RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ASAH1 (Homo sapiens)

Ensembl gene IDs: ENSG00000104763

Ensembl transcript IDs: ENST00000314146.10, ENST00000381733.9, ENST00000517409.2, ENST00000518087.7, ENST00000518746.2, ENST00000520051.2, ENST00000520781.6, ENST00000521542.2, ENST00000523593.6, ENST00000523744.2, ENST00000635756.1, ENST00000635769.1, ENST00000635944.1, ENST00000635998.1, ENST00000636009.1, ENST00000636033.1, ENST00000636050.1, ENST00000636128.1, ENST00000636160.1, ENST00000636171.1, ENST00000636269.1, ENST00000636299.1, ENST00000636435.1, ENST00000636455.1, ENST00000636494.1, ENST00000636537.1, ENST00000636577.1, ENST00000636691.1, ENST00000636701.1, ENST00000636715.1, ENST00000636719.1, ENST00000636815.1, ENST00000636823.1, ENST00000636828.1, ENST00000636920.1, ENST00000636997.1, ENST00000637013.1, ENST00000637014.1, ENST00000637095.1, ENST00000637202.1, ENST00000637244.1, ENST00000637343.1, ENST00000637429.1, ENST00000637484.1, ENST00000637528.1, ENST00000637561.1, ENST00000637609.1, ENST00000637636.1, ENST00000637752.1, ENST00000637790.2, ENST00000637792.1, ENST00000637805.1, ENST00000637840.1, ENST00000637857.1, ENST00000637872.1, ENST00000637922.1, ENST00000637946.1, ENST00000637991.1, ENST00000638028.1, ENST00000638069.1

Found 2376 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR TCA 90 bp TGCAGTCCTCTGTCCACGGCGGCGCGTGCTGCGCGACGGCACAGCTaGCGGCGGCAGCCAGGAGGACTAAGGCGACGCAACTCCGGCCCG +
Preference number: 1 (lower is better)
Translates to: CSPLSTAARAARRHS*RRQPGGLRRRNSGP
Trigger: CGGGCCGGAGTTGCGTCGCCTTAGTCCTCCTGGCTGCCGCCGTCAGCTGTGCCGTCGCGCAGCACGCGCCGCCGTGGACAGAGGACTGCA
72% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR GCA 90 bp GAGCTTCACCCGTGGCGCCTCGATGGGGCGCCTCTAGCAGGCGGGTaGAGCCTGTCCCGCGTACCCAGGCGTCCTCGGTACCCACGAAAC +
Preference number: 1 (lower is better)
Translates to: ELHPWRLDGAPLAGG*SLSRVPRRPRYPRN
Trigger: GTTTCGTGGGTACCGAGGACGCCTGGGTACGCGGGACAGGCTGCACCCGCCTGCTAGAGGCGCCCCATCGAGGCGCCACGGGTGAAGCTC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637946.1
3UTR CCA 90 bp GACGTCACTGCCTGCAGAAGGAGAGTCGCGATCGCCTTTGGCGCGTaGCGTGATCCATCCCCCTCCCCCACCGCGGGCAATAGTCGGACC +
Preference number: 1 (lower is better)
Translates to: DVTACRRRVAIAFGA*RDPSPSPTAGNSRT
Trigger: GGTCCGACTATTGCCCGCGGTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGGCAGTGACGTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR CCA 90 bp TCCTCTGTCCACTGCAGAAGGAGAGTCGCGATCGCCTTTGGCGCGTaGCGTGATCCATCCCCCTCCCCCACCGCGGGCAATAGTCGGACC +
Preference number: 1 (lower is better)
Translates to: SSVHCRRRVAIAFGA*RDPSPSPTAGNSRT
Trigger: GGTCCGACTATTGCCCGCGGTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGTGGACAGAGGA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000637013.1
ENST00000637429.1
3UTR CCA 90 bp TTCCAGGCTACCTGCAGAAGGAGAGTCGCGATCGCCTTTGGCGCGTaGCGTGATCCATCCCCCTCCCCCACCGCGGGCAATAGTCGGACC +
Preference number: 1 (lower is better)
Translates to: FQATCRRRVAIAFGA*RDPSPSPTAGNSRT
Trigger: GGTCCGACTATTGCCCGCGGTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGGTAGCCTGGAA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR GCA 90 bp CGAAAAGGGTGGCGTAGAGAAAGAGAGAGAGCCTTCCAGGCTACCTaGAGAAGGAGAGTCGCGATCGCCTTTGGCGCGTGGCGTGATCCA +
Preference number: 1 (lower is better)
Translates to: RKGWRRERERAFQAT*RRRVAIAFGAWRDP
Trigger: TGGATCACGCCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGGTAGCCTGGAAGGCTCTCTCTCTTTCTCTACGCCACCCTTTTCG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR TCA 90 bp TCTGTTTGCGTTCCTTGTCAATACCAGACTCTGCGCTCCTTGAGGTaGGGACGGCCCCCAACACTGACGTCACTGCCTGCAGAAGGAGAG +
Preference number: 1 (lower is better)
Translates to: SVCVPCQYQTLRSLR*GRPPTLTSLPAEGE
Trigger: CTCTCCTTCTGCAGGCAGTGACGTCAGTGTTGGGGGCCGTCCTCACCTCAAGGAGCGCAGAGTCTGGTATTGACAAGGAACGCAAACAGA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR GCA 90 bp TGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTaGTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGT +
Preference number: 1 (lower is better)
Translates to: WCLHVSEAAFCRPDV*SPTYTRVRAVPQVS
Trigger: ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CCA 90 bp AGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATaGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTG +
Preference number: 1 (lower is better)
Translates to: SLWKVRQLQCSVTWR*CLHVSEAAFCRPDV
Trigger: CACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR CCA 90 bp GCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGAGGTaGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCA +
Preference number: 1 (lower is better)
Translates to: AGFNTHAESPFIPRR*SSPWFDCPPDPQMS
Trigger: TGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR TCA 90 bp ACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTaGATCTCCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGA +
Preference number: 1 (lower is better)
Translates to: TVPLLTQTCWIQHPR*ISIYSTEVEFTMVR
Trigger: TCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR GCA 90 bp AAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGG +
Preference number: 1 (lower is better)
Translates to: KENLPRVLVFGRSDS*SVRSHGDGVFMSQR
Trigger: CCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR TCA 90 bp CCCTCCTCCAAACCAACACAGATGTACACACCCAATCAGCGTGCATaGCTGCTGACTGGCACTCTTTCCAGTGACTGTTTATTGAGTGTC +
Preference number: 1 (lower is better)
Translates to: PSSKPTQMYTPNQRA*LLTGTLSSDCLLSV
Trigger: GACACTCAATAAACAGTCACTGGAAAGAGTGCCAGTCAGCAGTCATGCACGCTGATTGGGTGTGTACATCTGTGTTGGTTTGGAGGAGGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637790.2
3UTR GCA 90 bp CTGCACCTCTGTACGTTGGTCCTGAAGGAGGATAGGTTGATTTTCTaGAGTCCTCTGTCCACTGGTGAACTGCTGGTTCTAACTTCCAAG +
Preference number: 1 (lower is better)
Translates to: LHLCTLVLKEDRLIF*SPLSTGELLVLTSK
Trigger: CTTGGAAGTTAGAACCAGCAGTTCACCAGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR CCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGT +
Preference number: 1 (lower is better)
Translates to: DKLLTQREPAASLSL*KVRQLQCSVTWRWC
Trigger: ACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR GCA 90 bp CTAAAGAAGTTATCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGG +
Preference number: 1 (lower is better)
Translates to: LKKLSRVLVFGRSDS*SVRSHGDGVFMSQR
Trigger: CCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGATAACTTCTTTAG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000635998.1
3UTR GCA 90 bp TATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTaGGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATAATTTG +
Preference number: 1 (lower is better)
Translates to: YSLGWCGSDTSLQAF*DHQGRRDVSNGHNL
Trigger: CAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CCA 90 bp GCATCAATTCATGCCATCTTTTGTAGGGTGGTAAGTCAAGATTTATaGTGTACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGAG +
Preference number: 1 (lower is better)
Translates to: ASIHAIFCRVVSQDL*CTMELHLCTLVLKE
Trigger: CTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGTACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGAATTGATGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CCA 90 bp GCATCAATTCATGCCATCTTTTGTAGGGTGGTAAGTCAAGATTTATaGTGTACCATGGAACTGCACCTCTGTACCTGTAATGAGAGGTGT +
Preference number: 1 (lower is better)
Translates to: ASIHAIFCRVVSQDL*CTMELHLCTCNERC
Trigger: ACACCTCTCATTACAGGTACAGAGGTGCAGTTCCATGGTACACCATAAATCTTGACTTACCACCCTACAAAAGATGGCATGAATTGATGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000636160.1
3UTR TCA 90 bp CCTTTCCTCCCACAGCATTTGTGCACACTCTCATCAACATGTTTATaGCACTGCTTTATAATCATCTGTTTGCGTTCCTTGTCAATACCA +
Preference number: 1 (lower is better)
Translates to: PFLPQHLCTLSSTCL*HCFIIICLRSLSIP
Trigger: TGGTATTGACAAGGAACGCAAACAGATGATTATAAAGCAGTGTCATAAACATGTTGATGAGAGTGTGCACAAATGCTGTGGGAGGAAAGG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR TCA 90 bp GAGGAGAATTATCAAGAGGAGAAAACTGAAACTCTCATACTCTGCTaGTTGTCAACTGCTGGAATCACTTTGGAAAACTGTTTGGCAGAA +
Preference number: 1 (lower is better)
Translates to: EENYQEEKTETLILC*LSTAGITLENCLAE
Trigger: TTCTGCCAAACAGTTTTCCAAAGTGATTCCAGCAGTTGACAATCAGCAGAGTATGAGAGTTTCAGTTTTCTCCTCTTGATAATTCTCCTC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000636715.1
ENST00000637202.1
3UTR TCA 90 bp AAAAGACTGACACTATCGAGAGGAGAATTATCAAGAGGAGAAAACTaGAACTCTCATACTCTGCTGATTGTCAACTGCTGGAATCACTTT +
Preference number: 1 (lower is better)
Translates to: KRLTLSRGELSRGEN*NSHTLLIVNCWNHF
Trigger: AAAGTGATTCCAGCAGTTGACAATCAGCAGAGTATGAGAGTTTCAGTTTTCTCCTCTTGATAATTCTCCTCTCGATAGTGTCAGTCTTTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000637202.1
3UTR CAA 90 bp CCAACACTGACGTCACTGCCTGCAGAAGGAGAGTCGCGATCGCCTTaGGCGCGTGGCGTGATCCATCCCCCTCCCCCACCGCGGGCAATA +
Preference number: 2 (lower is better)
Translates to: PTLTSLPAEGESRSP*ARGVIHPPPPPRAI
Trigger: TATTGCCCGCGGTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGGCAGTGACGTCAGTGTTGG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR CAA 90 bp AGAGAGCCTTCCAGGCTACCTGCAGAAGGAGAGTCGCGATCGCCTTaGGCGCGTGGCGTGATCCATCCCCCTCCCCCACCGCGGGCAATA +
Preference number: 2 (lower is better)
Translates to: REPSRLPAEGESRSP*ARGVIHPPPPPRAI
Trigger: TATTGCCCGCGGTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGGTAGCCTGGAAGGCTCTCT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR-3UTR CCA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCCCGTGGCGCCTCGATaGGGCGCCTCTAGCAGGCGG +
Preference number: 2 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPPVAPR*GASSRR
Trigger: CCGCCTGCTAGAGGCGCCCCATCGAGGCGCCACGGG...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp GCCAACGCCACTCCCCGGACTCCAGCAGAGGCAAAGAAGAGCCGGCTGGGCCGGGTGCCACGAAAAGGGTaGCGTAGAGAAAGAGAGAGA +
Preference number: 2 (lower is better)
Translates to: ANATPRTPAEAKKSRLGRVPRKG*RRERER
Trigger: TCTCTCTCTTTCTCTACGCCACCCTTTTCGTGGCAC...CCGGCCCAGCCGGCTCTTCTTTGCCTCTGCTGGAGTCCGGGGAGTGGCGTTGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000520051.2
ENST00000637244.1
3UTR-3UTR GCA 90 bp GAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCCCTCTAGCAGGCGGGTaGAGCCTGTCCCGCGTACCC +
Preference number: 2 (lower is better)
Translates to: EPAASLSLWKVRQLQCSVPLAGG*SLSRVP
Trigger: GGGTACGCGGGACAGGCTGCACCCGCCTGCTAGAGG...GACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp TCTCCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCGTGGCGCCTCGATaGGGCGCCTCTAGCAGGCGG +
Preference number: 2 (lower is better)
Translates to: SPFIPRRWSSPWFDCPPDPVAPR*GASSRR
Trigger: CCGCCTGCTAGAGGCGCCCCATCGAGGCGCCACGGG...ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp GGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTCGGGAGCTTCACCCGTaGCGCCTCGATGGGGCGCCT +
Preference number: 2 (lower is better)
Translates to: GGGVHHGSTAHQIPKCQSRELHP*RLDGAP
Trigger: AGGCGCCCCATCGAGGCGCCACGGGTGAAGCTCCCG...ACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR GCA 90 bp TCTCCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCTCTAGCAGGCGGGTaGAGCCTGTCCCGCGTACCC +
Preference number: 2 (lower is better)
Translates to: SPFIPRRWSSPWFDCPPDPLAGG*SLSRVP
Trigger: GGGTACGCGGGACAGGCTGCACCCGCCTGCTAGAGG...ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp GACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACCCCGTGGCGCCTCGATaGGGCGCCTCTAGCAGGCGG +
Preference number: 2 (lower is better)
Translates to: DTSLQAFCDHQGRRDVSNPVAPR*GASSRR
Trigger: CCGCCTGCTAGAGGCGCCCCATCGAGGCGCCACGGG...GTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR CAA 90 bp ACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGAGGATAGGTaGATTTTCTGCAGTCCTCTGTCCACGGCGGCGCGTGCTGCGCGA +
Preference number: 2 (lower is better)
Translates to: TMELHLCTLVLKEDR*IFCSPLSTAARAAR
Trigger: TCGCGCAGCACGCGCCGCCGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR-3UTR GCA 90 bp TGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAACCTCTAGCAGGCGGGTaGAGCCTGTCCCGCGTACCC +
Preference number: 2 (lower is better)
Translates to: CLLSRYSHRRAGFNTHAEPLAGG*SLSRVP
Trigger: GGGTACGCGGGACAGGCTGCACCCGCCTGCTAGAGG...TTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp GATTTATGGTGTACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGAGGATCGGGAGCTTCACCCGTaGCGCCTCGATGGGGCGCCT +
Preference number: 2 (lower is better)
Translates to: DLWCTMELHLCTLVLKEDRELHP*RLDGAP
Trigger: AGGCGCCCCATCGAGGCGCCACGGGTGAAGCTCCCG...ATCCTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGTACACCATAAATC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637946.1
3UTR-3UTR TCA 90 bp CTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTTTGGCGCGTGGCGTaGTCCATCCCCCTCCCCCAC +
Preference number: 2 (lower is better)
Translates to: LLTQREPAASLSLWKVRQLWRVA*SIPLPH
Trigger: GTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAG...CTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR GCA 90 bp GATTTATGGTGTACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGAGGATCCTCTAGCAGGCGGGTaGAGCCTGTCCCGCGTACCC +
Preference number: 2 (lower is better)
Translates to: DLWCTMELHLCTLVLKEDPLAGG*SLSRVP
Trigger: GGGTACGCGGGACAGGCTGCACCCGCCTGCTAGAGG...ATCCTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGTACACCATAAATC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637946.1
3UTR-3UTR CCA 90 bp GGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTATCGCCTTTGGCGCGTaGCGTGATCCATCCCCCTCC +
Preference number: 2 (lower is better)
Translates to: GRSDSCSVRSHGDGVFMSIAFGA*RDPSPS
Trigger: GGAGGGGGATGGATCACGCCACGCGCCAAAGGCGAT...AGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR TCA 90 bp TTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCCCATCTTTGCCCTCTaGGAAAAGCGGCCCGAAATG +
Preference number: 2 (lower is better)
Translates to: FHGGGVHHGSTAHQIPKCPIFAL*EKRPEM
Trigger: CATTTCGGGCCGCTTTTCTCAGAGGGCAAAGATGGG...ACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAAATCGCCTTTGGCGCGTaGCGTGATCCATCCCCCTCC +
Preference number: 2 (lower is better)
Translates to: CLLSRYSHRRAGFNTHAEIAFGA*RDPSPS
Trigger: GGAGGGGGATGGATCACGCCACGCGCCAAAGGCGAT...TTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR CAA 90 bp ACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGAGGATAGGTaGATTTTCTGCAGTCCTCTGTCCACCAGGCGTCCTCGGTACCCA +
Preference number: 2 (lower is better)
Translates to: TMELHLCTLVLKEDR*IFCSPLSTRRPRYP
Trigger: TGGGTACCGAGGACGCCTGGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637484.1
3UTR-3UTR TCA 90 bp CTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCACCCAATCAGCGTGCATaGCTGCTGACTGGCACTCTT +
Preference number: 2 (lower is better)
Translates to: LSRYSHRRAGFNTHAESPPNQRA*LLTGTL
Trigger: AAGAGTGCCAGTCAGCAGTCATGCACGCTGATTGGG...TGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637790.2
3UTR-3UTR TCA 90 bp CTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCACCCATCTTTGCCCTCTaGGAAAAGCGGCCCGAAATG +
Preference number: 2 (lower is better)
Translates to: LSRYSHRRAGFNTHAESPPIFAL*EKRPEM
Trigger: CATTTCGGGCCGCTTTTCTCAGAGGGCAAAGATGGG...TGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp TTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGA +
Preference number: 2 (lower is better)
Translates to: FHGGGVHHGSTAHQIPKCGRSDS*SVRSHG
Trigger: TCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC...ACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: PRRWSSPWFDCPPDPQMSASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: AASLSLWKVRQLQCSVTWRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: DGVFMSQRPHSVGQTCAHRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...GTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AGTCAAGATTTATGGTGTACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGACGGCCCCCAACACTaGCGTCACTGCCTGCAGAAG +
Preference number: 2 (lower is better)
Translates to: SQDLWCTMELHLCTLVLKDGPQH*RHCLQK
Trigger: CTTCTGCAGGCAGTGACGTCAGTGTTGGGGGCCGTC...CTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGTACACCATAAATCTTGACT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR-3UTR GCA 90 bp GTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: VRSHGDGVFMSQRPHSVGSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...GCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: LFHGGGVHHGSTAHQIPKSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...TTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp GAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: EPAASLSLWKVRQLQCSVLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...GACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp GCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: ARRVLTNLYKGQGSPAGKLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...CTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTCGGTCACATGGAGATaGTGTCTTCATGTCTCAGAG +
Preference number: 2 (lower is better)
Translates to: PDVCSPTYTRVRAVPQVSSVTWR*CLHVSE
Trigger: CTCTGAGACATGAAGACACCATCTCCATGTGACCGA...ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: PDVCSPTYTRVRAVPQVSQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: AASLSLWKVRQLQCSVTWASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: HLFHGGGVHHGSTAHQIPASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: HGGGVHHGSTAHQIPKCQASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TCATATACATCCAATGATTCCTTTCTGTCTCGTGTAATCACACAACCTTCCCCACGGGAGCTTCACCCGTaGCGCCTCGATGGGGCGCCT +
Preference number: 2 (lower is better)
Translates to: SYTSNDSFLSRVITQPSPRELHP*RLDGAP
Trigger: AGGCGCCCCATCGAGGCGCCACGGGTGAAGCTCCCG...TGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGTATATGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp TTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCATCGCCTTTGGCGCGTaGCGTGATCCATCCCCCTCC +
Preference number: 2 (lower is better)
Translates to: FRHIFAGVLRSSRKKGCFIAFGA*RDPSPS
Trigger: GGAGGGGGATGGATCACGCCACGCGCCAAAGGCGAT...GAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CCA 90 bp TCCTTTCTGTCTCGTGTAATCACACAACCTTCCCCAGACTGGTTGCCTCCCAGGCAACCTTCCCCAGACTaGTTGCCTCCCAGGATAAAG +
Preference number: 2 (lower is better)
Translates to: SFLSRVITQPSPDWLPPRQPSPD*LPPRIK
Trigger: CTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTG...CCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAACAACCTTCCCCAGACTaGTTGCCTCCCAGGATAAAG +
Preference number: 2 (lower is better)
Translates to: LFHGGGVHHGSTAHQIPKQPSPD*LPPRIK
Trigger: CTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTG...TTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGAGATATTCTCTTGGCTaGTGCGGTTCAGACACATCT +
Preference number: 2 (lower is better)
Translates to: ARRVLTNLYKGQGSPAGKRYSLG*CGSDTS
Trigger: AGATGTGTCTGAACCGCACCAGCCAAGAGAATATCT...CTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp CCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: PRRWSSPWFDCPPDPQMSIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...TGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp CCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: PDVCSPTYTRVRAVPQVSIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp CACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGACCCATCTTTGCCCTCTaGGAAAAGCGGCCCGAAATG +
Preference number: 2 (lower is better)
Translates to: HTDVLDSTPTLNLHLFHGPIFAL*EKRPEM
Trigger: CATTTCGGGCCGCTTTTCTCAGAGGGCAAAGATGGG...TCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGA +
Preference number: 2 (lower is better)
Translates to: ECLLSRYSHRRAGFNTHAGRSDS*SVRSHG
Trigger: TCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC...AGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: CSVRSHGDGVFMSQRPHSSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...AGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: WCGSDTSLQAFCDHQGRRSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...CCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGATTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: GWCGSDTSLQAFCDHQGRLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...TCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: PDVCSPTYTRVRAVPQVSLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGATGTAGGCCAGACGTGTaGTCACCAACCTATACAAGG +
Preference number: 2 (lower is better)
Translates to: GWCGSDTSLQAFCDHQGRCRPDV*SPTYTR
Trigger: CCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACA...TCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAACAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: HGGGVHHGSTAHQIPKCQQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...TTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: VFMSQRPHSVGQTCAHQPQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...AGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGAC
52% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: SEAAFCRPDVCSPTYTRVQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: EPAASLSLWKVRQLQCSVQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: VTWRWCLHVSEAAFCRPDASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: GWCGSDTSLQAFCDHQGRASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: VRSHGDGVFMSQRPHSVGASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: WSVYCPVTHTDVLDSTPTRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...CGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: LKENLPRVLVFGRSDSCSRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...ACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: ECLLSRYSHRRAGFNTHARWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...AGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: GRSDSCSVRSHGDGVFMSRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...AGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: AASLSLWKVRQLQCSVTWFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATAATTTGTTTGTACAAAGAAGAGCCGGCTaGGCCGGGGGCAGGCCACGC +
Preference number: 2 (lower is better)
Translates to: FCDHQGRRDVSNGHNLFVQRRAG*AGGRPR
Trigger: GCGTGGCCTGCCCCCGGCCCAGCCGGCTCTTCTTTG...TACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR-3UTR CCA 90 bp AGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGCAACCTTCCCCAGACTaGTTGCCTCCCAGGATAAAG +
Preference number: 2 (lower is better)
Translates to: RSDSCSVRSHGDGVFMSQQPSPD*LPPRIK
Trigger: CTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTG...CTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TTCTGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGAGATATTCTCTTGGCTaGTGCGGTTCAGACACATCT +
Preference number: 2 (lower is better)
Translates to: FCRPDVCSPTYTRVRAVPRYSLG*CGSDTS
Trigger: AGATGTGTCTGAACCGCACCAGCCAAGAGAATATCT...CGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp CTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCAACGAAGACAAGCTATTaGCTCAAAGAGAACCTGCCG +
Preference number: 2 (lower is better)
Translates to: LSRYSHRRAGFNTHAESPTKTSY*LKENLP
Trigger: CGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGT...TGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAACGAAGACAAGCTATTaGCTCAAAGAGAACCTGCCG +
Preference number: 2 (lower is better)
Translates to: GWCGSDTSLQAFCDHQGRTKTSY*LKENLP
Trigger: CGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGT...TCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp ACTGGTGAACTGCTGGTTCTAACTTCCAAGATTCAGTTCAAGCATTTTCTTTCTCTTTGGCGCGTGGCGTaGTCCATCCCCCTCCCCCAC +
Preference number: 2 (lower is better)
Translates to: TGELLVLTSKIQFKHFLSLWRVA*SIPLPH
Trigger: GTGGGGGAGGGGGATGGATCACGCCACGCGCCAAAG...AGAAAGAAAATGCTTGAACTGAATCTTGGAAGTTAGAACCAGCAGTTCACCAGT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR-3UTR TCA 90 bp GAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCGGAACCCTATCCACATaGCATCTTTCTTTCCCAGAA +
Preference number: 2 (lower is better)
Translates to: EPAASLSLWKVRQLQCSVGTLST*HLSFPE
Trigger: TTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCC...GACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: VYCPVTHTDVLDSTPTLNSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...ATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp ACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTTCGAATTGACCTTTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: TNLYKGQGSPAGKFRIDLSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...AAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: SLSLWKVRQLQCSVTWRWSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...CCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: SHRRAGFNTHAESPFIPRSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...CCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp CAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: QCSVTWRWCLHVSEAAFCLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...ACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp CTGTCTCGTGTAATCACACAACCTTCCCCAGACTGGTTGCCTCCCAGGATAAAGTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: LSRVITQPSPDWLPPRIKLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...CTTTATCCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: SVYCPVTHTDVLDSTPTLLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...CAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: SDSCSVRSHGDGVFMSQRLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...CCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TCCTTTCTGTCTCGTGTAATCACACAACCTTCCCCAGACTGGTTGCCTCCCAGGGGTGTACCATGGAACTaGACCTCTGTACCTGTAATG +
Preference number: 2 (lower is better)
Translates to: SFLSRVITQPSPDWLPPRGVPWN*TSVPVM
Trigger: CATTACAGGTACAGAGGTGCAGTTCCATGGTACACC...CCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000636160.1
3UTR-3UTR CCA 90 bp GTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACTCGGTCACATGGAGATaGTGTCTTCATGTCTCAGAG +
Preference number: 2 (lower is better)
Translates to: VTWRWCLHVSEAAFCRPDSVTWR*CLHVSE
Trigger: CTCTGAGACATGAAGACACCATCTCCATGTGACCGA...GTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGAC
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAACAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: LFHGGGVHHGSTAHQIPKQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...TTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: VTWRWCLHVSEAAFCRPDQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGAC
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: EVEFTMVRLPTRSPNVKVFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...CACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGGTAAGTCAAGATTTATaGTGTACCATGGAACTGCAC +
Preference number: 2 (lower is better)
Translates to: ARRVLTNLYKGQGSPAGKVSQDL*CTMELH
Trigger: GTGCAGTTCCATGGTACACCATAAATCTTGACTTAC...CTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000636160.1
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGAGATATTCTCTTGGCTaGTGCGGTTCAGACACATCT +
Preference number: 2 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPRYSLG*CGSDTS
Trigger: AGATGTGTCTGAACCGCACCAGCCAAGAGAATATCT...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CAA 90 bp ACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGGAGGATAGGTaGATTTTCTGCAGTCCTCTGTCCACTGGTGAACTGCTGGTTCTA +
Preference number: 2 (lower is better)
Translates to: TMELHLCTLVLKEDR*IFCSPLSTGELLVL
Trigger: TAGAACCAGCAGTTCACCAGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR-3UTR TCA 90 bp GAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTACGAAGACAAGCTATTaGCTCAAAGAGAACCTGCCG +
Preference number: 2 (lower is better)
Translates to: ECLLSRYSHRRAGFNTHATKTSY*LKENLP
Trigger: CGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGT...AGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: EVEFTMVRLPTRSPNVKVIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...CACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp CCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: PDVCSPTYTRVRAVPQVSDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGATAGCCAGCAAAGCTTaGAGCCTTGAAGACAGTTTT +
Preference number: 2 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPIASKA*SLEDSF
Trigger: AAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTAT...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGA +
Preference number: 2 (lower is better)
Translates to: NVECLLSRYSHRRAGFNTGRSDS*SVRSHG
Trigger: TCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC...GGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp ACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGA +
Preference number: 2 (lower is better)
Translates to: TSLQAFCDHQGRRDVSNGGRSDS*SVRSHG
Trigger: TCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC...ACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: DKLLTQREPAASLSLWKVSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...GACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTTCGAATTGACCTTTGGTAACTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: YTRVRAVPQVSFELTFGNSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...GTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp TCCTTTCTGTCTCGTGTAATCACACAACCTTCCCCAGACTGGTTGCCTCCCAGGTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: SFLSRVITQPSPDWLPPRLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...CCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: ARRVLTNLYKGQGSPAGKVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...CTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGGGTGTACCATGGAACTaGACCTCTGTACGTTGGTCC +
Preference number: 2 (lower is better)
Translates to: LLTQREPAASLSLWKVRQGVPWN*TSVRWS
Trigger: GGACCAACGTACAGAGGTGCAGTTCCATGGTACACC...CTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGTCTTTGCAGGCGTTCTaGGATCATCAAGGAAGAAGG +
Preference number: 2 (lower is better)
Translates to: RSDSCSVRSHGDGVFMSQSLQAF*DHQGRR
Trigger: CCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGA...CTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AGTCAAGATTTATGGTGTACCATGGAACTGCACCTCTGTACGTTGGTCCTGAAGACTGACGTCACTGCCTaGAGAAGGAGAGTCGCGATC +
Preference number: 2 (lower is better)
Translates to: SQDLWCTMELHLCTLVLKTDVTA*RRRVAI
Trigger: GATCGCGACTCTCCTTCTGCAGGCAGTGACGTCAGT...CTTCAGGACCAACGTACAGAGGTGCAGTTCCATGGTACACCATAAATCTTGACT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR-3UTR CCA 90 bp TGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGTCGGTCACATGGAGATaGTGTCTTCATGTCTCAGAG +
Preference number: 2 (lower is better)
Translates to: WSVYCPVTHTDVLDSTPTSVTWR*CLHVSE
Trigger: CTCTGAGACATGAAGACACCATCTCCATGTGACCGA...CGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: ECLLSRYSHRRAGFNTHAQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...AGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGACAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: VRFRHIFAGVLRSSRKKGQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...TCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp AATCTCCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: NLHLFHGGGVHHGSTAHQQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...CTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: VLVFGRSDSCSVRSHGDGASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...ACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: SRYSHRRAGFNTHAESPFASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...AAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp ACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGAGGTGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: TDVLDSTPTLNLHLFHGGASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...ACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: SHRRAGFNTHAESPFIPRASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...CCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: DKLLTQREPAASLSLWKVRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...GACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: ECGVFTVPLLTQTCWIQHRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...GTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: NVECLLSRYSHRRAGFNTRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...GGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: QCSVTWRWCLHVSEAAFCFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...ACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: EIFSWLVRFRHIFAGVLRFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...TCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: GRSDSCSVRSHGDGVFMSFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...AGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: DILLAGAVQTHLCRRSAIFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...GATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AATCTCCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: NLHLFHGGGVHHGSTAHQIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...CTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: AASLSLWKVRQLQCSVTWKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: VFMSQRPHSVGQTCAHQPKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...AGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: EPAASLSLWKVRQLQCSVDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...GACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 25 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp AAGGGCCAGGAAAGTTGCCAAGTAGGCCAGGCAATTTTTCATCCACCACCTGCAGCATGCATGCATTTCTaGAGCTTCACTGAGCTGTAT +
Preference number: 2 (lower is better)
Translates to: KGQESCQVGQAIFHPPPAACMHF*SFTELY
Trigger: ATACAGCTCAGTGAAGCTTCAGAAATGCATGCATGC...TGCAGGTGGTGGATGAAAAATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000518087.7
ENST00000636715.1
ENST00000637202.1
ENST00000637805.1
3UTR-3UTR TCA 90 bp TCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCCAAAGCTTGAAGCCTTaGAGACAGTTTTGTTGTTTC +
Preference number: 2 (lower is better)
Translates to: SEAAFCRPDVCSPTYTRVQSLKP*RQFCCF
Trigger: GAAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTG...GACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp TCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGATAGCCAGCAAAGCTTaGAGCCTTGAAGACAGTTTT +
Preference number: 2 (lower is better)
Translates to: SWLVRFRHIFAGVLRSSRIASKA*SLEDSF
Trigger: AAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTAT...CCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp TTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: FTMVRLPTRSPNVKVKQNSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...GTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp AAGAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: KNVECLLSRYSHRRAGFNSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...GTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTCTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp CTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: LLTQREPAASLSLWKVRQLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...CTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp GAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAATTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: EFTMVRLPTRSPNVKVKQLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...TTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp AGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: RSDSCSVRSHGDGVFMSQLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...CTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAAGTGGACAAACGGTCTTaGACAAATGACGTACATTTC +
Preference number: 2 (lower is better)
Translates to: LFHGGGVHHGSTAHQIPKVDKRS*TNDVHF
Trigger: GAAATGTACGTCATTTGTGCAAGACCGTTTGTCCAC...TTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TTCTGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: FCRPDVCSPTYTRVRAVPVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...CGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp ATGAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCTCTTTGCAGGCGTTCTaGGATCATCAAGGAAGAAGG +
Preference number: 2 (lower is better)
Translates to: MRYSLGWCGSDTSLQAFCSLQAF*DHQGRR
Trigger: CCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGA...GCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCTCGGTCACATGGAGATaGTGTCTTCATGTCTCAGAG +
Preference number: 2 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPSVTWR*CLHVSE
Trigger: CTCTGAGACATGAAGACACCATCTCCATGTGACCGA...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp ACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGAGGTCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: TDVLDSTPTLNLHLFHGGQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...ACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: LCRRSAIIKEEGMFPTVIASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: ECGVFTVPLLTQTCWIQHASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAAGATAAGGAAGCACCTCCTGCGAGCACTTCCATCAAAGCATGTAGATGGGTAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: EDKEAPPASTSIKACRWVASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TACCCATCTACATGCTTTGATGGAAGTGCTCGCAGGAGGTGCTTCCTTATCTTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637013.1
3UTR-3UTR CCA 90 bp CTGAAGAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: LKNVECLLSRYSHRRAGFASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTCTTCAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAATTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: VEFTMVRLPTRSPNVKVKFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...TTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTCTGGGGCCAATATCTTaGTCTTGGTCAATAAATTCT +
Preference number: 2 (lower is better)
Translates to: VFMSQRPHSVGQTCAHQPLGPIS*SWSINS
Trigger: AGAATTTATTGACCAAGACCAAGATATTGGCCCCAG...AGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp AGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAGATATTCTCTTGGCTaGTGCGGTTCAGACACATCT +
Preference number: 2 (lower is better)
Translates to: SVYCPVTHTDVLDSTPTLRYSLG*CGSDTS
Trigger: AGATGTGTCTGAACCGCACCAGCCAAGAGAATATCT...CAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp AATCTCCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGAATGAGATATTCTCTTaGCTGGTGCGGTTCAGACAC +
Preference number: 2 (lower is better)
Translates to: NLHLFHGGGVHHGSTAHQNEIFS*LVRFRH
Trigger: GTGTCTGAACCGCACCAGCCAAGAGAATATCTCATT...CTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGATCAAAGCATGTAGATaGGTAGAAGTAAACTATGAG +
Preference number: 2 (lower is better)
Translates to: CRPDVCSPTYTRVRAVPQIKACR*VEVNYE
Trigger: CTCATAGTTTACTTCTACCCATCTACATGCTTTGAT...CTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637013.1
3UTR-3UTR TCA 90 bp ACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGAGGTATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: TDVLDSTPTLNLHLFHGGIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...ACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: EVEFTMVRLPTRSPNVKVKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...CACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: VTWRWCLHVSEAAFCRPDDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...GTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp AAATATTCATACCCTCCTTTCCTCCCACAGCATTTGTGCACACTCTCATCAACACCCATCTTTGCCCTCTaGGAAAAGCGGCCCGAAATG +
Preference number: 2 (lower is better)
Translates to: KYSYPPFLPQHLCTLSSTPIFAL*EKRPEM
Trigger: CATTTCGGGCCGCTTTTCTCAGAGGGCAAAGATGGG...TGTTGATGAGAGTGTGCACAAATGCTGTGGGAGGAAAGGAGGGTATGAATATTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR-3UTR TCA 90 bp GGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGCAAAGCTTGAAGCCTTaGAGACAGTTTTGTTGTTTC +
Preference number: 2 (lower is better)
Translates to: GAVQTHLCRRSAIIKEEGQSLKP*RQFCCF
Trigger: GAAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTG...CCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGGGAACCCTATCCACATaGCATCTTTCTTTCCCAGAA +
Preference number: 2 (lower is better)
Translates to: SLSLWKVRQLQCSVTWRWGTLST*HLSFPE
Trigger: TTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCC...CCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp TCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCCTCCCATGTATTAGATaGCCTAAAGGTATATCAGTA +
Preference number: 2 (lower is better)
Translates to: SEAAFCRPDVCSPTYTRVLPCIR*PKGISV
Trigger: TACTGATATACCTTTAGGTCATCTAATACATGGGAG...GACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000636009.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CCAACGGTCATAATTTGTTTGTACCACATACCATCTACCCTGCTTAGCATCGAGTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: PTVIICLYHIPSTLLSIESPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...CTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CCTTTGGTAACATCTATCAAGGTTGTGTATACGGTCAGCTTGTTGAGGACAGGTTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: PLVTSIKVVYTVSLLRTGSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...ACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATAGATGTTACCAAAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp TTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: FRHIFAGVLRSSRKKGCFLLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...GAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: SLSLWKVRQLQCSVTWRWLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...CCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp AGCATCGTGGAGTGCTGGGCTCTTCCGTATCTTGATCTGAGTCATGGCTACATGGACATACAGCACCTGTaGTGTATGTATATCACACCT +
Preference number: 2 (lower is better)
Translates to: SIVECWALPYLDLSHGYMDIQHL*CMYITP
Trigger: AGGTGTGATATACATACAGCACAGGTGCTGTATGTC...CATGTAGCCATGACTCAGATCAAGATACGGAAGAGCCCAGCACTCCACGATGCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000518087.7
ENST00000636715.1
ENST00000637202.1
ENST00000637805.1
3UTR-3UTR GCA 90 bp GATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: DGVFMSQRPHSVGQTCAHVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...GTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCAACATACCATCTACCCTaGTTAGCATCGAGTTCATAT +
Preference number: 2 (lower is better)
Translates to: LSRYSHRRAGFNTHAESPTYHLP*LASSSY
Trigger: ATATGAACTCGATGCTAAGCAGGGTAGATGGTATGT...TGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCTGTAGGCCAGACGTGTaGTCACCAACCTATACAAGG +
Preference number: 2 (lower is better)
Translates to: HLSTDGRRQAIDSKRTCRCRPDV*SPTYTR
Trigger: CCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACA...GCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGTCGGTCACATGGAGATaGTGTCTTCATGTCTCAGAG +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWSVTWR*CLHVSE
Trigger: CTCTGAGACATGAAGACACCATCTCCATGTGACCGA...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: NVECLLSRYSHRRAGFNTQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: DTSLQAFCDHQGRRDVSNQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp AGGGTCAGGGCAGTCCCGCAGGTAAGTTTCGAATTGACCTTTGGTAACATCTATCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: RVRAVPQVSFELTFGNIYQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...ATAGATGTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: ECGVFTVPLLTQTCWIQHQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: HLSTDGRRQAIDSKRTCRASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GGTATATCAGTAACAGCGGCAATACCCTTCATTTCCTCTTCAAAAGGGCCAGGAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: GISVTAAIPFISSSKGPGASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TCCTGGCCCTTTTGAAGAGGAAATGAAGGGTATTGCCGCTGTTACTGATATACC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: RYSHRRAGFNTHAESPFIASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...AATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TTCTGTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCCAATATCTTGGTCTTaGTCAATAAATTCTTGGCTT +
Preference number: 2 (lower is better)
Translates to: FCRPDVCSPTYTRVRAVPPISWS*SINSWL
Trigger: AAGCCAAGAATTTATTGACCAAGACCAAGATATTGG...CGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CAA 90 bp CCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTTCGAATaGACCTTTGGTAACATCTATCAAGGTTGTGTATACGGTCAGCTT +
Preference number: 2 (lower is better)
Translates to: PTYTRVRAVPQVSFE*TFGNIYQGCVYGQL
Trigger: AAGCTGACCGTATACACAACCTTGATAGATGTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp TTTCAAATGAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGACGAAGACAAGCTATTaGCTCAAAGAGAACCTGCCG +
Preference number: 2 (lower is better)
Translates to: FQMRYSLGWCGSDTSLQATKTSY*LKENLP
Trigger: CGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGT...CGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: NVECLLSRYSHRRAGFNTIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...GGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp AGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: SVYCPVTHTDVLDSTPTLKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...CAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp CAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: QCSVTWRWCLHVSEAAFCKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...ACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: GRSDSCSVRSHGDGVFMSKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...AGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp TCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: SDSCSVRSHGDGVFMSQRDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...CCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp TGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: CSVRSHGDGVFMSQRPHSDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...AGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp CTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: LKENLPRVLVFGRSDSCSDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...ACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 25 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: GRSDSCSVRSHGDGVFMSDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...AGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp CTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATGTGATTATACAAAATaGAGTGGACAAACGGTCTTG +
Preference number: 2 (lower is better)
Translates to: LSRYSHRRAGFNTHAESPCDYTK*SGQTVL
Trigger: CAAGACCGTTTGTCCACTTCATTTTGTATAATCACA...TGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp TTCACTATAACCTTTAGCACTGGTGCCTTGTCAAGCATCAATTCATGCCATCTTCCCATCTTTGCCCTCTaGGAAAAGCGGCCCGAAATG +
Preference number: 2 (lower is better)
Translates to: FTITFSTGALSSINSCHLPIFAL*EKRPEM
Trigger: CATTTCGGGCCGCTTTTCTCAGAGGGCAAAGATGGG...AAGATGGCATGAATTGATGCTTGACAAGGCACCAGTGCTAAAGGTTATAGTGAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCGGAACCCTATCCACATaGCATCTTTCTTTCCCAGAA +
Preference number: 2 (lower is better)
Translates to: DKLLTQREPAASLSLWKVGTLST*HLSFPE
Trigger: TTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCC...GACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CATACTGATTACTTCTTGAACCCCAAAAAGTGCTATTTAGAGGCAAGGGCCCATTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: HTDYFLNPKKCYLEARAHSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...ATGGGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAAGAAGTAATCAGTATG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp CCAACGGTCATAATTTGTTTGTACCACATACCATCTACCCTGCTTAGCATCGAGTTACTCACACAGACGTaGTGGATTCAACACCCACGC +
Preference number: 2 (lower is better)
Translates to: PTVIICLYHIPSTLLSIELLTQT*WIQHPR
Trigger: GCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA...CTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp TCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGGTGGACAAACGGTCTTaGACAAATGACGTACATTTC +
Preference number: 2 (lower is better)
Translates to: SHRRAGFNTHAESPFIPRVDKRS*TNDVHF
Trigger: GAAATGTACGTCATTTGTGCAAGACCGTTTGTCCAC...CCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCGTGGACAAACGGTCTTaGACAAATGACGTACATTTC +
Preference number: 2 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPVDKRS*TNDVHF
Trigger: GAAATGTACGTCATTTGTGCAAGACCGTTTGTCCAC...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: KLLTQREPAASLSLWKVRQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...TCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp ACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCACAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: TMVRLPTRSPNVKVKQNSQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...TGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AAGAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: KNVECLLSRYSHRRAGFNQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...GTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTCTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: VRLPTRSPNVKVKQNSVNASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...ATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATTCTGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: RLPTRSPNVKVKQNSVNSASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...AGAATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp CATACTGATTACTTCTTGAACCCCAAAAAGTGCTATTTAGAGGCAAGGGCCCATAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: HTDYFLNPKKCYLEARAHRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...ATGGGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAAGAAGTAATCAGTATG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AAGAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: KNVECLLSRYSHRRAGFNFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...GTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTCTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGTTATACAAAATGAAGTaGACAAACGGTCTTGCACAA +
Preference number: 2 (lower is better)
Translates to: AASLSLWKVRQLQCSVTWLYKMK*TNGLAQ
Trigger: TTGTGCAAGACCGTTTGTCCACTTCATTTTGTATAA...CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGCTGGGGCCAATATCTTaGTCTTGGTCAATAAATTCT +
Preference number: 2 (lower is better)
Translates to: SVYCPVTHTDVLDSTPTLLGPIS*SWSINS
Trigger: AGAATTTATTGACCAAGACCAAGATATTGGCCCCAG...CAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATACAGGATAAAGTAGGCTaGGGCCAATATCTTGGTCTT +
Preference number: 2 (lower is better)
Translates to: LCRRSAIIKEEGMFPTVIQDKVG*GQYLGL
Trigger: AAGACCAAGATATTGGCCCCAGCCTACTTTATCCTG...TATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAGATATTCTCTTGGCTaGTGCGGTTCAGACACATCT +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWRYSLG*CGSDTS
Trigger: AGATGTGTCTGAACCGCACCAGCCAAGAGAATATCT...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAATGAGATATTCTCTTaGCTGGTGCGGTTCAGACAC +
Preference number: 2 (lower is better)
Translates to: EFTMVRLPTRSPNVKVKQNEIFS*LVRFRH
Trigger: GTGTCTGAACCGCACCAGCCAAGAGAATATCTCATT...TTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CAA 90 bp TTTCAAATGAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTaGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAAC +
Preference number: 2 (lower is better)
Translates to: FQMRYSLGWCGSDTS*QAFCDHQGRRDVSN
Trigger: GTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp TCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: SRYSHRRAGFNTHAESPFKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...AAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp TCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: SHRRAGFNTHAESPFIPRKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...CCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCATAGCCAGCAAAGCTTaGAGCCTTGAAGACAGTTTT +
Preference number: 2 (lower is better)
Translates to: DKLLTQREPAASLSLWKVIASKA*SLEDSF
Trigger: AAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTAT...GACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp CATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCATACGGTCAGCTTGTTaGGGACAGGTTTTGTTGACA +
Preference number: 2 (lower is better)
Translates to: HLSTDGRRQAIDSKRTCRIRSAC*GQVLLT
Trigger: TGTCAACAAAACCTGTCCTCAACAAGCTGACCGTAT...GCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCGTGGACAAACGGTCTTaGACAAATGACGTACATTTC +
Preference number: 2 (lower is better)
Translates to: DKLLTQREPAASLSLWKVVDKRS*TNDVHF
Trigger: GAAATGTACGTCATTTGTGCAAGACCGTTTGTCCAC...GACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: VRLPTRSPNVKVKQNSVNQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...ATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AACTGTTCTAGTGAGGAACCCTATCCACATGACATCTTTCTTTCCCAGAATCCAGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: NCSSEEPYPHDIFLSQNPASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...TGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TGTCATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: CHLSTDGRRQAIDSKRTCASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...GCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATGACA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GCTATTTTCCAGAACTGTTCTAGTGAGGAACCCTATCCACATGACATCTTTCTTAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: AIFQNCSSEEPYPHDIFLRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...AAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTTCTGGAAAATAGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TTCACTATAACCTTTAGCACTGGTGCCTTGTCAAGCATCAATTCATGCCATCTTAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: FTITFSTGALSSINSCHLRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...AAGATGGCATGAATTGATGCTTGACAAGGCACCAGTGCTAAAGGTTATAGTGAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 10 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636920.1
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CCAGGCAATTTTTCATCCACCACCTGCATAATTTTTCCACTTGGCACGAATGTAGTGCCACGAAAAGGGTaGCGTAGAGAAAGAGAGAGA +
Preference number: 2 (lower is better)
Translates to: PGNFSSTTCIIFPLGTNVVPRKG*RRERER
Trigger: TCTCTCTCTTTCTCTACGCCACCCTTTTCGTGGCAC...TACATTCGTGCCAAGTGGAAAAATTATGCAGGTGGTGGATGAAAAATTGCCTGG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR-3UTR CCA 90 bp GACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCATTTATGGTGTACCATaGAACTGCACCTCTGTACGT +
Preference number: 2 (lower is better)
Translates to: DKLLTQREPAASLSLWKVIYGVP*NCTSVR
Trigger: ACGTACAGAGGTGCAGTTCCATGGTACACCATAAAT...GACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGATGGTCAATAAATTCTTaGCTTCTTCATAACTTGTGC +
Preference number: 2 (lower is better)
Translates to: GWCGSDTSLQAFCDHQGRWSINS*LLHNLC
Trigger: GCACAAGTTATGAAGAAGCCAAGAATTTATTGACCA...TCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATGGTCAATAAATTCTTaGCTTCTTCATAACTTGTGC +
Preference number: 2 (lower is better)
Translates to: LSRYSHRRAGFNTHAESPWSINS*LLHNLC
Trigger: GCACAAGTTATGAAGAAGCCAAGAATTTATTGACCA...TGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp TTAGCACTGGTGCCTTGTCAAGCATCAATTCATGCCATCTTTTGTAGGGTGGTAATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: LALVPCQASIHAIFCRVVIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...TACCACCCTACAAAAGATGGCATGAATTGATGCTTGACAAGGCACCAGTGCTAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636920.1
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: NVECLLSRYSHRRAGFNTKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...GGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp ACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: TSLQAFCDHQGRRDVSNGKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...ACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp TCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: SLQAFCDHQGRRDVSNGHKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...ATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: EFTMVRLPTRSPNVKVKQDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...TTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp TATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTTCGAATTGACCTTTGGTAACGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: YTRVRAVPQVSFELTFGNDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...GTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAACAAAGCTTGAAGCCTTaGAGACAGTTTTGTTGTTTC +
Preference number: 2 (lower is better)
Translates to: EFTMVRLPTRSPNVKVKQQSLKP*RQFCCF
Trigger: GAAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTG...TTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp CTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATACAAAGCTTGAAGCCTTaGAGACAGTTTTGTTGTTTC +
Preference number: 2 (lower is better)
Translates to: LCRRSAIIKEEGMFPTVIQSLKP*RQFCCF
Trigger: GAAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTG...TATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AATGAAGTGGACAAACGGTCTTGCACAAATGACGTACATTTCACAGTTAATCGTTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: NEVDKRSCTNDVHFTVNRSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...ACGATTAACTGTGAAATGTACGTCATTTGTGCAAGACCGTTTGTCCACTTCATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp CCTTTGGTAACATCTATCAAGGTTGTGTATACGGTCAGCTTGTTGAGGACAGGTTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: PLVTSIKVVYTVSLLRTGLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...ACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATAGATGTTACCAAAGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp AGGCCAGGCAATTTTTCATCCACCACCTGCATAATTTTTCCACTTGGCACGAATTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: RPGNFSSTTCIIFPLGTNLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...ATTCGTGCCAAGTGGAAAAATTATGCAGGTGGTGGATGAAAAATTGCCTGGCCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 19 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: VRLPTRSPNVKVKQNSVNLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...ATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAAC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp CATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGTGGACAAACGGTCTTaGACAAATGACGTACATTTC +
Preference number: 2 (lower is better)
Translates to: HLSTDGRRQAIDSKRTCRVDKRS*TNDVHF
Trigger: GAAATGTACGTCATTTGTGCAAGACCGTTTGTCCAC...GCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp GGCACTCTTTCCAGTGACTGTTTATTGAGTGTCAGGAACACAACTGTGATTATATGTAGGCCAGACGTGTaGTCACCAACCTATACAAGG +
Preference number: 2 (lower is better)
Translates to: GTLSSDCLLSVRNTTVIICRPDV*SPTYTR
Trigger: CCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACA...TATAATCACAGTTGTGTTCCTGACACTCAATAAACAGTCACTGGAAAGAGTGCC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000636009.1
3UTR-3UTR CCA 90 bp TCTGTCATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: SVICQQMDEDKLLTQREPASLSL*KVRQLQ
Trigger: CTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGC...AGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATGACAGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp ATCAAGGAAGAAGGGATGTTTCCAACGGTCATAATTTGTTTGTACCACATACCAAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: IKEEGMFPTVIICLYHIPRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...TGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TCACACAGACGTGCTGGATTCAACACCCACGCTGAATCTCCATTTATTCCACGGTATCTGGTTAAGAGGTaGTATCAGTCATGTAAGAGT +
Preference number: 2 (lower is better)
Translates to: SHRRAGFNTHAESPFIPRYLVKR*YQSCKS
Trigger: ACTCTTACATGACTGATACCACCTCTTAACCAGATA...CCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637790.2
3UTR-3UTR CCA 90 bp ACATCCAATGATTCCTTTCTGTCTCGTGTAATCACACAACCTTCCCCAGACTGGATTTATGGTGTACCATaGAACTGCACCTCTGTACGT +
Preference number: 2 (lower is better)
Translates to: TSNDSFLSRVITQPSPDWIYGVP*NCTSVR
Trigger: ACGTACAGAGGTGCAGTTCCATGGTACACCATAAAT...CCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAGGAATCATTGGATGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTTGGTCAATAAATTCTTaGCTTCTTCATAACTTGTGC +
Preference number: 2 (lower is better)
Translates to: QCSVTWRWCLHVSEAAFCWSINS*LLHNLC
Trigger: GCACAAGTTATGAAGAAGCCAAGAATTTATTGACCA...ACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGACCAATATCTTGGTCTTaGTCAATAAATTCTTGGCTT +
Preference number: 2 (lower is better)
Translates to: VRFRHIFAGVLRSSRKKGPISWS*SINSWL
Trigger: AAGCCAAGAATTTATTGACCAAGACCAAGATATTGG...TCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCAC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp CATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: HLSTDGRRQAIDSKRTCRKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...GCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCAAAGCTTGAAGCCTTaGAGACAGTTTTGTTGTTTC +
Preference number: 2 (lower is better)
Translates to: VQTHLCRRSAIIKEEGMFQSLKP*RQFCCF
Trigger: GAAACAACAAAACTGTCTTCAAGGCTTCAAGCTTTG...AAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCTTCATATACATCCAATaGTTCCTTTCTGTCTCGTGT +
Preference number: 2 (lower is better)
Translates to: NVECLLSRYSHRRAGFNTFIYIQ*FLSVSC
Trigger: ACACGAGACAGAAAGGAATCATTGGATGTATATGAA...GGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AGGCCAGGCAATTTTTCATCCACCACCTGCATAATTTTTCCACTTGGCACGAATTATATATCCAGAAAATaGGTACCCAGACACCCCCAA +
Preference number: 2 (lower is better)
Translates to: RPGNFSSTTCIIFPLGTNYISRK*VPRHPQ
Trigger: TTGGGGGTGTCTGGGTACTCATTTTCTGGATATATA...ATTCGTGCCAAGTGGAAAAATTATGCAGGTGGTGGATGAAAAATTGCCTGGCCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 19 nt.
Matches the following 2 transcripts:
ENST00000636715.1
ENST00000637202.1
3UTR-3UTR GCA 90 bp ATTGCTTTGCATACTGATTACTTCTTGAACCCCAAAAAGTGCTATTTAGAGGCAGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGA +
Preference number: 2 (lower is better)
Translates to: IALHTDYFLNPKKCYLEAGRSDS*SVRSHG
Trigger: TCCATGTGACCGAACACTGCAGCTGTCTGACCTTCC...TGCCTCTAAATAGCACTTTTTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp AACTGTTCTAGTGAGGAACCCTATCCACATGACATCTTTCTTTCCCAGAATCCATTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: NCSSEEPYPHDIFLSQNPLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...TGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATGTGGACAAACGGTCTTaGACAAATGACGTACATTTC +
Preference number: 2 (lower is better)
Translates to: VRLPTRSPNVKVKQNSVNVDKRS*TNDVHF
Trigger: GAAATGTACGTCATTTGTGCAAGACCGTTTGTCCAC...ATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTTTCGAATTGACCTTTGGTAACGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: YTRVRAVPQVSFELTFGNVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...GTTACCAAAGGTCAATTCGAAACTTACCTGCGGGACTGCCCTGACCCTTGTATA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp GAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: EFTMVRLPTRSPNVKVKQVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...TTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: QTHLCRRSAIIKEEGMFPVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...TGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GTAACATCTATCAAGGTTGTGTATACGGTCAGCTTGTTGAGGACAGGTTTTGTTCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: VTSIKVVYTVSLLRTGFVQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...AACAAAACCTGTCCTCAACAAGCTGACCGTATACACAACCTTGATAGATGTTAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CCATTTATACTGAAACGTTCATTCAGTGTAAGACTGAACAGTCCTGGTTTGAATAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: PFILKRSFSVRLNSPGLNRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...ATTCAAACCAGGACTGTTCAGTCTTACACTGAATGAACGTTTCAGTATAAATGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCTTATACAAAATGAAGTaGACAAACGGTCTTGCACAA +
Preference number: 2 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPLYKMK*TNGLAQ
Trigger: TTGTGCAAGACCGTTTGTCCACTTCATTTTGTATAA...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATTTATACAAAATGAAGTaGACAAACGGTCTTGCACAA +
Preference number: 2 (lower is better)
Translates to: VYCPVTHTDVLDSTPTLNLYKMK*TNGLAQ
Trigger: TTGTGCAAGACCGTTTGTCCACTTCATTTTGTATAA...ATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp ATGAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCTGGTCAATAAATTCTTaGCTTCTTCATAACTTGTGC +
Preference number: 2 (lower is better)
Translates to: MRYSLGWCGSDTSLQAFCWSINS*LLHNLC
Trigger: GCACAAGTTATGAAGAAGCCAAGAATTTATTGACCA...GCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CAA 90 bp GCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATAATTTGTTaGTACCACATACCATCTACCCTGCTTAGCATCGAGTTCATATAC +
Preference number: 2 (lower is better)
Translates to: AIIKEEGMFPTVIIC*YHIPSTLLSIEFIY
Trigger: GTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp ATGAAGTGGACAAACGGTCTTGCACAAATGACGTACATTTCACAGTTAATCGTGATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: MKWTNGLAQMTYISQLIVIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...CACGATTAACTGTGAAATGTACGTCATTTGTGCAAGACCGTTTGTCCACTTCAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: VRLPTRSPNVKVKQNSVNDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...ATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 26 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp GTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGGATGTTTTCAGGAACACAACTGTaGTTATACAAAATGAAGTGG +
Preference number: 2 (lower is better)
Translates to: VQTHLCRRSAIIKEEGMFSGTQL*LYKMKW
Trigger: CCACTTCATTTTGTATAATCACAGTTGTGTTCCTGA...AAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636701.1
3UTR-3UTR GCA 90 bp TTTAGTTGCTCAGTTATGACCCAGGTATCATTATTTATGTTCCACCCAAGAAATTCACCATGGTTCGACTaGCCACCAGATCCCCAAATG +
Preference number: 2 (lower is better)
Translates to: FSCSVMTQVSLFMFHPRNSPWFD*PPDPQM
Trigger: CATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGA...ATTTCTTGGGTGGAACATAAATAATGATACCTGGGTCATAACTGAGCAACTAAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TTCATCCACCACCTGCATAATTTTTCCACTTGGCACGAATGTATTTATCATATTAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGAT +
Preference number: 2 (lower is better)
Translates to: FIHHLHNFSTWHECIYHIRWSSP*FDCPPD
Trigger: ATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCT...AATATGATAAATACATTCGTGCCAAGTGGAAAAATTATGCAGGTGGTGGATGAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp ACATACCATCTACCCTGCTTAGCATCGAGTTCATATACATCCAATGATTCCTTTTTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: TYHLPCLASSSYTSNDSFFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...AAAGGAATCATTGGATGTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGT
42% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTGGTTATACAAAATGAAGTaGACAAACGGTCTTGCACAA +
Preference number: 2 (lower is better)
Translates to: DEDKLLTQREPAASLSLWLYKMK*TNGLAQ
Trigger: TTGTGCAAGACCGTTTGTCCACTTCATTTTGTATAA...CCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp GAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAATTATACAAAATGAAGTaGACAAACGGTCTTGCACAA +
Preference number: 2 (lower is better)
Translates to: EFTMVRLPTRSPNVKVKQLYKMK*TNGLAQ
Trigger: TTGTGCAAGACCGTTTGTCCACTTCATTTTGTATAA...TTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp TCATACCCTCCTTTCCTCCCACAGCATTTGTGCACACTCTCATCAACATGTTTAGTAAGTCAAGATTTATaGTGTACCATGGAACTGCAC +
Preference number: 2 (lower is better)
Translates to: SYPPFLPQHLCTLSSTCLVSQDL*CTMELH
Trigger: GTGCAGTTCCATGGTACACCATAAATCTTGACTTAC...TAAACATGTTGATGAGAGTGTGCACAAATGCTGTGGGAGGAAAGGAGGGTATGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR-3UTR TCA 90 bp ATTGCTTTGCATACTGATTACTTCTTGAACCCCAAAAAGTGCTATTTAGAGGCAACGAAGACAAGCTATTaGCTCAAAGAGAACCTGCCG +
Preference number: 2 (lower is better)
Translates to: IALHTDYFLNPKKCYLEATKTSY*LKENLP
Trigger: CGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGT...TGCCTCTAAATAGCACTTTTTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAAT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 25 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp ACATACCATCTACCCTGCTTAGCATCGAGTTCATATACATCCAATGATTCCTTTATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: TYHLPCLASSSYTSNDSFIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...AAAGGAATCATTGGATGTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAAACAAAACTCAGTGAATTCAGGAACACAACTGTaGTTATACAAAATGAAGTGG +
Preference number: 2 (lower is better)
Translates to: VRLPTRSPNVKVKQNSVNSGTQL*LYKMKW
Trigger: CCACTTCATTTTGTATAATCACAGTTGTGTTCCTGA...ATTCACTGAGTTTTGTTTCACTTTGACATTTGGGGATCTGGTGGGCAGTCGAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 12 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp TTCTGCGATCATCAAGGAAGAAGGGATGTTTCCAACGGTCATAATTTGTTTGTATTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: FCDHQGRRDVSNGHNLFVLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...TACAAACAAATTATGACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp AAAGGTTTTAGTTGCTCAGTTATGACCCAGGTATCATTATTTATGTTCCACCCATTTATTCCACGGAGGTaGAGTTCACCATGGTTCGAC +
Preference number: 2 (lower is better)
Translates to: KGFSCSVMTQVSLFMFHPFIPRR*SSPWFD
Trigger: GTCGAACCATGGTGAACTCCACCTCCGTGGAATAAA...TGGGTGGAACATAAATAATGATACCTGGGTCATAACTGAGCAACTAAAACCTTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp CATTTGTCAACAGATGGACGAAGACAAGCTATTGACTCAAAGAGAACCTGCCGCTTATACAAAATGAAGTaGACAAACGGTCTTGCACAA +
Preference number: 2 (lower is better)
Translates to: HLSTDGRRQAIDSKRTCRLYKMK*TNGLAQ
Trigger: TTGTGCAAGACCGTTTGTCCACTTCATTTTGTATAA...GCGGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTCCATCTGTTGACAAATG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CCA 90 bp AACTGTTCTAGTGAGGAACCCTATCCACATGACATCTTTCTTTCCCAGAATCCAGTAAGTCAAGATTTATaGTGTACCATGGAACTGCAC +
Preference number: 2 (lower is better)
Translates to: NCSSEEPYPHDIFLSQNPVSQDL*CTMELH
Trigger: GTGCAGTTCCATGGTACACCATAAATCTTGACTTAC...TGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000636160.1
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp ATACAAAATGAAGTGGACAAACGGTCTTGCACAAATGACGTACATTTCACAGTTATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: IQNEVDKRSCTNDVHFTVIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...AACTGTGAAATGTACGTCATTTGTGCAAGACCGTTTGTCCACTTCATTTTGTAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp CTTGCACAAATGACGTACATTTCACAGTTAATCGTGAAGGTTAGAAAGGTTAACATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: LAQMTYISQLIVKVRKVNIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...GTTAACCTTTCTAACCTTCACGATTAACTGTGAAATGTACGTCATTTGTGCAAG
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp TGTACCACATACCATCTACCCTGCTTAGCATCGAGTTCATATACATCCAATGATAAAGAAATATACAGGTaGATGTCTGTCTCATCCCTC +
Preference number: 2 (lower is better)
Translates to: CTTYHLPCLASSSYTSNDKEIYR*MSVSSL
Trigger: GAGGGATGAGACAGACATTCACCTGTATATTTCTTT...ATCATTGGATGTATATGAACTCGATGCTAAGCAGGGTAGATGGTATGTGGTACA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp GAAGAAGGGATGTTTCCAACGGTCATAATTTGTTTGTACCACATACCATCTACCGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: EEGMFPTVIICLYHIPSTDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...GGTAGATGGTATGTGGTACAAACAAATTATGACCGTTGGAAACATCCCTTCTTC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR TCA 90 bp AATGAAGTGGACAAACGGTCTTGCACAAATGACGTACATTTCACAGTTAATCGTATAGCCAGCAAAGCTTaGAGCCTTGAAGACAGTTTT +
Preference number: 2 (lower is better)
Translates to: NEVDKRSCTNDVHFTVNRIASKA*SLEDSF
Trigger: AAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTAT...ACGATTAACTGTGAAATGTACGTCATTTGTGCAAGACCGTTTGTCCACTTCATT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636701.1
ENST00000637244.1
3UTR-3UTR TCA 90 bp AAGTTAGCAACTTCCTTAGGGTTACTGGGAAGTAGAGTAATTATGAAAAAGGGAATACGGTCAGCTTGTTaGGGACAGGTTTTGTTGACA +
Preference number: 2 (lower is better)
Translates to: KLATSLGLLGSRVIMKKGIRSAC*GQVLLT
Trigger: TGTCAACAAAACCTGTCCTCAACAAGCTGACCGTAT...TCCCTTTTTCATAATTACTCTACTTCCCAGTAACCCTAAGGAAGTTGCTAACTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 10 transcripts:
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp CTTGCACAAATGACGTACATTTCACAGTTAATCGTGAAGGTTAGAAAGGTTAACTTGAACCCCAAAAAGTaGTATTTAGAGGCAAGGGCC +
Preference number: 2 (lower is better)
Translates to: LAQMTYISQLIVKVRKVNLNPKK*YLEARA
Trigger: GGCCCTTGCCTCTAAATAGCACTTTTTGGGGTTCAA...GTTAACCTTTCTAACCTTCACGATTAACTGTGAAATGTACGTCATTTGTGCAAG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637244.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp ACTGTTCTAGTGAGGAACCCTATCCACATGACATCTTTCTTTCCCAGAATCCATGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: TVLVRNPIHMTSFFPRIHVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...ATGGATTCTGGGAAAGAAAGATGTCATGTGGATAGGGTTCCTCACTAGAACAGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp TTTAGTTGCTCAGTTATGACCCAGGTATCATTATTTATGTTCCACCCAAGAAATCAGTGTTCGGTCACATaGAGATGGTGTCTTCATGTC +
Preference number: 2 (lower is better)
Translates to: FSCSVMTQVSLFMFHPRNQCSVT*RWCLHV
Trigger: GACATGAAGACACCATCTCCATGTGACCGAACACTG...ATTTCTTGGGTGGAACATAAATAATGATACCTGGGTCATAACTGAGCAACTAAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CCA 90 bp GGCACTCTTTCCAGTGACTGTTTATTGAGTGTCAGGAACACAACTGTGATTATATGGGTTGATAGTATCTaGTTAAGAGGTGGTATCAGT +
Preference number: 2 (lower is better)
Translates to: GTLSSDCLLSVRNTTVIIWVDSI*LRGGIS
Trigger: ACTGATACCACCTCTTAACCAGATACTATCAACCCA...TATAATCACAGTTGTGTTCCTGACACTCAATAAACAGTCACTGGAAAGAGTGCC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637790.2
3UTR-3UTR TCA 90 bp TTCATCCACCACCTGCATAATTTTTCCACTTGGCACGAATGTATTTATCATATTATTCAACACCCACGCTaGATCTCCATTTATTCCACG +
Preference number: 2 (lower is better)
Translates to: FIHHLHNFSTWHECIYHIIQHPR*ISIYST
Trigger: CGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAAT...AATATGATAAATACATTCGTGCCAAGTGGAAAAATTATGCAGGTGGTGGATGAA
39% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR GCA 90 bp ATGAAGTGGACAAACGGTCTTGCACAAATGACGTACATTTCACAGTTAATCGTGGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: MKWTNGLAQMTYISQLIVVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...CACGATTAACTGTGAAATGTACGTCATTTGTGCAAGACCGTTTGTCCACTTCAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636701.1
ENST00000637244.1
3UTR-3UTR CCA 90 bp CTTGCACAAATGACGTACATTTCACAGTTAATCGTGAAGGTTAGAAAGGTTAACATTTATGGTGTACCATaGAACTGCACCTCTGTACGT +
Preference number: 2 (lower is better)
Translates to: LAQMTYISQLIVKVRKVNIYGVP*NCTSVR
Trigger: ACGTACAGAGGTGCAGTTCCATGGTACACCATAAAT...GTTAACCTTTCTAACCTTCACGATTAACTGTGAAATGTACGTCATTTGTGCAAG
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR-3UTR TCA 90 bp TTCCACAAGTCTTTGACTTGTTTATTTACTAAATTAACAGAACGTGGGATGCAGATAGCCAGCAAAGCTTaGAGCCTTGAAGACAGTTTT +
Preference number: 2 (lower is better)
Translates to: FHKSLTCLFTKLTERGMQIASKA*SLEDSF
Trigger: AAAACTGTCTTCAAGGCTTCAAGCTTTGCTGGCTAT...CTGCATCCCACGTTCTGTTAATTTAGTAAATAAACAAGTCAAAGACTTGTGGAA
38% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000637095.1
ENST00000637244.1
3UTR-3UTR TCA 90 bp TTCCACAAGTCTTTGACTTGTTTATTTACTAAATTAACAGAACGTGGGATGCAGGATTGCTTTGCATACTaGTTACTTCTTGAACCCCAA +
Preference number: 2 (lower is better)
Translates to: FHKSLTCLFTKLTERGMQDCFAY*LLLEPQ
Trigger: TTGGGGTTCAAGAAGTAATCAGTATGCAAAGCAATC...CTGCATCCCACGTTCTGTTAATTTAGTAAATAAACAAGTCAAAGACTTGTGGAA
37% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 18 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000637095.1
ENST00000637244.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR TCA 90 bp ATACAAAATGAAGTGGACAAACGGTCTTGCACAAATGACGTACATTTCACAGTTTCAGGAACACAACTGTaGTTATACAAAATGAAGTGG +
Preference number: 2 (lower is better)
Translates to: IQNEVDKRSCTNDVHFTVSGTQL*LYKMKW
Trigger: CCACTTCATTTTGTATAATCACAGTTGTGTTCCTGA...AACTGTGAAATGTACGTCATTTGTGCAAGACCGTTTGTCCACTTCATTTTGTAT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636171.1
ENST00000636691.1
ENST00000636701.1
ENST00000637528.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR GCA 90 bp AAGTTAGCAACTTCCTTAGGGTTACTGGGAAGTAGAGTAATTATGAAAAAGGGAGTTAAAGGTTTTAGTTaGTCAGTTATGACCCAGGTA +
Preference number: 2 (lower is better)
Translates to: KLATSLGLLGSRVIMKKGVKGFS*SVMTQV
Trigger: TACCTGGGTCATAACTGAGCAACTAAAACCTTTAAC...TCCCTTTTTCATAATTACTCTACTTCCCAGTAACCCTAAGGAAGTTGCTAACTT
37% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 10 transcripts:
ENST00000636009.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CAA 90 bp TTTAATGTAAATCCTCTTATAATTCCTCGTTTCACTAAAGTAATCTaGGAATCACTAAAGTTTTGTGGAAGCACCACCTATCTGGGGGAA +
Preference number: 2 (lower is better)
Translates to: FNVNPLIIPRFTKVI*ESLKFCGSTTYLGE
Trigger: TTCCCCCAGATAGGTGGTGCTTCCACAAAACTTTAGTGATTCCAAGATTACTTTAGTGAAACGAGGAATTATAAGAGGATTTACATTAAA
36% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000637790.2
3UTR GCA 72 bp CCGTGGCGCCTCGATGGGGCGCCTCTAGCAGGCGGGTaGAGCCTGTCCCGCGTACCCAGGCGTCCTCGGTAC +
Preference number: 3 (lower is better)
Translates to: PWRLDGAPLAGG*SLSRVPRRPRY
Trigger: GTACCGAGGACGCCTGGGTACGCGGGACAGGCTGCACCCGCCTGCTAGAGGCGCCCCATCGAGGCGCCACGG
74% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637946.1
3UTR TCA 72 bp CTGTCCACGGCGGCGCGTGCTGCGCGACGGCACAGCTaGCGGCGGCAGCCAGGAGGACTAAGGCGACGCAAC +
Preference number: 3 (lower is better)
Translates to: LSTAARAARRHS*RRQPGGLRRRN
Trigger: GTTGCGTCGCCTTAGTCCTCCTGGCTGCCGCCGTCAGCTGTGCCGTCGCGCAGCACGCGCCGCCGTGGACAG
72% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR GCA 72 bp GATTTTCTGCAGTCCTCTGTCCACGGCGGCGCGTGCTaGGCGACGGCACAGCTGACGGCGGCAGCCAGGAGG +
Preference number: 3 (lower is better)
Translates to: DFLQSSVHGGAC*ATAQLTAAARR
Trigger: CCTCCTGGCTGCCGCCGTCAGCTGTGCCGTCGCGCAGCACGCGCCGCCGTGGACAGAGGACTGCAGAAAATC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR GCA 72 bp TGGCGTAGAGAAAGAGAGAGAGCCTTCCAGGCTACCTaGAGAAGGAGAGTCGCGATCGCCTTTGGCGCGTGG +
Preference number: 3 (lower is better)
Translates to: WRRERERAFQAT*RRRVAIAFGAW
Trigger: CCACGCGCCAAAGGCGATCGCGACTCTCCTTCTGCAGGTAGCCTGGAAGGCTCTCTCTCTTTCTCTACGCCA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR TCA 72 bp GTTCCTTGTCAATACCAGACTCTGCGCTCCTTGAGGTaGGGACGGCCCCCAACACTGACGTCACTGCCTGCA +
Preference number: 3 (lower is better)
Translates to: VPCQYQTLRSLR*GRPPTLTSLPA
Trigger: TGCAGGCAGTGACGTCAGTGTTGGGGGCCGTCCTCACCTCAAGGAGCGCAGAGTCTGGTATTGACAAGGAAC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637946.1
3UTR GCA 72 bp CATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTaGTCACCAACCTATACAAGGGTCAGGGCAGTCCCG +
Preference number: 3 (lower is better)
Translates to: HVSEAAFCRPDV*SPTYTRVRAVP
Trigger: CGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636455.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR GCA 72 bp TGTACGTTGGTCCTGAAGGAGGATAGGTTGATTTTCTaGAGTCCTCTGTCCACGGCGGCGCGTGCTGCGCGA +
Preference number: 3 (lower is better)
Translates to: CTLVLKEDRLIF*SPLSTAARAAR
Trigger: TCGCGCAGCACGCGCCGCCGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637244.1
3UTR-3UTR CAA 90 bp CCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAAGGGCCAGGAAAGTaGCCAAGTAGGCCAGGCAAT +
Preference number: 3 (lower is better)
Translates to: PRRWSSPWFDCPPDPQMSKGPGK*PSRPGN
Trigger: ATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTT...TGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCTGCACCTCTGTACGTaGGTCCTGAAGGAGGATAGG +
Preference number: 3 (lower is better)
Translates to: DSCSVRSHGDGVFMSQRPLHLCT*VLKEDR
Trigger: CCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAG...CGGCCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTC
56% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGGGTTCAGACACATCTTaGCAGGCGTTCTGCGATCAT +
Preference number: 3 (lower is better)
Translates to: ARRVLTNLYKGQGSPAGKGSDTS*QAFCDH
Trigger: ATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACC...CTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGGAAAGGGCCAGGAAAGTaGCCAAGTAGGCCAGGCAAT +
Preference number: 3 (lower is better)
Translates to: AASLSLWKVRQLQCSVTWKGPGK*PSRPGN
Trigger: ATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTT...CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GAATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACGAGTCGCGATCGCCTTaGGCGCGTGGCGTGATCCAT +
Preference number: 3 (lower is better)
Translates to: ECGVFTVPLLTQTCWIQHESRSP*ARGVIH
Trigger: ATGGATCACGCCACGCGCCAAAGGCGATCGCGACTC...GTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACATTC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR-3UTR CAA 90 bp GAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGCTGCACCTCTGTACGTaGGTCCTGAAGGAGGATAGG +
Preference number: 3 (lower is better)
Translates to: EVEFTMVRLPTRSPNVKVLHLCT*VLKEDR
Trigger: CCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAG...CACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GTCACATGGAGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACCTGCACCTCTGTACGTaGGTCCTGAAGGAGGATAGG +
Preference number: 3 (lower is better)
Translates to: VTWRWCLHVSEAAFCRPDLHLCT*VLKEDR
Trigger: CCTATCCTCCTTCAGGACCAACGTACAGAGGTGCAG...GTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCTCCATGTGAC
54% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR GCA 72 bp TGTACGTTGGTCCTGAAGGAGGATAGGTTGATTTTCTaGAGTCCTCTGTCCACCAGGCGTCCTCGGTACCCA +
Preference number: 3 (lower is better)
Translates to: CTLVLKEDRLIF*SPLSTRRPRYP
Trigger: TGGGTACCGAGGACGCCTGGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637484.1
3UTR CCA 72 bp AACACCCACGCTGAATCTCCATTTATTCCACGGAGGTaGAGTTCACCATGGTTCGACTGCCCACCAGATCCC +
Preference number: 3 (lower is better)
Translates to: NTHAESPFIPRR*SSPWFDCPPDP
Trigger: GGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp AGATGGTGTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCAAAAGGGCCAGGAAAGTaGCCAAGTAGGCCAGGCAAT +
Preference number: 3 (lower is better)
Translates to: RWCLHVSEAAFCRPDVCSKGPGK*PSRPGN
Trigger: ATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTT...TGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGACACCATCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GTGGTAAGTCAAGATTTATGGTGTACCATGGAACTGCACCTCTGTACGTTGGTCGAGTCGCGATCGCCTTaGGCGCGTGGCGTGATCCAT +
Preference number: 3 (lower is better)
Translates to: VVSQDLWCTMELHLCTLVESRSP*ARGVIH
Trigger: ATGGATCACGCCACGCGCCAAAGGCGATCGCGACTC...GACCAACGTACAGAGGTGCAGTTCCATGGTACACCATAAATCTTGACTTACCAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637946.1
3UTR-3UTR CAA 90 bp TTTCAAATGAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGGAGTCGCGATCGCCTTaGGCGCGTGGCGTGATCCAT +
Preference number: 3 (lower is better)
Translates to: FQMRYSLGWCGSDTSLQAESRSP*ARGVIH
Trigger: ATGGATCACGCCACGCGCCAAAGGCGATCGCGACTC...CGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTCATTTGAAA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
3UTR GCA 72 bp CTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTaGAGTGTTCGGTCACATGGAGATGGTGTCTTCATG +
Preference number: 3 (lower is better)
Translates to: LPRVLVFGRSDS*SVRSHGDGVFM
Trigger: CATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR GCA 72 bp GGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTaGGATCATCAAGGAAGAAGGGATGTTTCCAACGGT +
Preference number: 3 (lower is better)
Translates to: GWCGSDTSLQAF*DHQGRRDVSNG
Trigger: ACCGTTGGAAACATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp CCATTTATTCCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCGACGAAGACAAGCTATaGACTCAAAGAGAACCTGCC +
Preference number: 3 (lower is better)
Translates to: PFIPRRWSSPWFDCPPDPDEDKL*TQREPA
Trigger: GGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC...GGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp TGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAGGAAGAAGGAAAGGGCCAGGAAAGTaGCCAAGTAGGCCAGGCAAT +
Preference number: 3 (lower is better)
Translates to: WCGSDTSLQAFCDHQGRRKGPGK*PSRPGN
Trigger: ATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTT...CCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp AAGGGCCAGGAAAGTTGCCAAGTAGGCCAGGCAATTTTTCATCCACCACCTGCAAAAGGGCCAGGAAAGTaGCCAAGTAGGCCAGGCAAT +
Preference number: 3 (lower is better)
Translates to: KGQESCQVGQAIFHPPPAKGPGK*PSRPGN
Trigger: ATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTT...TGCAGGTGGTGGATGAAAAATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 18 transcripts:
ENST00000518087.7
ENST00000523593.6
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636299.1
ENST00000636494.1
ENST00000636715.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637202.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637805.1
3UTR-3UTR CAA 90 bp TTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGATCATCAAAAGGGCCAGGAAAGTaGCCAAGTAGGCCAGGCAAT +
Preference number: 3 (lower is better)
Translates to: FSWLVRFRHIFAGVLRSSKGPGK*PSRPGN
Trigger: ATTGCCTGGCCTACTTGGCAACTTTCCTGGCCCTTT...TGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp CCACGGAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAGGCAAGGGCCCATTTaGTGCCCATTAAAAGAAATA +
Preference number: 3 (lower is better)
Translates to: PRRWSSPWFDCPPDPQMSRQGPI*CPLKEI
Trigger: TATTTCTTTTAATGGGCACAAAATGGGCCCTTGCCT...TGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp GTAGGCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGCATACTGATTACTTCTaGAACCCCAAAAAGTGCTAT +
Preference number: 3 (lower is better)
Translates to: VGQTCAHQPIQGSGQSRRHTDYF*NPKKCY
Trigger: ATAGCACTTTTTGGGGTTCAAGAAGTAATCAGTATG...CCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGCCTAC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GCCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTGGCTTCTTCATAACTaGTGCTATTTTCCAGAACTG +
Preference number: 3 (lower is better)
Translates to: ARRVLTNLYKGQGSPAGKWLLHN*CYFPEL
Trigger: CAGTTCTGGAAAATAGCACAAGTTATGAAGAAGCCA...CTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp AGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGGGTTCAGACACATCTTaGCAGGCGTTCTGCGATCAT +
Preference number: 3 (lower is better)
Translates to: SVYCPVTHTDVLDSTPTLGSDTS*QAFCDH
Trigger: ATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACC...CAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR GCA 72 bp TGTACGTTGGTCCTGAAGGAGGATAGGTTGATTTTCTaGAGTCCTCTGTCCACTGCAGAAGGAGAGTCGCGA +
Preference number: 3 (lower is better)
Translates to: CTLVLKEDRLIF*SPLSTAEGESR
Trigger: TCGCGACTCTCCTTCTGCAGTGGACAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAGGACCAACGTACA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000637013.1
ENST00000637429.1
3UTR CCA 72 bp TTGACTCAAAGAGAACCTGCCGCGAGTCTTAGTCTTTaGAAGGTCAGACAGCTGCAGTGTTCGGTCACATGG +
Preference number: 3 (lower is better)
Translates to: LTQREPAASLSL*KVRQLQCSVTW
Trigger: CCATGTGACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTCTCTTTGAGTCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp TCAGACAGCTGCAGTGTTCGGTCACATGGAGATGGTGTCTTCATGTCTCAGAGGGACGAAGACAAGCTATaGACTCAAAGAGAACCTGCC +
Preference number: 3 (lower is better)
Translates to: SDSCSVRSHGDGVFMSQRDEDKL*TQREPA
Trigger: GGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC...CCTCTGAGACATGAAGACACCATCTCCATGTGACCGAACACTGCAGCTGTCTGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp GAACCTGCCGCGAGTCTTAGTCTTTGGAAGGTCAGACAGCTGCAGTGTTCGGTCAGGCAAGGGCCCATTTaGTGCCCATTAAAAGAAATA +
Preference number: 3 (lower is better)
Translates to: EPAASLSLWKVRQLQCSVRQGPI*CPLKEI
Trigger: TATTTCTTTTAATGGGCACAAAATGGGCCCTTGCCT...GACCGAACACTGCAGCTGTCTGACCTTCCAAAGACTAAGACTCGCGGCAGGTTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp GTCTTCATGTCTCAGAGGCCGCATTCTGTAGGCCAGACGTGTGCTCACCAACCTAGGCAAGGGCCCATTTaGTGCCCATTAAAAGAAATA +
Preference number: 3 (lower is better)
Translates to: VFMSQRPHSVGQTCAHQPRQGPI*CPLKEI
Trigger: TATTTCTTTTAATGGGCACAAAATGGGCCCTTGCCT...AGGTTGGTGAGCACACGTCTGGCCTACAGAATGCGGCCTCTGAGACATGAAGAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp CTTTCTGTCTCGTGTAATCACACAACCTTCCCCAGACTGGTTGCCTCCCAGGATCTGAAGGAGGATAGGTaGATTTTCTGCAGTCCTCTG +
Preference number: 3 (lower is better)
Translates to: LSVSCNHTTFPRLVASQDLKEDR*IFCSPL
Trigger: CAGAGGACTGCAGAAAATCAACCTATCCTCCTTCAG...ATCCTGGGAGGCAACCAGTCTGGGGAAGGTTGTGTGATTACACGAGACAGAAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000637013.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp CCAGACGTGTGCTCACCAACCTATACAAGGGTCAGGGCAGTCCCGCAGGTAAGTGCCTTGAAGACAGTTTaGTTGTTTCTTTGGAAATCC +
Preference number: 3 (lower is better)
Translates to: PDVCSPTYTRVRAVPQVSALKTV*LFLWKS
Trigger: GGATTTCCAAAGAAACAACAAAACTGTCTTCAAGGC...ACTTACCTGCGGGACTGCCCTGACCCTTGTATAGGTTGGTGAGCACACGTCTGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp GAGATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTGCAGGCGTTCTGCGACTGAACAGTCCTGGTTaGAATCCTGTTAACATGCCC +
Preference number: 3 (lower is better)
Translates to: EIFSWLVRFRHIFAGVLRLNSPG*NPVNMP
Trigger: GGGCATGTTAACAGGATTCAAACCAGGACTGTTCAG...TCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATCTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR-3UTR CAA 90 bp ATGTGGAGTGTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCGGTTCAGACACATCTTaGCAGGCGTTCTGCGATCAT +
Preference number: 3 (lower is better)
Translates to: MWSVYCPVTHTDVLDSTPGSDTS*QAFCDH
Trigger: ATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACC...GGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAACACTCCACAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR TCA 72 bp TTACTCACACAGACGTGCTGGATTCAACACCCACGCTaGATCTCCATTTATTCCACGGAGGTGGAGTTCACC +
Preference number: 3 (lower is better)
Translates to: LLTQTCWIQHPR*ISIYSTEVEFT
Trigger: GGTGAACTCCACCTCCGTGGAATAAATGGAGATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 29 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR TCA 72 bp GCATCGTGGAGTGCTGGGCTCTTCCGTATCTTGATCTaGGTCATGGCTACATGCATGCATGCATTTCTGAAG +
Preference number: 3 (lower is better)
Translates to: ASWSAGLFRILI*VMATCMHAFLK
Trigger: CTTCAGAAATGCATGCATGCATGTAGCCATGACTCAGATCAAGATACGGAAGAGCCCAGCACTCCACGATGC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000518087.7
ENST00000636269.1
ENST00000636537.1
ENST00000636715.1
ENST00000637202.1
ENST00000637561.1
ENST00000637805.1
ENST00000637872.1
3UTR TCA 72 bp ATGGAGCATCGTGGAGTGCTGGGCTCTTCCGTATCTTaGTCTGAGTCATGGCTACATGCATGCATGCATTTC +
Preference number: 3 (lower is better)
Translates to: MEHRGVLGSSVS*SESWLHACMHF
Trigger: GAAATGCATGCATGCATGTAGCCATGACTCAGATCAAGATACGGAAGAGCCCAGCACTCCACGATGCTCCAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000518087.7
ENST00000636269.1
ENST00000636537.1
ENST00000636715.1
ENST00000637202.1
ENST00000637561.1
ENST00000637805.1
ENST00000637872.1
3UTR GCA 72 bp GATATTCTCTTGGCTGGTGCGGTTCAGACACATCTTTaGAGGCGTTCTGCGATCATCAAGGAAGAAGGGATG +
Preference number: 3 (lower is better)
Translates to: DILLAGAVQTHL*RRSAIIKEEGM
Trigger: CATCCCTTCTTCCTTGATGATCGCAGAACGCCTGCAAAGATGTGTCTGAACCGCACCAGCCAAGAGAATATC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636160.1
ENST00000636494.1
ENST00000636701.1
ENST00000636920.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
3UTR CCA 72 bp GAATCTCCATTTATTCCACGGAGGTGGAGTTCACCATaGTTCGACTGCCCACCAGATCCCCAAATGTCAAAG +
Preference number: 3 (lower is better)
Translates to: ESPFIPRRWSSP*FDCPPDPQMSK
Trigger: CTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTCCGTGGAATAAATGGAGATTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 30 transcripts:
ENST00000314146.10
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000635998.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp GTTTACTGTCCCGTTACTCACACAGACGTGCTGGATTCAACACCCACGCTGAATGACGAAGACAAGCTATaGACTCAAAGAGAACCTGCC +
Preference number: 3 (lower is better)
Translates to: VYCPVTHTDVLDSTPTLNDEDKL*TQREPA
Trigger: GGCAGGTTCTCTTTGAGTCAATAGCTTGTCTTCGTC...ATTCAGCGTGGGTGTTGAATCCAGCACGTCTGTGTGAGTAACGGGACAGTAAAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6
ENST00000635756.1
ENST00000635944.1
ENST00000636009.1
ENST00000636033.1
ENST00000636050.1
ENST00000636128.1
ENST00000636160.1
ENST00000636171.1
ENST00000636455.1
ENST00000636494.1
ENST00000636577.1
ENST00000636691.1
ENST00000636701.1
ENST00000636815.1
ENST00000636920.1
ENST00000636997.1
ENST00000637013.1
ENST00000637095.1
ENST00000637244.1
ENST00000637429.1
ENST00000637484.1
ENST00000637528.1
ENST00000637636.1
ENST00000637790.2
ENST00000637922.1
ENST00000637991.1
3UTR-3UTR CAA 90 bp GAGGTGGAGTTCACCATGGTTCGACTGCCCACCAGATCCCCAAATGTCAAAGTGAGGCAAGGGCCCATTTaGTGCCCATTAAAAGAAATA +
Preference number: 3 (lower is better)
Translates to: EVEFTMVRLPTRSPNVKVRQGPI*CPLKEI
Trigger: TATTTCTTTTAATGGGCACAAAATGGGCCCTTGCCT...CACTTTGACATTTGGGGATCTGGTGGGCAGTCGAACCATGGTGAACTCCACCTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 28 transcripts:
ENST00000381733.9
ENST00000520781.6