GTGGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCC...CAGTAGGTAGAGAGGCTTTGGAGTGACAAAATAGAATAATATATTCAGGGAATG
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR GCA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCAAAGCTCCTGCAATGTaGTTTACGACTTACCATTTG +
Preference number: 4 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLKAPAM*FTTYHL
Trigger: CAAATGGTAAGTCGTAAAGCACATTGCAGGAGCTTT...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAGGTCCAAATACGTGGTaGTTGAGAAAGGGGGAAAAA +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRGPNTW*LRKGEK
Trigger: TTTTTCCCCCTTTCTCAAGCACCACGTATTTGGACC...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
39% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTCCAACCATTGAGTaGATGATCAGATTACACAAA +
Preference number: 4 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVFPTIE*MIRLHK
Trigger: TTTGTGTAATCTGATCATGCACTCAATGGTTGGAAA...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGATTTCGTTGGCTATGCTaGTCATCTTTTGCAACTCCT +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGFRWLC*SSFATP
Trigger: AGGAGTTGCAAAAGATGACCAGCATAGCCAACGAAA...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATAGGGCGAGTTTTTGCTaGATAGCCATTCGTAACAAA +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYRASFC*IAIRNK
Trigger: TTTGTTACGAATGGCTATCCAGCAAAAACTCGCCCT...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
39% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp GATAACAGCGGTTTTGAGAAGTTTGATTTATACATTCCAACCCACTTGAATGTCACCTCATCACTTTTGTaGACTACGAAATTGTCGCTG +
Preference number: 4 (lower is better)
Translates to: DNSGFEKFDLYIPTHLNVTSSLL*TTKLSL
Trigger: CAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGT...GACATTCAAGTGGGTTGGAATGTATAAATCAAACTTCTCAAAACCGCTGTTATC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CCA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACATCAGTTTTGGTCATATaGACAAAAGTTTCCCTAAGA +
Preference number: 4 (lower is better)
Translates to: YPCPVKEKLINSTISKGTSVLVI*TKVSLR
Trigger: TCTTAGGGAAACTTTTGTCCATATGACCAAAACTGA...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGAGGATACAACCCTATTTaGAAACTGTTCTGGATACTG +
Preference number: 4 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGGYNPI*KLFWIL
Trigger: CAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCC...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CCA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAAAATGACCACAGTCTaGCCAATTCCAGATTTCAAA +
Preference number: 4 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFKMTTV*PIPDFK
Trigger: TTTGAAATCTGGAATTGGCCAGACTGTGGTCATTTT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAGGAGTTCATTCTTTTTaGTTCTCACTAGTTCTGCCC +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVGVHSF*FSLVLP
Trigger: GGGCAGAACTAGTGAGAACCAAAAAGAATGAACTCC...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
39% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAATCACAGGAATAATCTaGCTCAGCAGTTTATCCAGG +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVITGII*LSSLSR
Trigger: CCTGGATAAACTGCTGAGCCAGATTATTCCTGTGAT...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAGGATCTCTAAACCATTaGTGTCCACCTCATAGTCAT +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRGSLNH*CPPHSH
Trigger: ATGACTATGAGGTGGACATCAATGGTTTAGAGATCC...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGATCTCATCCAACTGGGTaGCATATTCATCACATCTTG +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRSHPTG*HIHHIL
Trigger: CAAGATGTGATGAATATGTCACCCAGTTGGATGAGA...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCGATTTGTTTGTCCATTaGCTGTGCAAAGTTTTTCCA +
Preference number: 4 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSDLFVH*LCKVFP
Trigger: TGGAAAAACTTTGCACAGTCAATGGACAAACAAATC...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR TCA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCATCATTTATTGTTTGTaGCAAATACCCCAAAGCCTC +
Preference number: 4 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSIIYCL*QIPQSL
Trigger: GAGGCTTTGGGGTATTTGTCACAAACAATAAATGAT...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR TCA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCAGTTAATGAGCTACTaGTTAGAAAGTAAGTGCCTA +
Preference number: 4 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFQLMSY*LESKCL
Trigger: TAGGCACTTACTTTCTAATCAGTAGCTCATTAACTG...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGATACTTAATAGGCGTATaGCTAACGAAAGCTCCTGCA +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRYLIGV*LTKAPA
Trigger: TGCAGGAGCTTTCGTTAGTCATACGCCTATTAAGTA...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAACTCGGGAGCTAGATTaGTCTTGTAGTTCCATAGAA +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRTRELD*SCSSIE
Trigger: TTCTATGGAACTACAAGATCAATCTAGCTCCCGAGT...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCAACCATTGAGTGCATaGTCAGATTACACAAATACA +
Preference number: 4 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTQPLSA*SDYTNT
Trigger: TGTATTTGTGTAATCTGATCATGCACTCAATGGTTG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTATCTACCTGCATAAGCTaGTGCTTCAACTTCTGTATT +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVSTCIS*CFNFCI
Trigger: AATACAGAAGTTGAAGCAGCAGCTTATGCAGGTAGA...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTACATTGCATATTTCTATaGACTCTCGCCCTTACACTA +
Preference number: 4 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVHCIFL*TLALTL
Trigger: TAGTGTAAGGGCGAGAGTGCATAGAAATATGCAATG...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGATTTCGTTGGCTATGCTaGTCATCTTTTGCAACTCCT +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRFRWLC*SSFATP
Trigger: AGGAGTTGCAAAAGATGACCAGCATAGCCAACGAAA...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAAGGGCGAGTTTTTGCTaGATAGCCATTCGTAACAAA +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQRASFC*IAIRNK
Trigger: TTTGTTACGAATGGCTATCCAGCAAAAACTCGCCCT...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
38% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAGGAGTTCATTCTTTTTaGTTCTCACTAGTTCTGCCC +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQGVHSF*FSLVLP
Trigger: GGGCAGAACTAGTGAGAACCAAAAAGAATGAACTCC...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
38% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
3UTR CAA 72 bp GTTGGTAACATAAACCGAGATATAAGAATCGATATATaGGCTTCTGGTTATTTTCTTAGCACTGGAGTGCCT +
Preference number: 4 (lower is better)
Translates to: VGNINRDIRIDI*ASGYFLSTGVP
Trigger: AGGCACTCCAGTGCTAAGAAAATAACCAGAAGCCAATATATCGATTCTTATATCTCGGTTTATGTTACCAAC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR TCA 90 bp ATAACTTGGATTACAGCATGTGTAACGTTGAACTGTAATTGTGTTTCTATCCTGTTCATAAGCATTTACTaGCTTCATCAGAAGGCACTG +
Preference number: 4 (lower is better)
Translates to: ITWITACVTLNCNCVSILFISIY*LHQKAL
Trigger: CAGTGCCTTCTGATGAAGTCAGTAAATGCTTATGAA...CAGGATAGAAACACAATTACAGTTCAACGTTACACATGCTGTAATCCAAGTTAT
37% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR GCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTGTGGACACTAGTTTCTaGAATGTGATATTTTCTTCT +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLVDTSF*NVIFSS
Trigger: AGAAGAAAATATCACATTGCAGAAACTAGTGTCCAC...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATCTACCTGCATAAGCTaGTGCTTCAACTTCTGTATT +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQSTCIS*CFNFCI
Trigger: AATACAGAAGTTGAAGCAGCAGCTTATGCAGGTAGA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAGATTTTCGTTGGCTATaGTGGTCATCTTTTGCAACT +
Preference number: 4 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRDFRWL*WSSFAT
Trigger: AGTTGCAAAAGATGACCAGCATAGCCAACGAAAATC...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATTGGGCAATATTCCCATaGCAAATGAAAAAGCACAAA +
Preference number: 4 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYWAIFP*QMKKHK
Trigger: TTTGTGCTTTTTCATTTGGCATGGGAATATTGCCCA...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
37% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR GCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATCCTCTAAGACTGGCTaGACAAATCATACCTATGAA +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQSSKTG*TNHTYE
Trigger: TTCATAGGTATGATTTGTGCAGCCAGTCTTAGAGGA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTACATTCTTAGGTTATTaGACCAATGTTTCATGCTTG +
Preference number: 4 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLTFLGY*TNVSCL
Trigger: CAAGCATGAAACATTGGTCCAATAACCTAAGAATGT...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR GCA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGATGCATTCTCCTATCTTaGCACTTAATACTTACTAGA +
Preference number: 4 (lower is better)
Translates to: DELNFRHNSSEGIITDNGCILLS*HLILTR
Trigger: TCTAGTAAGTATTAAGTGGCAAGATAGGAGAATGCA...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
36% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CCA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAACAATATCAGAATCATaGATGGTTCATCACATAAGC +
Preference number: 4 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQTISES*MVHHIS
Trigger: GCTTATGTGATGAACCATCCATGATTCTGATATTGT...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
34% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp AGGCGGCAAAGGCCGCCGCATGTGTCCTCGGGGCCGGCCCCTGCGTaGGGTCAGCAGCCGTGCGGCATGGCCCGGGCTGCGGCGGCCGCG +
Preference number: 5 (lower is better)
Translates to: RRQRPPHVSSGPAPA*GQQPCGMARAAAAA
Trigger: CGCGGCCGCCGCAGCCCGGGCCATGCCGCACGGCTGCTGACCGCACGCAGGGGCCGGCCCCGAGGACACATGCGGCGGCCTTTGCCGCCT
80% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 90 bp GGCGAGGCGGCAAAGGCCGCCGCATGTGTCCTCGGGGCCGGCCCCTaGGTGCGGTCAGCAGCCGTGCGGCATGGCCCGGGCTGCGGCGGC +
Preference number: 5 (lower is better)
Translates to: GEAAKAAACVLGAGP*VRSAAVRHGPGCGG
Trigger: GCCGCCGCAGCCCGGGCCATGCCGCACGGCTGCTGACCGCACGCAGGGGCCGGCCCCGAGGACACATGCGGCGGCCTTTGCCGCCTCGCC
80% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS CCA 90 bp GCCCGTCCGCCATGTCTCCCGGGCCGCGTCACTGCAGTCTCGCCCTaGGTCTGGCGCGCTCCGGCTCGCGGCTCGCTCTCTCGCTCCACC +
Preference number: 5 (lower is better)
Translates to: ARPPCLPGRVTAVSP*VWRAPARGSLSRST
Trigger: GGTGGAGCGAGAGAGCGAGCCGCGAGCCGGAGCGCGCCAGACCCAGGGCGAGACTGCAGTGACGCGGCCCGGGAGACATGGCGGACGGGC
76% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS CCA 90 bp CCGCCATGTCTCCCGGGCCGCGTCACTGCAGTCTCGCCCTGGGTCTaGCGCGCTCCGGCTCGCGGCTCGCTCTCTCGCTCCACCTGCTCC +
Preference number: 5 (lower is better)
Translates to: PPCLPGRVTAVSPWV*RAPARGSLSRSTCS
Trigger: GGAGCAGGTGGAGCGAGAGAGCGAGCCGCGAGCCGGAGCGCGCCAGACCCAGGGCGAGACTGCAGTGACGCGGCCCGGGAGACATGGCGG
74% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000551848.1
ENST00000652176.1
CDS GCA 90 bp CTTATTCAGAGACGCCCGTCCGCCATGTCTCCCGGGCCGCGTCACTaGAGTCTCGCCCTGGGTCTGGCGCGCTCCGGCTCGCGGCTCGCT +
Preference number: 5 (lower is better)
Translates to: LIQRRPSAMSPGPRH*SLALGLARSGSRLA
Trigger: AGCGAGCCGCGAGCCGGAGCGCGCCAGACCCAGGGCGAGACTGCAGTGACGCGGCCCGGGAGACATGGCGGACGGGCGTCTCTGAATAAG
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS TCA 90 bp CCCCGCCGGCTCTGGTGGCAGCGGCAGCTACACCGCCCGAGAAACTaGCGAGAAATGCAACATGGAGAACAGGGCAGAGGGTCAGGGGCG +
Preference number: 5 (lower is better)
Translates to: PRRLWWQRQLHRPRN*REMQHGEQGRGSGA
Trigger: CGCCCCTGACCCTCTGCCCTGTTCTCCATGTTGCATTTCTCGTCAGTTTCTCGGGCGGTGTAGCTGCCGCTGCCACCAGAGCCGGCGGGG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS CCA 90 bp GCAGCGGCAGCTACACCGCCCGAGAAACTGACGAGAAATGCAACATaGAGAACAGGGCAGAGGGTCAGGGGCGAGGCGGCAAAGGCCGCC +
Preference number: 5 (lower is better)
Translates to: AAAATPPEKLTRNAT*RTGQRVRGEAAKAA
Trigger: GGCGGCCTTTGCCGCCTCGCCCCTGACCCTCTGCCCTGTTCTCCATGTTGCATTTCTCGTCAGTTTCTCGGGCGGTGTAGCTGCCGCTGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 90 bp CTGCTTTGCAGGCCCCTCATGGCATTGACGTGCTCTGTGAGCCGGTaGACCCGCTCATGCTGCTCCGTCAGTGCCCCCTTGGTGTGTTCC +
Preference number: 5 (lower is better)
Translates to: LLCRPLMALTCSVSR*TRSCCSVSAPLVCS
Trigger: GGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAATGCCATGAGGGGCCTGCAAAGCAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp CCCCTCATGGCATTGACGTGCTCTGTGAGCCGGTGCACCCGCTCATaGTGCTCCGTCAGTGCCCCCTTGGTGTGTTCCAGCTGTGTCTGT +
Preference number: 5 (lower is better)
Translates to: PLMALTCSVSRCTRS*CSVSAPLVCSSCVC
Trigger: ACAGACACAGCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAATGCCATGAGGGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp CTCATGGCATTGACGTGCTCTGTGAGCCGGTGCACCCGCTCATGCTaGTCCGTCAGTGCCCCCTTGGTGTGTTCCAGCTGTGTCTGTGAC +
Preference number: 5 (lower is better)
Translates to: LMALTCSVSRCTRSC*SVSAPLVCSSCVCD
Trigger: GTCACAGACACAGCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAATGCCATGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp TCTGGTGGCAGCGGCAGCTACACCGCCCGAGAAACTGACGAGAAATaGAACATGGAGAACAGGGCAGAGGGTCAGGGGCGAGGCGGCAAA +
Preference number: 5 (lower is better)
Translates to: SGGSGSYTARETDEK*NMENRAEGQGRGGK
Trigger: TTTGCCGCCTCGCCCCTGACCCTCTGCCCTGTTCTCCATGTTGCATTTCTCGTCAGTTTCTCGGGCGGTGTAGCTGCCGCTGCCACCAGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 90 bp AGGGAGAAGGAAATGGGAAGGGATGGGTGGAAACGGAAAAGAAAGTaGGGCCGGATGAATGAGCAGCGCGATGCCCCGCCGGCTCTGGTG +
Preference number: 5 (lower is better)
Translates to: REKEMGRDGWKRKRK*GRMNEQRDAPPALV
Trigger: CACCAGAGCCGGCGGGGCATCGCGCTGCTCATTCATCCGGCCGCACTTTCTTTTCCGTTTCCACCCATCCCTTCCCATTTCCTTCTCCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000548411.5
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTGGCGGTACGGAGTCTTTGACGAGACAGTaGCAAGGACCGGTCCACAGC +
Preference number: 5 (lower is better)
Translates to: TVGQSCLPASCEHCGGTESLTRQ*QGPVHS
Trigger: GCTGTGGACCGGTCCTTGCAACTGTCTCGTCAAAGA...CTCCGTACCGCCACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp GGACATGGCCCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCCAGGCCAAACAGCCATaGCCTCCCAAATTCCAGCTT +
Preference number: 5 (lower is better)
Translates to: GHGPASLRGEIKAVGSPSQAKQP*PPKFQL
Trigger: AAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTG...GCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGGGCCATGTCC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS GCA 90 bp CTCTATCTCAGTCTTATAATGGTCCACCGTCTGCAATACCTCTTCTaGGGCCATAGCCCCGGTGGATGGAGGCAGGAGGGGGTTACGGGG +
Preference number: 5 (lower is better)
Translates to: LYLSLIMVHRLQYLF*GHSPGGWRQEGVTG
Trigger: CCCCGTAACCCCCTCCTGCCTCCATCCACCGGGGCTATGGCCGCAGAAGAGGTATTGCAGACGGTGGACCATTATAAGACTGAGATAGAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000550207.1
ENST00000551086.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 90 bp CTGCCGATCTTGCTCTTTCCAAGTTTGCCTTTGCTGCGTCGGGACTaGTCATGGTCAAACTCTAAGTCCTCCAGCCTCTGGGTCAGGGCG +
Preference number: 5 (lower is better)
Translates to: LPILLFPSLPLLRRD*SWSNSKSSSLWVRA
Trigger: CGCCCTGACCCAGAGGCTGGAGGACTTAGAGTTTGACCATGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCAAGATCGGCAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000552160.2
ENST00000552226.1
ENST00000652176.1
CDS CCA 90 bp CCTTTTCCTCTGAGTGCCACTGCTGACCCGAATGTTGGGTGTCTGTaGGCCCTGACTATGCAGGAGGTAAGTGTCTATGGTGGGCACGGT +
Preference number: 5 (lower is better)
Translates to: PFPLSATADPNVGCL*ALTMQEVSVYGGHG
Trigger: ACCGTGCCCACCATAGACACTTACCTCCTGCATAGTCAGGGCCCACAGACACCCAACATTCGGGTCAGCAGTGGCACTCAGAGGAAAAGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp ACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTGGCGGTACGGAGAGCTCCACCATCTCATaGTTCTCCTTCAGATCCTGC +
Preference number: 5 (lower is better)
Translates to: TVGQSCLPASCEHCGGTESSTIS*FSFRSC
Trigger: GCAGGATCTGAAGGAGAACAATGAGATGGTGGAGCT...CTCCGTACCGCCACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS TCA 90 bp GCCCTGACTATGCAGGAGGTAAGTGTCTATGGTGGGCACGGTGACTaGTGCCTCCCCACTTACTTTAGGGCTGCCGATCTTGCTCTTTCC +
Preference number: 5 (lower is better)
Translates to: ALTMQEVSVYGGHGD*CLPTYFRAADLALS
Trigger: GGAAAGAGCAAGATCGGCAGCCCTAAAGTAAGTGGGGAGGCATCAGTCACCGTGCCCACCATAGACACTTACCTCCTGCATAGTCAGGGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000552160.2
ENST00000652176.1
CDS CCA 90 bp AGAAGCGTTTCCTCCCGAGTCTCTCCATCTTCAGCAACCTTCCGGTaGATGGAGAAGGACTGCCCAAATGCCTCTTTGAGCTGCTCCAGC +
Preference number: 5 (lower is better)
Translates to: RSVSSRVSPSSATFR*MEKDCPNASLSCSS
Trigger: GCTGGAGCAGCTCAAAGAGGCATTTGGGCAGTCCTTCTCCATCCACCGGAAGGTTGCTGAAGATGGAGAGACTCGGGAGGAAACGCTTCT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CCA 90 bp TCTTTTCCTCTGAGTGCCACTGCTGACCCGAATGTTGGGTGTCTGTaGGCCCTGACTATGCAGGAGGTAAGTGTCTATGGTGGGCACGGT +
Preference number: 5 (lower is better)
Translates to: SFPLSATADPNVGCL*ALTMQEVSVYGGHG
Trigger: ACCGTGCCCACCATAGACACTTACCTCCTGCATAGTCAGGGCCCACAGACACCCAACATTCGGGTCAGCAGTGGCACTCAGAGGAAAAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CAA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTGTCTCCGTGAGCTCCTaGGTTAGCCTCTCTATCTCA +
Preference number: 5 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCVSVSS*VSLSIS
Trigger: TGAGATAGAGAGGCTAACCAAGGAGCTCACGGAGAC...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACACCGTCCAGCTCAGCCTaGAGCTCCTTGCTGCTTTGC +
Preference number: 5 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTPSSSA*SSLLLC
Trigger: GCAAAGCAGCAAGGAGCTCAAGGCTGAGCTGGACGG...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS TCA 90 bp TTGTCTTTATCAATCATGGGGGCTAGCTCCCGAGCCGCTGCTCTTTaGCGAGACAGTTGCAAGGACCGGTCCACAGCTTTCTGCAGATGC +
Preference number: 5 (lower is better)
Translates to: LSLSIMGASSRAAAL*RDSCKDRSTAFCRC
Trigger: GCATCTGCAGAAAGCTGTGGACCGGTCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCGGGAGCTAGCCCCCATGATTGATAAAGACAA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp GTTCTCCTTCAGATCCTGCACGACTGCGGTGAGCCTCTCGTTTTCTaGCTGTACATTAGTGACCACAGCCCGGCTCTGTTTCAGCTCGTT +
Preference number: 5 (lower is better)
Translates to: VLLQILHDCGEPLVF*LYISDHSPALFQLV
Trigger: AACGAGCTGAAACAGAGCCGGGCTGTGGTCACTAATGTACAGGCAGAAAACGAGAGGCTCACCGCAGTCGTGCAGGATCTGAAGGAGAAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CTCTTACTAATCTCCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCGTCTCCGTGAGCTCCTaGGTTAGCCTCTCTATCTCA +
Preference number: 5 (lower is better)
Translates to: LLLISLPRRPNSHCLPNSVSVSS*VSLSIS
Trigger: TGAGATAGAGAGGCTAACCAAGGAGCTCACGGAGAC...GGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGGAGATTAGTAAGAG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS TCA 90 bp CTGCATCTCCAAGATCTTCCCCAGATAGTAAGCCTCCTTCGATGCTaGCTCCTGCAGAAGCGTTTCCTCCCGAGTCTCTCCATCTTCAGC +
Preference number: 5 (lower is better)
Translates to: LHLQDLPQIVSLLRC*LLQKRFLPSLSIFS
Trigger: GCTGAAGATGGAGAGACTCGGGAGGAAACGCTTCTGCAGGAGTCAGCATCGAAGGAGGCTTACTATCTGGGGAAGATCTTGGAGATGCAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CCA 90 bp CGAGGGCTTCTTCCAGTTGGTGCTCAGCAATCTCTTTCAATCGGATaGCATCTTCCAGCTGGCTGTTCAGCAGTACCGTCTCCTCCTCAA +
Preference number: 5 (lower is better)
Translates to: RGLLPVGAQQSLSIG*HLPAGCSAVPSPPQ
Trigger: TTGAGGAGGAGACGGTACTGCTGAACAGCCAGCTGGAAGATGCCATCCGATTGAAAGAGATTGCTGAGCACCAACTGGAAGAAGCCCTCG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CCA 90 bp AGGTGTCGGAAAGGGGAGCTGGGGTCTATGGATCTGACATGCAGCTaGGTGGAAGGGAAAGGACATCTGAATTTACCTGACAGTTGGGCA +
Preference number: 5 (lower is better)
Translates to: RCRKGELGSMDLTCS*VEGKGHLNLPDSWA
Trigger: TGCCCAACTGTCAGGTAAATTCAGATGTCCTTTCCCTTCCACCCAGCTGCATGTCAGATCCATAGACCCCAGCTCCCCTTTCCGACACCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000614004.1
CDS-3UTR CAA 90 bp TTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGATGCTCCAGCTCCTGTTaGAGGCTGTCGTACTCAGCC +
Preference number: 5 (lower is better)
Translates to: LPSLCQMGLVRSSLSHQGCSSSC*RLSYSA
Trigger: GGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGCA...TCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTGCCCAAATGCCTCTTaGAGCTGCTCCAGCTCCTGT +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWCPNAS*SCSSSC
Trigger: ACAGGAGCTGGAGCAGCTCAAAGAGGCATTTGGGCA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTCCATCCTCGGCAAATTaGAGTCCATCTACTGAGATG +
Preference number: 5 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCPSSAN*SPSTEM
Trigger: CATCTCAGTAGATGGACTCAAATTTGCCGAGGATGG...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGACCTCAGCTGTCTGCTaGTTGGCTTTCAACACCGCC +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWTSAVC*LAFNTA
Trigger: GGCGGTGTTGAAAGCCAACAAGCAGACAGCTGAGGT...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTGTGAGCACTGTGGCGGTACGGAGGCAGCAGGCTGCTGACAATCTGGTGGAGATTCATCACATCTTGTaGCAAACATTGCTCTCAGGG +
Preference number: 5 (lower is better)
Translates to: VVSTVAVRRQQAADNLVEIHHIL*QTLLSG
Trigger: CCCTGAGAGCAATGTTTGCAACAAGATGTGATGAAT...CTCCACCAGATTGTCAGCAGCCTGCTGCCTCCGTACCGCCACAGTGCTCACAAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS TCA 90 bp CAGTTACTGCCACCCTGTATTTGCATTCAAGGATCTCTAAACCATTaGTGTCCACCTCATAGTCATGGGCCTCCTCCCCTGAGTCCCGGC +
Preference number: 5 (lower is better)
Translates to: QLLPPCICIQGSLNH*CPPHSHGPPPLSPG
Trigger: GCCGGGACTCAGGGGAGGAGGCCCATGACTATGAGGTGGACATCAATGGTTTAGAGATCCTTGAATGCAAATACAGGGTGGCAGTAACTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CCA 90 bp ATCTTGCTCTTTCCAAGTTTGCCTTTGCTGCGTCGGGACTGCTCATaGTCAAACTCTAAGTCCTCCAGCCTCTGGGTCAGGGCGAGTTTT +
Preference number: 5 (lower is better)
Translates to: ILLFPSLPLLRRDCS*SNSKSSSLWVRASF
Trigger: AAAACTCGCCCTGACCCAGAGGCTGGAGGACTTAGAGTTTGACCATGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCAAGAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000552160.2
ENST00000552226.1
ENST00000652176.1
CDS-3UTR CAA 90 bp CAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCAAAGTTGTTTTCATCATACTGCTGTTaGAGGGTCAGCTTCTCCTCC +
Preference number: 5 (lower is better)
Translates to: QPRSEVKSRQWDHPAKLFSSYCC*RVSFSS
Trigger: GGAGGAGAAGCTGACCCTCAAACAGCAGTATGATGA...AAACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp GTGTCAGGACTGACAGTTGGGCAGTCTTGCCTCCCGGCTAGTTGTGAGCACTGTTATGCTGGTCATCTTTaGCAACTCCTTCTCCATGTG +
Preference number: 5 (lower is better)
Translates to: VSGLTVGQSCLPASCEHCYAGHL*QLLLHV
Trigger: CACATGGAGAAGGAGTTGCAAAAGATGACCAGCATA...ACAGTGCTCACAACTAGCCGGGAGGCAAGACTGCCCAACTGTCAGTCCTGACAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGGTTCAGATGAGGTCCTaGTTTCTACCGGGGATGACA +
Preference number: 5 (lower is better)
Translates to: GSILCVATKLPPQMFVHRVQMRS*FLPGMT
Trigger: TGTCATCCCCGGTAGAAACAAGGACCTCATCTGAAC...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTCAGCTGTCTGCTTGTaGGCTTTCAACACCGCCCTC +
Preference number: 5 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGSAVCL*AFNTAL
Trigger: GAGGGCGGTGTTGAAAGCCAACAAGCAGACAGCTGA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTTTCCAAGTTTGCCTTaGCTGCGTCGGGACTGCTCA +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWFPSLP*LRRDCS
Trigger: TGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAAA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGTTAGGGCTGCCGATCTaGCTCTTTCCAAGTTTGCCT +
Preference number: 5 (lower is better)
Translates to: GSILCVATKLPPQMFVHRLGLPI*LFPSLP
Trigger: AGGCAAACTTGGAAAGAGCAAGATCGGCAGCCCTAA...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTGAGCCGGTGCCCTaGGATGAATTCACTCATGGA +
Preference number: 5 (lower is better)
Translates to: SNNREENTRWILGSILCVAEPVP*DEFTHG
Trigger: TCCATGAGTGAATTCATCCAAGGGCACCGGCTCAGC...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000395758.3
ENST00000652176.1
CDS-3UTR CAA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGAACACCCGCTGGATCTaGGGCAGTATCCTGTGTGTG +
Preference number: 5 (lower is better)
Translates to: SNNREENTRWILGSILCVNTRWI*GSILCV
Trigger: CACACACAGGATACTGCCCAAGATCCAGCGGGTGTT...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CCAGCCTCGCTCCGAGGTGAAATCAAGGCAGTGGGATCACCCAGCAAAGTTGTTGATCACCCAGCAAAGTaGTTTTTCTTCTGCAGCCCA +
Preference number: 5 (lower is better)
Translates to: PASLRGEIKAVGSPSKVVDHPAK*FFFCSP
Trigger: TGGGCTGCAGAAGAAAAACAACTTTGCTGGGTGATC...AACAACTTTGCTGGGTGATCCCACTGCCTTGATTTCACCTCGGAGCGAGGCTGG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCATGTGGCAGCCTGAGTTaGAACCCACCACAGTTCCTT +
Preference number: 5 (lower is better)
Translates to: RLPDKDKESGLGAIVWAACGSLS*NPPQFL
Trigger: AAGGAACTGTGGTGGGTTCAAACTCAGGCTGCCACA...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTCTCCGTGAGCTCCTaGGTTAGCCTCTCTATCTCA +
Preference number: 5 (lower is better)
Translates to: LPSLCQMGLVRSSLSHQGVSVSS*VSLSIS
Trigger: TGAGATAGAGAGGCTAACCAAGGAGCTCACGGAGAC...TCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAATCATCATACTGCTGTTaGAGGGTCAGCTTCTCCTCC +
Preference number: 5 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQSSYCC*RVSFSS
Trigger: GGAGGAGAAGCTGACCCTCAAACAGCAGTATGATGA...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGCTCCTTCCGCAGGTaGTTCTTTTGCTCTCTTTCA +
Preference number: 5 (lower is better)
Translates to: GSILCVATKLPPQMFVHRSSFRR*FFCSLS
Trigger: TGAAAGAGAGCAAAAGAACAACCTGCGGAAGGAGCT...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAATCCGTCAGTGCCCCCTaGGTGTGTTCCAGCTGTGTC +
Preference number: 5 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKSVSAP*VCSSCV
Trigger: GACACAGCTGGAACACACCAAGGGGGCACTGACGGA...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCAGGCCCCTCATGGCATaGACGTGCTCTGTGAGCCGG +
Preference number: 5 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVRPLMA*TCSVSR
Trigger: CCGGCTCACAGAGCACGTCAATGCCATGAGGGGCCT...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCACCGTCCAGCTCAGCCTaGAGCTCCTTGCTGCTTTGC +
Preference number: 5 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPPSSSA*SSLLLC
Trigger: GCAAAGCAGCAAGGAGCTCAAGGCTGAGCTGGACGG...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCCCGAGCCGCTGCTCTTaGACGAGACAGTTGCAAGGA +
Preference number: 5 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSPSRCS*TRQLQG
Trigger: TCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCGG...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCACCTCAGCTGTCTGCTaGTTGGCTTTCAACACCGCC +
Preference number: 5 (lower is better)
Translates to: WDQGELLINSVGRKPLKSTSAVC*LAFNTA
Trigger: GGCGGTGTTGAAAGCCAACAAGCAGACAGCTGAGGT...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp TTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGACAGGCCAAACAGCCATaGCCTCCCAAATTCCAGCTT +
Preference number: 5 (lower is better)
Translates to: LPSLCQMGLVRSSLSHQGQAKQP*PPKFQL
Trigger: AAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTG...TCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp CCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAGCTTATATATTCCCAGAAGAGCCTCATTaGAAATGCAACACTACCCAC +
Preference number: 5 (lower is better)
Translates to: PSPAGQTAIASQIPAYIFPEEPH*KCNTTH
Trigger: GTGGGTAGTGTTGCATTTCAAATGAGGCTCTTCTGG...GAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp GAAGTCTTTTCCGCTCCTCTAGGAAACCTTAGTTGCTTCCTCTGCATTGTTCTCCACTGTGCCTGCTTGTaGGCTTTCAACACCGCCCTC +
Preference number: 5 (lower is better)
Translates to: EVFSAPLGNLSCFLCIVLHCACL*AFNTAL
Trigger: GAGGGCGGTGTTGAAAGCCAACAAGCAGGCACAGTG...GAGAACAATGCAGAGGAAGCAACTAAGGTTTCCTAGAGGAGCGGAAAAGACTTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CAA 90 bp GTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAGATTGTGGCAGCCTGAGTTaGAACCCACCACAGTTCCTT +
Preference number: 5 (lower is better)
Translates to: VSCVWLQNFHPRCSSTGDCGSLS*NPPQFL
Trigger: AAGGAACTGTGGTGGGTTCAAACTCAGGCTGCCACA...ATCTCCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS CCA 90 bp TTTGCAACTCCTTCTCCATGTGGGCCATCTTCTCACCACTCTCCTTaGTGGTCTTCTCAAGGCTTGTCACCTGCTCATCATACATCTGGA +
Preference number: 5 (lower is better)
Translates to: FATPSPCGPSSHHSP*WSSQGLSPAHHTSG
Trigger: TCCAGATGTATGATGAGCAGGTGACAAGCCTTGAGAAGACCACCAAGGAGAGTGGTGAGAAGATGGCCCACATGGAGAAGGAGTTGCAAA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AGGAACAGCAAGGCCATGCAGGTAGAAAAGAGCAGAAGGTTAGGCTGCTATGGTTCATCATACTGCTGTTaGAGGGTCAGCTTCTCCTCC +
Preference number: 5 (lower is better)
Translates to: RNSKAMQVEKSRRLGCYGSSYCC*RVSFSS
Trigger: GGAGGAGAAGCTGACCCTCAAACAGCAGTATGATGA...ACCATAGCAGCCTAACCTTCTGCTCTTTTCTACCTGCATGGCCTTGCTGTTCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAGGCCCCTCATGGCATaGACGTGCTCTGTGAGCCGG +
Preference number: 5 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFRPLMA*TCSVSR
Trigger: CCGGCTCACAGAGCACGTCAATGCCATGAGGGGCCT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGGAGCTCCTTGCTGCTTaGCAGGCCCCTCATGGCATT +
Preference number: 5 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLELLAA*QAPHGI
Trigger: AATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCTC...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAGAGCTCCTTGCTGCTTaGCAGGCCCCTCATGGCATT +
Preference number: 5 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKELLAA*QAPHGI
Trigger: AATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCTC...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAGCTTTCTGCAGATGCTaGATTTGGTCCCGGATTATG +
Preference number: 5 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQAFCRC*IWSRIM
Trigger: CATAATCCGGGACCAAATCAAGCATCTGCAGAAAGC...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGCCGAGCCGCTGCTCTTaGACGAGACAGTTGCAAGGA +
Preference number: 5 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLPSRCS*TRQLQG
Trigger: TCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCGG...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCAACACCCGCTGGATCTaGGGCAGTATCCTGTGTGTG +
Preference number: 5 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSNTRWI*GSILCV
Trigger: CACACACAGGATACTGCCCAAGATCCAGCGGGTGTT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGAATGCAAATACAACATaGCCGACTGGCAATACTGCC +
Preference number: 5 (lower is better)
Translates to: GSILCVATKLPPQMFVHRNANTT*PTGNTA
Trigger: GGCAGTATTGCCAGTCGGCAATGTTGTATTTGCATT...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp TTAACTAAAATCTGGCCACTGCACCGTACTATGAAGATCGCTGCATaGATACCTTTTCCTCTGAGTGCCACTGCTGACCCGAATGTTGGG +
Preference number: 5 (lower is better)
Translates to: LTKIWPLHRTMKIAA*IPFPLSATADPNVG
Trigger: CCCAACATTCGGGTCAGCAGTGGCACTCAGAGGAAAAGGTATGCATGCAGCGATCTTCATAGTACGGTGCAGTGGCCAGATTTTAGTTAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS CCA 90 bp AGTTGGTGCTCAGCAATCTCTTTCAATCGGATGGCATCTTCCAGCTaGCTGTTCAGCAGTACCGTCTCCTCCTCAAATCGCTTAATCTCA +
Preference number: 5 (lower is better)
Translates to: SWCSAISFNRMASSS*LFSSTVSSSNRLIS
Trigger: TGAGATTAAGCGATTTGAGGAGGAGACGGTACTGCTGAACAGCCAGCTGGAAGATGCCATCCGATTGAAAGAGATTGCTGAGCACCAACT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CCA 90 bp CTCCCATCCTCGGCAAATTTGAGTCCATCTACTGAGATGCTGATATaGTTATCATTGAGGCTGATATACTGGGAGAGCTCCTTCCGCAGG +
Preference number: 5 (lower is better)
Translates to: LPSSANLSPSTEMLI*LSLRLIYWESSFRR
Trigger: CCTGCGGAAGGAGCTCTCCCAGTATATCAGCCTCAATGATAACCATATCAGCATCTCAGTAGATGGACTCAAATTTGCCGAGGATGGGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTGCTCCAGCTCCTGTTaGAGGCTGTCGTACTCAGCC +
Preference number: 5 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLCSSSC*RLSYSA
Trigger: GGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGCA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGCCATCCTCGGCAAATTaGAGTCCATCTACTGAGATG +
Preference number: 5 (lower is better)
Translates to: SNNREENTRWILGSILCVPSSAN*SPSTEM
Trigger: CATCTCAGTAGATGGACTCAAATTTGCCGAGGATGG...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTCCGTCCAGCTCAGCCTaGAGCTCCTTGCTGCTTTGC +
Preference number: 5 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSPSSSA*SSLLLC
Trigger: GCAAAGCAGCAAGGAGCTCAAGGCTGAGCTGGACGG...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCGTTGGACTTGGTTCTTaGCTGGCCTCTGTGCTTTCT +
Preference number: 5 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFVGLGS*LASVLS
Trigger: AGAAAGCACAGAGGCCAGCAAAGAACCAAGTCCAAC...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGTCCATTAAGGCTTCCTaGTCTTTATCAATCATGGGG +
Preference number: 5 (lower is better)
Translates to: GSILCVATKLPPQMFVHRSIKAS*SLSIMG
Trigger: CCCCATGATTGATAAAGACAAGGAAGCCTTAATGGA...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTCAGGGATGAGAAGGTaGCAGCATCTTCTTTCAAAG +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWSGMRR*QHLLSK
Trigger: CTTTGAAAGAAGATGCTGCAACCTTCTCATCCCTGA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGACCAGAAGAGCCTCATTaGAAATGCAACACTACCCAC +
Preference number: 5 (lower is better)
Translates to: LPSLCQMGLVRSSLSHQGPEEPH*KCNTTH
Trigger: GTGGGTAGTGTTGCATTTCAAATGAGGCTCTTCTGG...TCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp GACATCCCCAGGAGGCTGAGTCTTCTGGAAGGCAGGGACCATGTGTTAGTCTTCCCCAAAGCCTCAGTTTaGTTTGTAGATTTGTTTGTC +
Preference number: 5 (lower is better)
Translates to: DIPRRLSLLEGRDHVLVFPKASV*FVDLFV
Trigger: GACAAACAAATCTACAAACAAAACTGAGGCTTTGGG...GAAGACTAACACATGGTCCCTGCCTTCCAGAAGACTCAGCCTCCTGGGGATGTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CAA 90 bp TGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACATTTACGACTTACCATTaGGTCTCTGATGGACCACTC +
Preference number: 5 (lower is better)
Translates to: WAVSCVWLQNFHPRCSSTFTTYH*VSDGPL
Trigger: GAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAAA...TGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGATTGGAAGAAATGTTTaGTGGGTGACCCGGCTTTTC +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWIGRNV*WVTRLF
Trigger: GAAAAGCCGGGTCACCCACAAAACATTTCTTCCAAT...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS TCA 90 bp GCATCTAGCACAGTGCTAGATGGACGGTGCTTCATAAGCATTTACTaGCTTCATCAGAAGGCACTGTGCCTGCTTGTTGGCTTTCAACAC +
Preference number: 5 (lower is better)
Translates to: ASSTVLDGRCFISIY*LHQKALCLLVGFQH
Trigger: GTGTTGAAAGCCAACAAGCAGGCACAGTGCCTTCTGATGAAGTCAGTAAATGCTTATGAAGCACCGTCCATCTAGCACTGTGCTAGATGC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS GCA 90 bp TGGCTGTTCAGCAGTACCGTCTCCTCCTCAAATCGCTTAATCTCATaGTTTAAGCCTTCGTATTCAACCTGGTTCTGCTTCAACGTGGAC +
Preference number: 5 (lower is better)
Translates to: WLFSSTVSSSNRLIS*FKPSYSTWFCFNVD
Trigger: GTCCACGTTGAAGCAGAACCAGGTTGAATACGAAGGCTTAAAGCATGAGATTAAGCGATTTGAGGAGGAGACGGTACTGCTGAACAGCCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTGCTCCAGCTCCTGTTaGAGGCTGTCGTACTCAGCC +
Preference number: 5 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSCSSSC*RLSYSA
Trigger: GGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGCA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTGCCCAAATGCCTCTTaGAGCTGCTCCAGCTCCTGT +
Preference number: 5 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVCPNAS*SCSSSC
Trigger: ACAGGAGCTGGAGCAGCTCAAAGAGGCATTTGGGCA...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGTTTTGTCATCATTGTTaGGTTCACTCCCATCCTCGG +
Preference number: 5 (lower is better)
Translates to: SNNREENTRWILGSILCVFCHHC*VHSHPR
Trigger: CCGAGGATGGGAGTGAACCAAACAATGATGACAAAA...CACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTGTGACTCCTGTAGGTaGGCCAAAAGAATGGCCTTT +
Preference number: 5 (lower is better)
Translates to: WDQGELLINSVGRKPLKSCDSCR*AKRMAF
Trigger: AAAGGCCATTCTTTTGGCCAACCTACAGGAGTCACA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCTGTGACTCCTGTAGGTaGGCCAAAAGAATGGCCTTT +
Preference number: 5 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFCDSCR*AKRMAF
Trigger: AAAGGCCATTCTTTTGGCCAACCTACAGGAGTCACA...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCCGTCAGTGCCCCCTaGGTGTGTTCCAGCTGTGTC +
Preference number: 5 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLSVSAP*VCSSCV
Trigger: GACACAGCTGGAACACACCAAGGGGGCACTGACGGA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGACTGCCACCCTGTATTaGCATTCAAGGATCTCTAAA +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWTATLY*HSRISK
Trigger: TTTAGAGATCCTTGAATGCAAATACAGGGTGGCAGT...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCTCCAGCATGACCCTGTaGGGAGTTTCATTATTACAT +
Preference number: 5 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSSSMTL*GVSLLH
Trigger: ATGTAATAATGAAACTCCCAACAGGGTCATGCTGGA...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATCTTTGACGAGACAGTaGCAAGGACCGGTCCACAGC +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQSLTRQ*QGPVHS
Trigger: GCTGTGGACCGGTCCTTGCAACTGTCTCGTCAAAGA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAAACACCCGCTGGATCTaGGGCAGTATCCTGTGTGTG +
Preference number: 5 (lower is better)
Translates to: TVSLILVLGRYNASEMKTNTRWI*GSILCV
Trigger: CACACACAGGATACTGCCCAAGATCCAGCGGGTGTT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AGATTGCCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAACTTTGTCAAATGGGATaGGTGAGGAGTTCCCTCTCT +
Preference number: 5 (lower is better)
Translates to: RLPSLCQMGLVRSSLSHQLCQMG*VRSSLS
Trigger: AGAGAGGGAACTCCTCACCAATCCCATTTGACAAAG...TTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGGCAATCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATGATCACCCAGCAAAGTaGTTTTTCTTCTGCAGCCCA +
Preference number: 5 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNDHPAK*FFFCSP
Trigger: TGGGCTGCAGAAGAAAAACAACTTTGCTGGGTGATC...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp CCTAGCCTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGATCAAAGCACGTTCATaGTTTTCTCCCATACATCCG +
Preference number: 5 (lower is better)
Translates to: PSLCQMGLVRSSLSHQGVIKARS*FSPIHP
Trigger: CGGATGTATGGGAGAAAACAATGAACGTGCTTTGAT...CACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAGGCTAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR CAA 90 bp CCCTCCCCCGCAGGCCAAACAGCCATTGCCTCCCAAATTCCAGCTTATATATTCTTTGTAAGTGGTTATTaGCTACCCATAGTGCCTCAA +
Preference number: 5 (lower is better)
Translates to: PSPAGQTAIASQIPAYIFFVSGY*LPIVPQ
Trigger: TTGAGGCACTATGGGTAGCAAATAACCACTTACAAA...GAATATATAAGCTGGAATTTGGGAGGCAATGGCTGTTTGGCCTGCGGGGGAGGG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS TCA 90 bp ATTCATTGGCTCTTTGCGGATGTCACTTGTATCCAATACTGGAGATaGCGGTGGGGCAGTAATAACAGGAGAGATTGTGGGGGTCTTAGT +
Preference number: 5 (lower is better)
Translates to: IHWLFADVTCIQYWR*RWGSNNRRDCGGLS
Trigger: ACTAAGACCCCCACAATCTCTCCTGTTATTACTGCCCCACCGTCATCTCCAGTATTGGATACAAGTGACATCCGCAAAGAGCCAATGAAT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTGTCTCCGTGAGCTCCTaGGTTAGCCTCTCTATCTCA +
Preference number: 5 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLVSVSS*VSLSIS
Trigger: TGAGATAGAGAGGCTAACCAAGGAGCTCACGGAGAC...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCTTTTGTCATCATTGTTaGGTTCACTCCCATCCTCGG +
Preference number: 5 (lower is better)
Translates to: WDQGELLINSVGRKPLKSFCHHC*VHSHPR
Trigger: CCGAGGATGGGAGTGAACCAAACAATGATGACAAAA...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGAAGGCCCCTCATGGCATaGACGTGCTCTGTGAGCCGG +
Preference number: 5 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRRPLMA*TCSVSR
Trigger: CCGGCTCACAGAGCACGTCAATGCCATGAGGGGCCT...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGAGCTCCTTGCTGCTTaGCAGGCCCCTCATGGCATT +
Preference number: 5 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFELLAA*QAPHGI
Trigger: AATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCTC...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAGTTCAGATGAGGTCCTaGTTTCTACCGGGGATGACA +
Preference number: 5 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKVQMRS*FLPGMT
Trigger: TGTCATCCCCGGTAGAAACAAGGACCTCATCTGAAC...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCTTTGCGGATGTCACTaGTATCCAATACTGGAGATG +
Preference number: 5 (lower is better)
Translates to: KKTPAGSWAVSCVWLQNFLCGCH*YPILEM
Trigger: CATCTCCAGTATTGGATACAAGTGACATCCGCAAAG...GAAGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCCGAGCCGCTGCTCTTaGACGAGACAGTTGCAAGGA +
Preference number: 5 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTPSRCS*TRQLQG
Trigger: TCCTTGCAACTGTCTCGTCAAAGAGCAGCGGCTCGG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTACCTCAGCTGTCTGCTaGTTGGCTTTCAACACCGCC +
Preference number: 5 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSTSAVC*LAFNTA
Trigger: GGCGGTGTTGAAAGCCAACAAGCAGACAGCTGAGGT...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCACAGGCATATTCATCACATCTaGTTGCAAACATTGCTCTCA +
Preference number: 5 (lower is better)
Translates to: GSILCVATKLPPQMFVHRHIHHI*LQTLLS
Trigger: TGAGAGCAATGTTTGCAACAAGATGTGATGAATATG...CCTGTGGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTTGCTCTTTCCAAGTTaGCCTTTGCTGCGTCGGGAC +
Preference number: 5 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLLLFPS*PLLRRD
Trigger: GTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCAA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACATTGCTCTTTCCAAGTTaGCCTTTGCTGCGTCGGGAC +
Preference number: 5 (lower is better)
Translates to: YPCPVKEKLINSTISKGTLLFPS*PLLRRD
Trigger: GTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCAA...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAATTAGGGCTGCCGATCTaGCTCTTTCCAAGTTTGCCT +
Preference number: 5 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKLGLPI*LFPSLP
Trigger: AGGCAAACTTGGAAAGAGCAAGATCGGCAGCCCTAA...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCATTAGGGCTGCCGATCTaGCTCTTTCCAAGTTTGCCT +
Preference number: 5 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPLGLPI*LFPSLP
Trigger: AGGCAAACTTGGAAAGAGCAAGATCGGCAGCCCTAA...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATTACATTCCAACCCACTaGAATGTCGTCTTAGAGTGC +
Preference number: 5 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNYIPTH*NVVLEC
Trigger: GCACTCTAAGACGACATTCAAGTGGGTTGGAATGTA...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp ATTACAGCATGTGTAACGTTGAACTGTAATTGTGTTTCTATCCTGACATCCCCAAGGCACTGTGCCTGCTaGTTGGCTTTCAACACCGCC +
Preference number: 5 (lower is better)
Translates to: ITACVTLNCNCVSILTSPRHCAC*LAFNTA
Trigger: GGCGGTGTTGAAAGCCAACAAGCAGGCACAGTGCCT...TGGGGATGTCAGGATAGAAACACAATTACAGTTCAACGTTACACATGCTGTAAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CAA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTTGTGTGGGCAGCACTaGATGGTTAAGGAGCCCGAG +
Preference number: 5 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYLCGQH*MVKEPE
Trigger: CTCGGGCTCCTTAACCATCAAGTGCTGCCCACACAA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AGGCTACCTGACAAAGACAAGGAATCAGGGCTAGGAGCAATTGTGTGGGCAGCAACCATATCAATGTATTaGTGGCAGCCTGAGTTTGAA +
Preference number: 5 (lower is better)
Translates to: RLPDKDKESGLGAIVWAATISMY*WQPEFE
Trigger: TTCAAACTCAGGCTGCCACAAATACATTGATATGGT...TGCTGCCCACACAATTGCTCCTAGCCCTGATTCCTTGTCTTTGTCAGGTAGCCT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS TCA 90 bp TTTACACATCATCAAAGGTATACTCTGCAGCTGGGTGAGCCTGAGTaGCCGGAAGGAAGGGGAGAGTCTATTCAACTAATCATTTGCATC +
Preference number: 5 (lower is better)
Translates to: FTHHQRYTLQLGEPE*PEGRGESIQLIICI
Trigger: GATGCAAATGATTAGTTGAATAGACTCTCCCCTTCCTTCCGGTCACTCAGGCTCACCCAGCTGCAGAGTATACCTTTGATGATGTGTAAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552226.1
CDS CCA 90 bp TTGACTTATAGGAATTTACACATCATCAAAGGTATACTCTGCAGCTaGGTGAGCCTGAGTGACCGGAAGGAAGGGGAGAGTCTATTCAAC +
Preference number: 5 (lower is better)
Translates to: LTYRNLHIIKGILCS*VSLSDRKEGESLFN
Trigger: GTTGAATAGACTCTCCCCTTCCTTCCGGTCACTCAGGCTCACCCAGCTGCAGAGTATACCTTTGATGATGTGTAAATTCCTATAAGTCAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552226.1
CDS-3UTR CAA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTGCCCAAATGCCTCTTaGAGCTGCTCCAGCTCCTGT +
Preference number: 5 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTCPNAS*SCSSSC
Trigger: ACAGGAGCTGGAGCAGCTCAAAGAGGCATTTGGGCA...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGCTGATATGGTTATCATaGAGGCTGATATACTGGGAG +
Preference number: 5 (lower is better)
Translates to: CTSNNREENTRWILGSILLIWLS*RLIYWE
Trigger: CTCCCAGTATATCAGCCTCAATGATAACCATATCAG...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATCCGTCAGTGCCCCCTaGGTGTGTTCCAGCTGTGTC +
Preference number: 5 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQSVSAP*VCSSCV
Trigger: GACACAGCTGGAACACACCAAGGGGGCACTGACGGA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAGTTGGACTTGGTTCTTaGCTGGCCTCTGTGCTTTCT +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQVGLGS*LASVLS
Trigger: AGAAAGCACAGAGGCCAGCAAAGAACCAAGTCCAAC...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCATATTCATTGGCTCTTaGCGGATGTCACTTGTATCC +
Preference number: 5 (lower is better)
Translates to: WDQGELLINSVGRKPLKSIFIGS*RMSLVS
Trigger: GGATACAAGTGACATCCGCAAAGAGCCAATGAATAT...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000395758.3
CDS-3UTR CAA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCGGTTGTAGATATTCATaGGCTCTTTGCGGATGTCAC +
Preference number: 5 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSGCRYS*ALCGCH
Trigger: GTGACATCCGCAAAGAGCCAATGAATATCTACAACC...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCACTGCAGATGCTTGATTaGGTCCCGGATTATGGCATT +
Preference number: 5 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPLQMLD*VPDYGI
Trigger: AATGCCATAATCCGGGACCAAATCAAGCATCTGCAG...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAGCTTTCTGCAGATGCTaGATTTGGTCCCGGATTATG +
Preference number: 5 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKAFCRC*IWSRIM
Trigger: CATAATCCGGGACCAAATCAAGCATCTGCAGAAAGC...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTCCATTAAGGCTTCCTaGTCTTTATCAATCATGGGG +
Preference number: 5 (lower is better)
Translates to: CTSNNREENTRWILGSILSIKAS*SLSIMG
Trigger: CCCCATGATTGATAAAGACAAGGAAGCCTTAATGGA...CAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCAGCTGTCTGCTTGTaGGCTTTCAACACCGCCCTC +
Preference number: 5 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLSAVCL*AFNTAL
Trigger: GAGGGCGGTGTTGAAAGCCAACAAGCAGACAGCTGA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TATCCTTGCCCCGTTAAAGAGAAGCTGATAAACAGCACCATTTCCAAAGGTACATTAGGGCTGCCGATCTaGCTCTTTCCAAGTTTGCCT +
Preference number: 5 (lower is better)
Translates to: YPCPVKEKLINSTISKGTLGLPI*LFPSLP
Trigger: AGGCAAACTTGGAAAGAGCAAGATCGGCAGCCCTAA...TGTACCTTTGGAAATGGTGCTGTTTATCAGCTTCTCTTTAACGGGGCAAGGATA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp CTTTGTCAAATGGGATTGGTGAGGAGTTCCCTCTCTCACCAAGGAGTGGTTACACAAACCTCATCACTTTaGTGGACTACGAAATTGTCG +
Preference number: 5 (lower is better)
Translates to: LCQMGLVRSSLSHQGVVTQTSSL*WTTKLS
Trigger: CGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTG...TGTAACCACTCCTTGGTGAGAGAGGGAACTCCTCACCAATCCCATTTGACAAAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp CTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGTCAATGACAAACATATaGGAATCAACTTCCCTAGCT +
Preference number: 5 (lower is better)
Translates to: LTTEKKTPAGSWAVSCVWSMTNI*ESTSLA
Trigger: AGCTAGGGAAGTTGATTCCAATATGTTTGTCATTGA...CCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAACGTCCTGGTTGCTTaGGTAATAGCGACCACTACT +
Preference number: 5 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKNVLVA*VIATTT
Trigger: AGTAGTGGTCGCTATTACCAAAGCAACCAGGACGTT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTTCCACCCCAGATGTTCGTCCCACATTCTTAGGTTATaGGACCAATGTTTCATGCTT +
Preference number: 5 (lower is better)
Translates to: SWAVSCVWLQNFHPRCSSHILRL*DQCFML
Trigger: AAGCATGAAACATTGGTCCAATAACCTAAGAATGTG...GGACGAACATCTGGGGTGGAAGTTTTGTAGCCACACACAGGATACTGCCCAAGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAACTCATAGTCAAACCATaGAGCTTTAACATTTTGTGG +
Preference number: 5 (lower is better)
Translates to: TEKKTPAGSWAVSCVWLQLIVKP*SFNILW
Trigger: CCACAAAATGTTAAAGCTCAATGGTTTGACTATGAG...TTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS GCA 90 bp TTTTACTTGACTTATAGGAATTTACACATCATCAAAGGTATACTCTaGAGCTGGGTGAGCCTGAGTGACCGGAAGGAAGGGGAGAGTCTA +
Preference number: 5 (lower is better)
Translates to: FYLTYRNLHIIKGIL*SWVSLSDRKEGESL
Trigger: TAGACTCTCCCCTTCCTTCCGGTCACTCAGGCTCACCCAGCTGCAGAGTATACCTTTGATGATGTGTAAATTCCTATAAGTCAAGTAAAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552226.1
CDS-3UTR CAA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTGTCTCCGTGAGCTCCTaGGTTAGCCTCTCTATCTCA +
Preference number: 5 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLVSVSS*VSLSIS
Trigger: TGAGATAGAGAGGCTAACCAAGGAGCTCACGGAGAC...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGTATGTTCTTAAGAGTGACTGATAGGAAATCAAAGCACGTTCATTGTTTTCTCTGCTCCAGCTCCTGTTaGAGGCTGTCGTACTCAGCC +
Preference number: 5 (lower is better)
Translates to: CMFLRVTDRKSKHVHCFLCSSSC*RLSYSA
Trigger: GGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGCA...GAGAAAACAATGAACGTGCTTTGATTTCCTATCAGTCACTCTTAAGAACATACA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR CAA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATGCTCCAGCTCCTGTTaGAGGCTGTCGTACTCAGCC +
Preference number: 5 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQCSSSC*RLSYSA
Trigger: GGCTGAGTACGACAGCCTCAAACAGGAGCTGGAGCA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCTGTGACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCAGCTCCACCATCTCATaGTTCTCCTTCAGATCCTGC +
Preference number: 5 (lower is better)
Translates to: ICDSEKPQNVLSHQGLCFSSTIS*FSFRSC
Trigger: GCAGGATCTGAAGGAGAACAATGAGATGGTGGAGCT...GAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGTCACAGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTAGCTCCTTCCGCAGGTaGTTCTTTTGCTCTCTTTCA +
Preference number: 5 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLSSFRR*FFCSLS
Trigger: TGAAAGAGAGCAAAAGAACAACCTGCGGAAGGAGCT...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAAGCTCCTTCCGCAGGTaGTTCTTTTGCTCTCTTTCA +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQSSFRR*FFCSLS
Trigger: TGAAAGAGAGCAAAAGAACAACCTGCGGAAGGAGCT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAACTTTGCGGATGTCACTaGTATCCAATACTGGAGATG +
Preference number: 5 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKLCGCH*YPILEM
Trigger: CATCTCCAGTATTGGATACAAGTGACATCCGCAAAG...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCTTTGCGGATGTCACTaGTATCCAATACTGGAGATG +
Preference number: 5 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDLCGCH*YPILEM
Trigger: CATCTCCAGTATTGGATACAAGTGACATCCGCAAAG...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATATTCATTGGCTCTTaGCGGATGTCACTTGTATCC +
Preference number: 5 (lower is better)
Translates to: SNCTSNNREENTRWILGSIFIGS*RMSLVS
Trigger: GGATACAAGTGACATCCGCAAAGAGCCAATGAATAT...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAACTGCAGATGCTTGATTaGGTCCCGGATTATGGCATT +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQLQMLD*VPDYGI
Trigger: AATGCCATAATCCGGGACCAAATCAAGCATCTGCAG...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTTTCCAAGTTTGCCTTaGCTGCGTCGGGACTGCTCA +
Preference number: 5 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFFPSLP*LRRDCS
Trigger: TGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAAA...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
44% GC, longest homopolymer 6 nt, total homopolymer stretches 14 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTTTCCAAGTTTGCCTTaGCTGCGTCGGGACTGCTCA +
Preference number: 5 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLFPSLP*LRRDCS
Trigger: TGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAAA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTTGCTCTTTCCAAGTTaGCCTTTGCTGCGTCGGGAC +
Preference number: 5 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLLLFPS*PLLRRD
Trigger: GTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCAA...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTTGCTCTTTCCAAGTTaGCCTTTGCTGCGTCGGGAC +
Preference number: 5 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFLLFPS*PLLRRD
Trigger: GTCCCGACGCAGCAAAGGCAAACTTGGAAAGAGCAA...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATGCGGTTTTGAGAAGTTaGATTTATACATTCCAACCC +
Preference number: 5 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNAVLRS*IYTFQP
Trigger: GGGTTGGAATGTATAAATCAAACTTCTCAAAACCGC...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp CTGAAATTGTGGGTCCTCAGGCACAAACCTCATCACTTTTGTGGACTACGAAATTTGTGGACTACGAAATaGTCGCTGAAACCTGGGTTT +
Preference number: 5 (lower is better)
Translates to: LKLWVLRHKPHHFCGLRNLWTTK*SLKPGF
Trigger: AAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAA...ATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGCCTGAGGACCCACAATTTCAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp TCACCAAGGAGTGGTTACATCCAGAGGAAAGCTGAGGTGCCACACAGTCTAAATACACTACCCACGTATTaGATATACACCACTCTTTCA +
Preference number: 5 (lower is better)
Translates to: SPRSGYIQRKAEVPHSLNTLPTY*IYTTLS
Trigger: TGAAAGAGTGGTGTATATCAAATACGTGGGTAGTGT...ATTTAGACTGTGTGGCACCTCAGCTTTCCTCTGGATGTAACCACTCCTTGGTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGAAATCAAGAGGAGGGATaGGGCAGGGGGTTAGAAAGG +
Preference number: 5 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGNQEEG*GRGLER
Trigger: CCTTTCTAACCCCCTGCCCAATCCCTCCTCTTGATT...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCAGGATACAACCCTATTaGGAAACTGTTCTGGATACT +
Preference number: 5 (lower is better)
Translates to: WDQGELLINSVGRKPLKSRIQPY*ETVLDT
Trigger: AGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCT...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp GCACAAACCTCATCACTTTTGTGGACTACGAAATTGTCGCTGAAACCTGGGTTTCTCCTTTATGACTTCTaGATCATGATGAGTGGGCCT +
Preference number: 5 (lower is better)
Translates to: AQTSSLLWTTKLSLKPGFLLYDF*IMMSGP
Trigger: AGGCCCACTCATCATGATCAAGAAGTCATAAAGGAG...AAACCCAGGTTTCAGCGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTGTGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000551848.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAAAACGTCCTGGTTGCTTaGGTAATAGCGACCACTACT +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQNVLVA*VIATTT
Trigger: AGTAGTGGTCGCTATTACCAAAGCAACCAGGACGTT...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGAGTTCATTCTTTTaGGTTCTCACTAGTTCTGCC +
Preference number: 5 (lower is better)
Translates to: HQGLCFVFFSTFSRLPKRWSSFF*VLTSSA
Trigger: GGCAGAACTAGTGAGAACCAAAAAGAATGAACTCCA...TCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS TCA 90 bp ATTGTTTGGTTCACTCCCATCCTCGGCAAATTTGAGTCCATCTACTaGGATGCTGATATGGTTATCATTGAGGCTGATATACTGGGAGAG +
Preference number: 5 (lower is better)
Translates to: IVWFTPILGKFESIY*DADMVIIEADILGE
Trigger: CTCTCCCAGTATATCAGCCTCAATGATAACCATATCAGCATCTCAGTAGATGGACTCAAATTTGCCGAGGATGGGAGTGAACCAAACAAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATTCATCATACTGCTGTTaGAGGGTCAGCTTCTCCTCC +
Preference number: 5 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYSSYCC*RVSFSS
Trigger: GGAGGAGAAGCTGACCCTCAAACAGCAGTATGATGA...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTCATCATACTGCTGTTaGAGGGTCAGCTTCTCCTCC +
Preference number: 5 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTSSYCC*RVSFSS
Trigger: GGAGGAGAAGCTGACCCTCAAACAGCAGTATGATGA...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCAGCTCCACCATCTCATaGTTCTCCTTCAGATCCTGC +
Preference number: 5 (lower is better)
Translates to: TKCFITSGSVLRVLLNFLSSTIS*FSFRSC
Trigger: GCAGGATCTGAAGGAGAACAATGAGATGGTGGAGCT...GAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACTGATATGGTTATCATaGAGGCTGATATACTGGGAG +
Preference number: 5 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKLIWLS*RLIYWE
Trigger: CTCCCAGTATATCAGCCTCAATGATAACCATATCAG...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACATTTTGTCATCATTGTTaGGTTCACTCCCATCCTCGG +
Preference number: 5 (lower is better)
Translates to: TVSLILVLGRYNASEMKTFCHHC*VHSHPR
Trigger: CCGAGGATGGGAGTGAACCAAACAATGATGACAAAA...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAAGAGCAGAAGGTTAGGCTGCTATGGTTGGGAACTTCATGTCGAATCGTTTTGACTGCCACCCTGTATTaGCATTCAAGGATCTCTAAA +
Preference number: 5 (lower is better)
Translates to: KEQKVRLLWLGTSCRIVLTATLY*HSRISK
Trigger: TTTAGAGATCCTTGAATGCAAATACAGGGTGGCAGT...CAAAACGATTCGACATGAAGTTCCCAACCATAGCAGCCTAACCTTCTGCTCTTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACTGCCACCCTGTATTaGCATTCAAGGATCTCTAAA +
Preference number: 5 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKTATLY*HSRISK
Trigger: TTTAGAGATCCTTGAATGCAAATACAGGGTGGCAGT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATATGCTGGTCATCTTTaGCAACTCCTTCTCCATGTG +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQYAGHL*QLLLHV
Trigger: CACATGGAGAAGGAGTTGCAAAAGATGACCAGCATA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTGTTCAGATGAGGTCCTaGTTTCTACCGGGGATGACA +
Preference number: 5 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFVQMRS*FLPGMT
Trigger: TGTCATCCCCGGTAGAAACAAGGACCTCATCTGAAC...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCGGTTGTAGATATTCATaGGCTCTTTGCGGATGTCAC +
Preference number: 5 (lower is better)
Translates to: MFYHIRVCASCSSQLSLVGCRYS*ALCGCH
Trigger: GTGACATCCGCAAAGAGCCAATGAATATCTACAACC...GACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATCTTTGACGAGACAGTaGCAAGGACCGGTCCACAGC +
Preference number: 5 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQSLTRQ*QGPVHS
Trigger: GCTGTGGACCGGTCCTTGCAACTGTCTCGTCAAAGA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAAATTCATCACATCTTGTaGCAAACATTGCTCTCAGGG +
Preference number: 5 (lower is better)
Translates to: SHQGLCFVFFSTFSRLPKIHHIL*QTLLSG
Trigger: CCCTGAGAGCAATGTTTGCAACAAGATGTGATGAAT...TTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCATATTCATCACATCTaGTTGCAAACATTGCTCTCA +
Preference number: 5 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTHIHHI*LQTLLS
Trigger: TGAGAGCAATGTTTGCAACAAGATGTGATGAATATG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATTTTCCAAGTTTGCCTTaGCTGCGTCGGGACTGCTCA +
Preference number: 5 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYFPSLP*LRRDCS
Trigger: TGAGCAGTCCCGACGCAGCAAAGGCAAACTTGGAAA...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAAGCTGAGCCGGTGCCCTaGGATGAATTCACTCATGGA +
Preference number: 5 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQAEPVP*DEFTHG
Trigger: TCCATGAGTGAATTCATCCAAGGGCACCGGCTCAGC...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000652176.1
CDS-3UTR CAA 90 bp TCCAATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATGAACTGTAGCCATTaGATGGCAGAAGTTTATCTG +
Preference number: 5 (lower is better)
Translates to: SNCTSNNREENTRWILGSMNCSH*MAEVYL
Trigger: CAGATAAACTTCTGCCATCAAATGGCTACAGTTCAT...ACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAATTGGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATTGTACATCTAACAACCGAGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCATGAACTGTAGCCATTaGATGGCAGAAGTTTATCTG +
Preference number: 5 (lower is better)
Translates to: IVHLTTEKKTPAGSWAVSMNCSH*MAEVYL
Trigger: CAGATAAACTTCTGCCATCAAATGGCTACAGTTCAT...GGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCTCGGTTGTTAGATGTACAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TGGGATCAGGGGGAACTCTTAATAAATTCTGTAGGTAGGAAGCCCCTGAAGTCCAAGGTGAAAATTGTCTaGCAGGAGATCCAAGAAAAA +
Preference number: 5 (lower is better)
Translates to: WDQGELLINSVGRKPLKSKVKIV*QEIQEK
Trigger: TTTTTCTTGGATCTCCTGCAAGACAATTTTCACCTT...GGACTTCAGGGGCTTCCTACCTACAGAATTTATTAAGAGTTCCCCCTGATCCCA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGATTGTGTGGGCAGCACTaGATGGTTAAGGAGCCCGAG +
Preference number: 5 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRLCGQH*MVKEPE
Trigger: CTCGGGCTCCTTAACCATCAAGTGCTGCCCACACAA...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AGAAGAAAACACCCGCTGGATCTTGGGCAGTATCCTGTGTGTGGCTACAAAACTCACATTCTTAGGTTATaGGACCAATGTTTCATGCTT +
Preference number: 5 (lower is better)
Translates to: RRKHPLDLGQYPVCGYKTHILRL*DQCFML
Trigger: AAGCATGAAACATTGGTCCAATAACCTAAGAATGTG...AGTTTTGTAGCCACACACAGGATACTGCCCAAGATCCAGCGGGTGTTTTCTTCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTATGCTGGTCATCTTTaGCAACTCCTTCTCCATGTG +
Preference number: 5 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSYAGHL*QLLLHV
Trigger: CACATGGAGAAGGAGTTGCAAAAGATGACCAGCATA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTAGTTGGACTTGGTTCTTaGCTGGCCTCTGTGCTTTCT +
Preference number: 5 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVVGLGS*LASVLS
Trigger: AGAAAGCACAGAGGCCAGCAAAGAACCAAGTCCAAC...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAATATTCATTGGCTCTTaGCGGATGTCACTTGTATCC +
Preference number: 5 (lower is better)
Translates to: TVSLILVLGRYNASEMKTIFIGS*RMSLVS
Trigger: GGATACAAGTGACATCCGCAAAGAGCCAATGAATAT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACGGTTGTAGATATTCATaGGCTCTTTGCGGATGTCAC +
Preference number: 5 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYGCRYS*ALCGCH
Trigger: GTGACATCCGCAAAGAGCCAATGAATATCTACAACC...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTCTGCAGATGCTTGATTaGGTCCCGGATTATGGCATT +
Preference number: 5 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTLQMLD*VPDYGI
Trigger: AATGCCATAATCCGGGACCAAATCAAGCATCTGCAG...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTGCTTTCTGCAGATGCTaGATTTGGTCCCGGATTATG +
Preference number: 5 (lower is better)
Translates to: KPQNVLSHQGLCFVFFSTAFCRC*IWSRIM
Trigger: CATAATCCGGGACCAAATCAAGCATCTGCAGAAAGC...AGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCAGGGATGAGAAGGTaGCAGCATCTTCTTTCAAAG +
Preference number: 5 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSSGMRR*QHLLSK
Trigger: CTTTGAAAGAAGATGCTGCAACCTTCTCATCCCTGA...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACAGTCTCACTAATACTGGTACTAGGCAGATACAACGCCAGTGAAATGAAGACAATTCATCACATCTTGTaGCAAACATTGCTCTCAGGG +
Preference number: 5 (lower is better)
Translates to: TVSLILVLGRYNASEMKTIHHIL*QTLLSG
Trigger: CCCTGAGAGCAATGTTTGCAACAAGATGTGATGAAT...TGTCTTCATTTCACTGGCGTTGTATCTGCCTAGTACCAGTATTAGTGAGACTGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAATGAACTGTAGCCATTaGATGGCAGAAGTTTATCTG +
Preference number: 5 (lower is better)
Translates to: ITSGSVLRVLLNFLSSSKMNCSH*MAEVYL
Trigger: CAGATAAACTTCTGCCATCAAATGGCTACAGTTCAT...TTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATCTTTGTCAAATGGGATaGGTGAGGAGTTCCCTCTCT +
Preference number: 5 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYLCQMG*VRSSLS
Trigger: AGAGAGGGAACTCCTCACCAATCCCATTTGACAAAG...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp GTAGAACACAGCTTCATTCTTAATATCCACCTTTATCTACCAATTCTCAGGTTGCTACCAATTCTCAGGTaGGAGGTAAGGGAGAGGCAT +
Preference number: 5 (lower is better)
Translates to: VEHSFILNIHLYLPILRLLPILR*EVRERH
Trigger: ATGCCTCTCCCTTACCTCCAACCTGAGAATTGGTAG...CAACCTGAGAATTGGTAGATAAAGGTGGATATTAAGAATGAAGCTGTGTTCTAC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACATTGGAAGAAATGTTTaGTGGGTGACCCGGCTTTTC +
Preference number: 5 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYIGRNV*WVTRLF
Trigger: GAAAAGCCGGGTCACCCACAAAACATTTCTTCCAAT...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAACCATATCAATGTATTaGTGGCAGCCTGAGTTTGAA +
Preference number: 5 (lower is better)
Translates to: LSHQGLCFVFFSTFSRLPTISMY*WQPEFE
Trigger: TTCAAACTCAGGCTGCCACAAATACATTGATATGGT...TGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS TCA 90 bp GGTGACATATTCATCACATCTTGTTGCAAACATTGCTCTCAGGGATaGGAAGGTTGCAGCATCTTCTTTCAAAGCCTTCAGTTCATTTCT +
Preference number: 5 (lower is better)
Translates to: GDIFITSCCKHCSQG*EGCSIFFQSLQFIS
Trigger: AGAAATGAACTGAAGGCTTTGAAAGAAGATGCTGCAACCTTCTCATCCCTGAGAGCAATGTTTGCAACAAGATGTGATGAATATGTCACC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000552160.2
ENST00000652176.1
CDS CCA 90 bp TCCTCCACAACAAGAGCACATTTATTTTTGCAGTTAACTAAAATCTaGCCACTGCACCGTACTATGAAGATCGCTGCATGCATACCTTTT +
Preference number: 5 (lower is better)
Translates to: SSTTRAHLFLQLTKI*PLHRTMKIAACIPF
Trigger: AAAAGGTATGCATGCAGCGATCTTCATAGTACGGTGCAGTGGCCAGATTTTAGTTAACTGCAAAAATAAATGTGCTCTTGTTGTGGAGGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp ACTCAGAGAAACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTCTGATATGGTTATCATaGAGGCTGATATACTGGGAG +
Preference number: 5 (lower is better)
Translates to: TQRNHKMFYHIRVCASCSLIWLS*RLIYWE
Trigger: CTCCCAGTATATCAGCCTCAATGATAACCATATCAG...AGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTTTCTCTGAGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTTTCATTTTGTCATCATaGTTTGGTTCACTCCCATCC +
Preference number: 5 (lower is better)
Translates to: VLSHQGLCFVFFSTFSRLFILSS*FGSLPS
Trigger: GGATGGGAGTGAACCAAACAATGATGACAAAATGAA...AAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAATTCATTTTGTCATCATaGTTTGGTTCACTCCCATCC +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQFILSS*FGSLPS
Trigger: GGATGGGAGTGAACCAAACAATGATGACAAAATGAA...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGATGTGACTCCTGTAGGTaGGCCAAAAGAATGGCCTTT +
Preference number: 5 (lower is better)
Translates to: DELNFRHNSSEGIITDNGCDSCR*AKRMAF
Trigger: AAAGGCCATTCTTTTGGCCAACCTACAGGAGTCACA...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCAGGGATGAGAAGGTaGCAGCATCTTCTTTCAAAG +
Preference number: 5 (lower is better)
Translates to: NHKMFYHIRVCASCSSQLSGMRR*QHLLSK
Trigger: CTTTGAAAGAAGATGCTGCAACCTTCTCATCCCTGA...AAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTGTCGCTGAAACCTGGGTTTGAGATAACAGCGGTTTTGAGAAGTTTGATTTATTACATTCCAACCCACTaGAATGTCGTCTTAGAGTGC +
Preference number: 5 (lower is better)
Translates to: LSLKPGFEITAVLRSLIYYIPTH*NVVLEC
Trigger: GCACTCTAAGACGACATTCAAGTGGGTTGGAATGTA...ATAAATCAAACTTCTCAAAACCGCTGTTATCTCAAACCCAGGTTTCAGCGACAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp ATGACTAAAGCCAAGCAGAATGAAGATTGCCTAGCCTTTGTCAAATGGGATTGGGCGGTTTTGAGAAGTTaGATTTATACATTCCAACCC +
Preference number: 5 (lower is better)
Translates to: MTKAKQNEDCLAFVKWDWAVLRS*IYTFQP
Trigger: GGGTTGGAATGTATAAATCAAACTTCTCAAAACCGC...CCAATCCCATTTGACAAAGGCTAGGCAATCTTCATTCTGCTTGGCTTTAGTCAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp TTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCTGAGACTTGATGACCAAACCTCATCACTTTaGTGGACTACGAAATTGTCG +
Preference number: 5 (lower is better)
Translates to: FIHSNPLECRLRVLRLDDQTSSL*WTTKLS
Trigger: CGACAATTTCGTAGTCCACAAAAGTGATGAGGTTTG...GTCATCAAGTCTCAGCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTTTTACGACTTACCATTaGGTCTCTGATGGACCACTC +
Preference number: 5 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFFTTYH*VSDGPL
Trigger: GAGTGGTCCATCAGAGACCAAATGGTAAGTCGTAAA...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
41% GC, longest homopolymer 6 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GATGAACTTAATTTTAGACACAACTCATCCGAGGGCATTATTACAGACAATGGAGTTAGGCTGCTATGGTaGGGAACTTCATGTCGAATC +
Preference number: 5 (lower is better)
Translates to: DELNFRHNSSEGIITDNGVRLLW*GTSCRI
Trigger: GATTCGACATGAAGTTCCCAACCATAGCAGCCTAAC...TCCATTGTCTGTAATAATGCCCTCGGATGAGTTGTGTCTAAAATTAAGTTCATC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACCACAAAATGTTTTATCACATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTAATGCAAATACAACATaGCCGACTGGCAATACTGCC +
Preference number: 5 (lower is better)
Translates to: TTKCFITSGSVLRVLLNFNANTT*PTGNTA
Trigger: GGCAGTATTGCCAGTCGGCAATGTTGTATTTGCATT...AAAGTTGAGAAGAACACGAAGCACAGACCCTGATGTGATAAAACATTTTGTGGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ATCAGGGTCTGTGCTTCGTGTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATCTCATAGTCAAACCATaGAGCTTTAACATTTTGTGG +
Preference number: 5 (lower is better)
Translates to: IRVCASCSSQLSLVFQNDLIVKP*SFNILW
Trigger: CCACAAAATGTTAAAGCTCAATGGTTTGACTATGAG...ATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAACACGAAGCACAGACCCTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGACCATCCTCGGCAAATTaGAGTCCATCTACTGAGATG +
Preference number: 5 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRPSSAN*SPSTEM
Trigger: CATCTCAGTAGATGGACTCAAATTTGCCGAGGATGG...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp ACTCATATAAAGAACACAAAACGTCCTGGTTGCTTTGGTAATAGCGACCACTACTTCATTTTGTCATCATaGTTTGGTTCACTCCCATCC +
Preference number: 5 (lower is better)
Translates to: THIKNTKRPGCFGNSDHYFILSS*FGSLPS
Trigger: GGATGGGAGTGAACCAAACAATGATGACAAAATGAA...GTAGTGGTCGCTATTACCAAAGCAACCAGGACGTTTTGTGTTCTTTATATGAGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTAAGTATCCATAACTCACTGGATTTGCTGATTTCTGCTTTCACCACTTTCTCCTCCATTAAGGCTTCCTaGTCTTTATCAATCATGGGG +
Preference number: 5 (lower is better)
Translates to: LSIHNSLDLLISAFTTFSSIKAS*SLSIMG
Trigger: CCCCATGATTGATAAAGACAAGGAAGCCTTAATGGA...GGAGAAAGTGGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATGGATACTTAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CAA 90 bp CAGTCTGTCATCAGTTTTGGTCATATGGACAAAAGTTTCCCTAAGAGAACATATTCAGGGATGAGAAGGTaGCAGCATCTTCTTTCAAAG +
Preference number: 5 (lower is better)
Translates to: QSVISFGHMDKSFPKRTYSGMRR*QHLLSK
Trigger: CTTTGAAAGAAGATGCTGCAACCTTCTCATCCCTGA...ATATGTTCTCTTAGGGAAACTTTTGTCCATATGACCAAAACTGATGACAGACTG
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp AAGATTAAGCCAAGCTCCTTTATTTATGCCACTCAGCACTCAGGCCAAAGACAACATATTCATCACATCTaGTTGCAAACATTGCTCTCA +
Preference number: 5 (lower is better)
Translates to: KIKPSSFIYATQHSGQRQHIHHI*LQTLLS
Trigger: TGAGAGCAATGTTTGCAACAAGATGTGATGAATATG...TTGTCTTTGGCCTGAGTGCTGAGTGGCATAAATAAAGGAGCTTGGCTTAATCTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTTATACATTCCAACCCACTTGAATGTCGTCTTAGAGTGCTGAGACTTGATGACACACTACCCACGTATTaGATATACACCACTCTTTCA +
Preference number: 5 (lower is better)
Translates to: FIHSNPLECRLRVLRLDDTLPTY*IYTTLS
Trigger: TGAAAGAGTGGTGTATATCAAATACGTGGGTAGTGT...GTCATCAAGTCTCAGCACTCTAAGACGACATTCAAGTGGGTTGGAATGTATAAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000550207.1
ENST00000551848.1
CDS-3UTR CAA 90 bp ATTACAGCATGTGTAACGTTGAACTGTAATTGTGTTTCTATCCTGACATCCCCACATAACTCACTGGATTaGCTGATTTCTGCTTTCACC +
Preference number: 5 (lower is better)
Translates to: ITACVTLNCNCVSILTSPHNSLD*LISAFT
Trigger: GGTGAAAGCAGAAATCAGCAAATCCAGTGAGTTATG...TGGGGATGTCAGGATAGAAACACAATTACAGTTCAACGTTACACATGCTGTAAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS-3UTR CAA 90 bp GTTCTTCTCAACTTTCTCTCGTCTTCCAAAACGATGGACATTAATCCAATTGTATCCAGCATGACCCTGTaGGGAGTTTCATTATTACAT +
Preference number: 5 (lower is better)
Translates to: VLLNFLSSSKTMDINPIVSSMTL*GVSLLH
Trigger: ATGTAATAATGAAACTCCCAACAGGGTCATGCTGGA...TACAATTGGATTAATGTCCATCGTTTTGGAAGACGAGAGAAAGTTGAGAAGAAC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GTAGAACACAGCTTCATTCTTAATATCCACCTTTATCTACCAATTCTCAGGTTGATTCATCACATCTTGTaGCAAACATTGCTCTCAGGG +
Preference number: 5 (lower is better)
Translates to: VEHSFILNIHLYLPILRLIHHIL*QTLLSG
Trigger: CCCTGAGAGCAATGTTTGCAACAAGATGTGATGAAT...CAACCTGAGAATTGGTAGATAAAGGTGGATATTAAGAATGAAGCTGTGTTCTAC
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATCCAGCATGACCCTGTaGGGAGTTTCATTATTACAT +
Preference number: 5 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQSSMTL*GVSLLH
Trigger: ATGTAATAATGAAACTCCCAACAGGGTCATGCTGGA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp GGTGGAAACACTTCACATCATTTAACCCCAAAAGGCATAATAATTAAACTGCAATCCATTAAGGCTTCCTaGTCTTTATCAATCATGGGG +
Preference number: 5 (lower is better)
Translates to: GGNTSHHLTPKGIIIKLQSIKAS*SLSIMG
Trigger: CCCCATGATTGATAAAGACAAGGAAGCCTTAATGGA...TTGCAGTTTAATTATTATGCCTTTTGGGGTTAAATGATGTGAAGTGTTTCCACC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGACATATTCATCACATCTaGTTGCAAACATTGCTCTCA +
Preference number: 5 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGHIHHI*LQTLLS
Trigger: TGAGAGCAATGTTTGCAACAAGATGTGATGAATATG...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp TTTAGTTTCCACATCAGGATACAACCCTATTTGGAAACTGTTCTGGATACTGGAAGTCTGTCATCAGTTTaGGTCATATGGACAAAAGTT +
Preference number: 5 (lower is better)
Translates to: FSFHIRIQPYLETVLDTGSLSSV*VIWTKV
Trigger: AACTTTTGTCCATATGACCAAAACTGATGACAGACT...TCCAGTATCCAGAACAGTTTCCAAATAGGGTTGTATCCTGATGTGGAAACTAAA
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000552160.2
CDS-3UTR CAA 90 bp AATCTCCACATTCTTAGGTTATTGGACCAATGTTTCATGCTTGTTTCAAACAGATGGAGTTCATTCTTTTaGGTTCTCACTAGTTCTGCC +
Preference number: 5 (lower is better)
Translates to: NLHILRLLDQCFMLVSNRWSSFF*VLTSSA
Trigger: GGCAGAACTAGTGAGAACCAAAAAGAATGAACTCCA...TCTGTTTGAAACAAGCATGAAACATTGGTCCAATAACCTAAGAATGTGGAGATT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000548411.5
ENST00000652176.1
CDS-3UTR CAA 90 bp CATTCCCTGAATATATTATTCTATTTTGTCACTCCAAAGCCTCTCTACCTACTGACAGCATGTGTAACGTaGAACTGTAATTGTGTTTCT +
Preference number: 5 (lower is better)
Translates to: HSLNILFYFVTPKPLYLLTACVT*NCNCVS
Trigger: AGAAACACAATTACAGTTCAACGTTACACATGCTGT...CAGTAGGTAGAGAGGCTTTGGAGTGACAAAATAGAATAATATATTCAGGGAATG
37% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000547680.2
CDS GCA 72 bp AGGCCGCCGCATGTGTCCTCGGGGCCGGCCCCTGCGTaGGGTCAGCAGCCGTGCGGCATGGCCCGGGCTGCG +
Preference number: 6 (lower is better)
Translates to: RPPHVSSGPAPA*GQQPCGMARAA
Trigger: CGCAGCCCGGGCCATGCCGCACGGCTGCTGACCGCACGCAGGGGCCGGCCCCGAGGACACATGCGGCGGCCT
79% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 72 bp GCAAAGGCCGCCGCATGTGTCCTCGGGGCCGGCCCCTaGGTGCGGTCAGCAGCCGTGCGGCATGGCCCGGGC +
Preference number: 6 (lower is better)
Translates to: AKAAACVLGAGP*VRSAAVRHGPG
Trigger: GCCCGGGCCATGCCGCACGGCTGCTGACCGCACGCAGGGGCCGGCCCCGAGGACACATGCGGCGGCCTTTGC
78% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS CCA 72 bp CCATGTCTCCCGGGCCGCGTCACTGCAGTCTCGCCCTaGGTCTGGCGCGCTCCGGCTCGCGGCTCGCTCTCT +
Preference number: 6 (lower is better)
Translates to: PCLPGRVTAVSP*VWRAPARGSLS
Trigger: AGAGAGCGAGCCGCGAGCCGGAGCGCGCCAGACCCAGGGCGAGACTGCAGTGACGCGGCCCGGGAGACATGG
74% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 72 bp CTGCGGCGGCCGCGGGTAGCGAGGGGCTCCGGATTCTaGTTATTCAGAGACGCCCGTCCGCCATGTCTCCCG +
Preference number: 6 (lower is better)
Translates to: LRRPRVARGSGF*LFRDARPPCLP
Trigger: CGGGAGACATGGCGGACGGGCGTCTCTGAATAAGCAGAATCCGGAGCCCCTCGCTACCCGCGGCCGCCGCAG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000550207.1
ENST00000551848.1
ENST00000652176.1
CDS GCA 72 bp AGGCCCCTCATGGCATTGACGTGCTCTGTGAGCCGGTaGACCCGCTCATGCTGCTCCGTCAGTGCCCCCTTG +
Preference number: 6 (lower is better)
Translates to: RPLMALTCSVSR*TRSCCSVSAPL
Trigger: CAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAATGCCATGAGGGGCCT
65% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 72 bp GCATTGACGTGCTCTGTGAGCCGGTGCACCCGCTCATaGTGCTCCGTCAGTGCCCCCTTGGTGTGTTCCAGC +
Preference number: 6 (lower is better)
Translates to: ALTCSVSRCTRS*CSVSAPLVCSS
Trigger: GCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAATGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CAA 90 bp CCTGAGTCCCGGCCCTTCTCCCCGTCCAGCTCAGCCTTGAGCTCCTaGCTGCTTTGCAGGCCCCTCATGGCATTGACGTGCTCTGTGAGC +
Preference number: 6 (lower is better)
Translates to: PESRPFSPSSSALSS*LLCRPLMALTCSVS
Trigger: GCTCACAGAGCACGTCAATGCCATGAGGGGCCTGCAAAGCAGCAAGGAGCTCAAGGCTGAGCTGGACGGGGAGAAGGGCCGGGACTCAGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 72 bp TTGACGTGCTCTGTGAGCCGGTGCACCCGCTCATGCTaGTCCGTCAGTGCCCCCTTGGTGTGTTCCAGCTGT +
Preference number: 6 (lower is better)
Translates to: LTCSVSRCTRSC*SVSAPLVCSSC
Trigger: ACAGCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS GCA 72 bp TCCTTGCTGCTTTGCAGGCCCCTCATGGCATTGACGTaGTCTGTGAGCCGGTGCACCCGCTCATGCTGCTCC +
Preference number: 6 (lower is better)
Translates to: SLLLCRPLMALT*SVSRCTRSCCS
Trigger: GGAGCAGCATGAGCGGGTGCACCGGCTCACAGAGCACGTCAATGCCATGAGGGGCCTGCAAAGCAGCAAGGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CAA 72 bp CGGTGCACCCGCTCATGCTGCTCCGTCAGTGCCCCCTaGGTGTGTTCCAGCTGTGTCTGTGACTCCTGTAGG +
Preference number: 6 (lower is better)
Translates to: RCTRSCCSVSAP*VCSSCVCDSCR
Trigger: CCTACAGGAGTCACAGACACAGCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CCA 72 bp GGTGCACCCGCTCATGCTGCTCCGTCAGTGCCCCCTTaGTGTGTTCCAGCTGTGTCTGTGACTCCTGTAGGT +
Preference number: 6 (lower is better)
Translates to: GAPAHAAPSVPP*CVPAVSVTPVG
Trigger: ACCTACAGGAGTCACAGACACAGCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS CAA 90 bp TCTGTGAGCCGGTGCACCCGCTCATGCTGCTCCGTCAGTGCCCCCTaGGTGTGTTCCAGCTGTGTCTGTGACTCCTGTAGGTTGGCCAAA +
Preference number: 6 (lower is better)
Translates to: SVSRCTRSCCSVSAP*VCSSCVCDSCRLAK
Trigger: TTTGGCCAACCTACAGGAGTCACAGACACAGCTGGAACACACCAAGGGGGCACTGACGGAGCAGCATGAGCGGGTGCACCGGCTCACAGA
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000395758.3
ENST00000548411.5
ENST00000652176.1
CDS TCA 72 bp CTCTGGTGGCAGCGGCAGCTACACCGCCCGAGAAACTaGCGAGAAATGCAACATGGAGAACAGGGCAGAGGG +
Preference number: 6 (lower is better)
Translates to: