RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ARHGAP4 (Homo sapiens)

Ensembl gene IDs: ENSG00000089820

Ensembl transcript IDs: ENST00000350060.10, ENST00000370016.5, ENST00000370028.7, ENST00000393721.5, ENST00000404127.6, ENST00000418750.5, ENST00000420383.5, ENST00000422091.1, ENST00000422918.5, ENST00000442262.5, ENST00000454164.5, ENST00000460782.1, ENST00000461052.5, ENST00000461739.1, ENST00000463905.1, ENST00000466928.5, ENST00000467421.1, ENST00000470209.5, ENST00000470979.1, ENST00000488269.5, ENST00000494302.5, ENST00000494813.5

Found 960 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp ACCACCAGCACCGGCGCGGGCAGCCGCCACAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGAAGCCAGC +
Preference number: 1 (lower is better)
Translates to: TTSTGAGSRHSRRLT*STLSAVASSSEEAS
Trigger: GCTGGCTTCTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGTGGCGGCTGCCCGCGCCGGTGCTGGTGGT
72% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 90 bp GGCGGGAAGACCCGATCGGGCTGCACTATGAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGCGCCACCGGGTCCTGCCCAGCGGGC +
Preference number: 1 (lower is better)
Translates to: GGKTRSGCTMSVCTS*FTRPCSATGSCPAG
Trigger: GCCCGCTGGGCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCC
72% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp TCGGGCTGCACTATGAGCGTCTGCACCAGCTGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGCCCAGCGGGCACCGGTAGCAGCGTG +
Preference number: 1 (lower is better)
Translates to: SGCTMSVCTSWFTRP*SATGSCPAGTGSSV
Trigger: CACGCTGCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGA
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp CAGGCTCTCCAGCTGGGCGTCCCCCAGGCAGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGACGGGGCCAGGCAGCGAGGTCAGGGG +
Preference number: 1 (lower is better)
Translates to: QALQLGVPQAAGGRR*HALLVDGARQRGQG
Trigger: CCCCTGACCTCGCTGCCTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACGCCCAGCTGGAGAGCCTG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp GCTCTGGCCGGTGGACCAGCTCCGATGCCAGGAGGCCCTCGGGACTaGTCCCAGACTCCCCTGCAGTCTGCAGCCCTGCGCCCACCACCT +
Preference number: 1 (lower is better)
Translates to: ALAGGPAPMPGGPRD*SQTPLQSAALRPPP
Trigger: AGGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTCCTGGCATCGGAGCTGGTCCACCGGCCAGAGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR TCA 90 bp CAGGCAGCGAGGTCAGGGGCGGGAAGACCCGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGTTCACCCGGCCCTGCAGCGCCACCG +
Preference number: 1 (lower is better)
Translates to: QAARSGAGRPDRAAL*ASAPAGSPGPAAPP
Trigger: CGGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCTCGCTGCCTG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp CAGCTTCTTCCAGGCTGCCCAGGCCCTGCACTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGTAGCTCCGGAGCACCTGCCCCAGGG +
Preference number: 1 (lower is better)
Translates to: QLLPGCPGPALGRLG*GSQRPCSSGAPAPG
Trigger: CCCTGGGGCAGGTGCTCCGGAGCTACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp GAGGTCAGGGGCGGGAAGACCCGATCGGGCTGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGGCCCTGCAGCGCCACCGGGTCCTGC +
Preference number: 1 (lower is better)
Translates to: EVRGGKTRSGCTMSV*TSWFTRPCSATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCTC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp ACGGGGCCAGGCAGCGAGGTCAGGGGCGGGAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACCAGCTGGTTCACCCGGCCCTGCAGC +
Preference number: 1 (lower is better)
Translates to: TGPGSEVRGGKTRSG*TMSVCTSWFTRPCS
Trigger: GCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCTCGCTGCCTGGCCCCGT
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp GAGGCCCTCGGGACTGCTCCCAGACTCCCCTGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATA +
Preference number: 1 (lower is better)
Translates to: EALGTAPRLPCSLQP*AHHLLLRPGGQRDI
Trigger: TATATCACGCTGCCCGCCGGGACGGAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR CCA 90 bp GGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTGGCCC +
Preference number: 1 (lower is better)
Translates to: GEAFVPAQAAAGRGL*ASGPRTGRGGRCWP
Trigger: GGGCCAGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR CCA 90 bp GGGAGGCTGGGACCAAGCAGCGTCGTCTGTGTCCAGAGGGTCCCATaGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCG +
Preference number: 1 (lower is better)
Translates to: GRLGPSSVVCVQRVP*PQVRCMALAGGPAP
Trigger: CGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTTGGTCCCAGCCTCCC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR GCA 90 bp CGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATaGTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTC +
Preference number: 1 (lower is better)
Translates to: RGLWASGPRTGRGGR*WPKALADRGLSQEL
Trigger: GAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR GCA 90 bp AGTAGAGCTTCAGCACCCCGGCCACCGAGTCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGTCCTCCCCTCTCTCGAAGGCATCAC +
Preference number: 1 (lower is better)
Translates to: SRASAPRPPSPGHGQ*SPPPVGPPLSRRHH
Trigger: GTGATGCCTTCGAGAGAGGGGAGGACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGCTGAAGCTCTACT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 90 bp GGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCTT +
Preference number: 1 (lower is better)
Translates to: GLWASGPRTGRGGRC*PKALADRGLSQELL
Trigger: AAGGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR TCA 90 bp GCTTGGCGAGGATGCTCCGTCCACTCAGATACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCTCCTGCTGCTGGCCGCGCCTCCGGC +
Preference number: 1 (lower is better)
Translates to: AWRGCSVHSDTPGAS*GRRFRSPAAGRASG
Trigger: GCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 90 bp TCCCTGTGTGCACGGCCCCATCCCACCTCTCTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGG +
Preference number: 1 (lower is better)
Translates to: SLCARPHPTSLHRVK*RHPALAGQGWREAR
Trigger: CCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGCCGTGCACACAGGGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR TCA 90 bp CTCCACCAGTGGGTCCTCCCCTCTCTCGAAGGCATCACGGATCTCTaGGACCCGGAGCTGGGCACCCGATACCCGGAAGATGCCTTCATG +
Preference number: 1 (lower is better)
Translates to: LHQWVLPSLEGITDL*DPELGTRYPEDAFM
Trigger: CATGAAGGCATCTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGAGAGGGGAGGACCCACTGGTGGAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 90 bp CGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCCAAGAGCTCCTTAAACACAGAGTCC +
Preference number: 1 (lower is better)
Translates to: RGPGLGEVVDAGPRP*RTEVFPKSSLNTES
Trigger: GGACTCTGTGTTTAAGGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCCAGTCCTGGGCCCCG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR CCA 90 bp TCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGCAG +
Preference number: 1 (lower is better)
Translates to: SSVSMVCRSRRLWMF*ALGRISSRSSISTQ
Trigger: CTGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 90 bp TCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGCAGATCTCAG +
Preference number: 1 (lower is better)
Translates to: SQWSVGPGGSGCSGL*AESRPAAPFQRRSQ
Trigger: CTGAGATCTGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 90 bp TTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATT +
Preference number: 1 (lower is better)
Translates to: LFTSSVSMVCRSRRL*MFWALGRISSRSSI
Trigger: AATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGT +
Preference number: 2 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQLGRLG*GSQRPC
Trigger: ACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGACGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGC +
Preference number: 2 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRRSRRL*MFWALG
Trigger: GCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCG...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
72% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGATGCCCCAGGGCCAGGTaGAACCCTGTGTCACAGCAG +
Preference number: 2 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRCPRAR*NPVSQQ
Trigger: CTGCTGTGACACAGGGTTCCACCTGGCCCTGGGGCA...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR TCA 90 bp GGCTTCCAGCTCCGGCTCATTGTCCGCCCCCAGGCTCTCCAGCTGGGCGTCCCCGCCTCCCTCCCTTCTTaGGGGAGCTCTTGCGGAGGG +
Preference number: 2 (lower is better)
Translates to: GFQLRLIVRPQALQLGVPASLPS*GSSCGG
Trigger: CCCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGC...GGGGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 2 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPEVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp GCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTATCGCCACCCAGCCCTaGCAGGCATCTGAGCAAGGG +
Preference number: 2 (lower is better)
Translates to: AAAGRGLWASGPRTGRGGIATQP*QASEQG
Trigger: CCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGAT...ACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000420383.5
3UTR-3UTR GCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 2 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
70% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CAA 90 bp CTCCACAGCTTCTTCCAGGCTGCCCAGGCCCTGCACTTGGGAGGCTaGGGTGCGGCTCTCAGCGGCCGTGTAGCTCCGGAGCACCTGCCC +
Preference number: 2 (lower is better)
Translates to: LHSFFQAAQALHLGG*GAALSGRVAPEHLP
Trigger: GGGCAGGTGCTCCGGAGCTACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTGTGGAG
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CAA 90 bp AGGTCATCCTCCTGTGCGGGCATCTCGGCTTCCAGCTCCGGCTCATaGTCCGCCCCCAGGCTCTCCAGCTGGGCGTCCCCCAGGCAGCTG +
Preference number: 2 (lower is better)
Translates to: RSSSCAGISASSSGS*SAPRLSSWASPRQL
Trigger: CAGCTGCCTGGGGGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCCGAGATGCCCGCACAGGAGGATGACCT
69% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR TCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 2 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 2 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQLHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTC +
Preference number: 2 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLAGIPV*TAPSHL
Trigger: GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGC...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTCTCGAGGCCCTCTCGTaGAGCCGCAGTACGTCCCCC +
Preference number: 2 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEALEALS*SRSTSP
Trigger: GGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAG...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CCA 90 bp GCTCTCCAGCTGGGCGTCCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 2 (lower is better)
Translates to: ALQLGVPQAAGGRRCHALGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...AAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACGCCCAGCTGGAGAGC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CAA 90 bp ATCCAGGGCCTCCACAGCTTCTTCCAGGCTGCCCAGGCCCTGCACTaGGGAGGCTTGGGTGCGGCTCTCAGCGGCCGTGTAGCTCCGGAG +
Preference number: 2 (lower is better)
Translates to: IQGLHSFFQAAQALH*GGLGAALSGRVAPE
Trigger: CTCCGGAGCTACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTGTGGAGGCCCTGGAT
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CAA 90 bp CGCCTCCGGCCCGCCTGCCGGCTGCCTGGGTCTGAGCTGGTGGACTaGAGGGACTCGGTGGAGGGGCTGGTCTGGAAGGAATCAAGCACA +
Preference number: 2 (lower is better)
Translates to: RLRPACRLPGSELVD*RDSVEGLVWKESST
Trigger: TGTGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp CGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 2 (lower is better)
Translates to: RLLGGAFGLRGPGLGEVVEVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...TACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp CCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTCTCGTAGACGGGGCCAGCAGCTTCTTCCAGGCTaGCCAGGCCCTGCACTTGGG +
Preference number: 2 (lower is better)
Translates to: PPGSWRKAVPCTSRRRGQQLLPG*PGPALG
Trigger: CCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG...CTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 2 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEAEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 15 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGAGCCTTCCACAAAGCTaGAGAAGAGGGCTTTCCCCA +
Preference number: 2 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQSLPQS*RRGLSP
Trigger: TGGGGAAAGCCCTCTTCTGCAGCTTTGTGGAAGGCT...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
3UTR-3UTR TCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCCCTGCCAGGCATCTaGGCAAGGGTACCCGCCACC +
Preference number: 2 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSALPGI*ARVPAT
Trigger: GGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
3UTR-3UTR GCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 2 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEAASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp ACAGCAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGACCTCCAGCAGGGCCTaGAGTGTCGCCTTCAGAGTC +
Preference number: 2 (lower is better)
Translates to: TAGGSRAPPSPLWPPAPKTSSRA*SVAFRV
Trigger: GACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGT...CTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 2 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 2 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CCA 90 bp CACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 2 (lower is better)
Translates to: HLLLRPGGQRDILVGDEAEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...GGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCAGGTG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 2 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR TCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGT +
Preference number: 2 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDDRAAL*ASAPAG
Trigger: ACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATC...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 2 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCATCGCCACCCAGCCCTaGCAGGCATCTGAGCAAGGG +
Preference number: 2 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSIATQP*QASEQG
Trigger: CCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGAT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
3UTR-3UTR CCA 90 bp ACAGCAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGGCACCTCGAGAACCTTaGCTTTGTCCCCTGGAGGAT +
Preference number: 2 (lower is better)
Translates to: TAGGSRAPPSPLWPPAPKAPREP*LCPLED
Trigger: ATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGC...CTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp CATCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 2 (lower is better)
Translates to: HLQQRHLSVAWGSCLGPGRLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...CCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR TCA 90 bp CAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGAAGCTGTCACAGCAGTCCATaGGGTCCAAGACGTCATGCA +
Preference number: 2 (lower is better)
Translates to: QAAHVLHPLRCGLQLRRSCHSSP*GPRRHA
Trigger: TGCATGACGTCTTGGACCTCATGGACTGCTGTGACA...GCTTCTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 2 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGEVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 2 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp CTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTCAGAAGACGGTAGCATaGACCTCGAGAACCTTGGCT +
Preference number: 2 (lower is better)
Translates to: LGGAFGLRGPGLGEVVDAQKTVA*TSRTLA
Trigger: AGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTG...AGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 2 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR GCA 90 bp GAGGCTGGGACCAAGCAGCGTCGTCTGTGTCCAGAGGGTCCCATGGCCTCAGGTCCGATACCCGGAAGATaGCTTCATGCTGCAGGCCAT +
Preference number: 2 (lower is better)
Translates to: EAGTKQRRLCPEGPMASGPIPGR*LHAAGH
Trigger: ATGGCCTGCAGCATGAAGGCATCTTCCGGGTATCGG...ACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTTGGTCCCAGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp GCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGTGCACTTGGGAGGCTTaGGTGCGGCTCTCAGCGGCC +
Preference number: 2 (lower is better)
Translates to: AFRVLFTSSVSMVCRSRRCTWEA*VRLSAA
Trigger: GGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCA...CCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 2 (lower is better)
Translates to: PIGESTRGLYESPPSPAREVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
3UTR-3UTR CCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 2 (lower is better)
Translates to: APIGESTRGLYESPPSPAAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
3UTR-3UTR CCA 90 bp CTGGATGTTCTGGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGCAGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 2 (lower is better)
Translates to: LDVLGSGQNLVPQLHFNAAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...TGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp CTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTGAAGCCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGC +
Preference number: 2 (lower is better)
Translates to: LCVLGPRHLLLLLVTSLKPPLSQ*SVGPGG
Trigger: GCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG...CTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CCA 90 bp AGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATCTTGGCTTTGTCCCCTaGAGGATCCAGGGCCTCCAC +
Preference number: 2 (lower is better)
Translates to: SLVHLLCLNGLSVQAALDLGFVP*RIQGLH
Trigger: GTGGAGGCCCTGGATCCTCCAGGGGACAAAGCCAAG...ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR GCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGCCTTCCACAAAGCTaGAGAAGAGGGCTTTCCCCA +
Preference number: 2 (lower is better)
Translates to: APIGESTRGLYESPPSPASLPQS*RRGLSP
Trigger: TGGGGAAAGCCCTCTTCTGCAGCTTTGTGGAAGGCT...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
3UTR-3UTR CCA 90 bp TTCTCTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTGTGGAGGGGCTGGTCTaGAAGGAATCAAGCACATCC +
Preference number: 2 (lower is better)
Translates to: FSVCTGSKTPPAPPCHLAVEGLV*KESSTS
Trigger: GGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCAC...AGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp AGCTGGTTCACCCGGCCCTGCAGCGCCACCGGGTCCTaGCCAGCGGGCACCGGTAGCAGCGTGGGCCCGAAG +
Preference number: 3 (lower is better)
Translates to: SWFTRPCSATGS*PAGTGSSVGPK
Trigger: CTTCGGGCCCACGCTGCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCAGCT
75% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp TCGGTCTCCTGCTGCTGGCCGCGCCTCCGGCCCGCCTaGCGGCTGCCTGGGTCTGAGCTGGTGGACTTGAGG +
Preference number: 3 (lower is better)
Translates to: SVSCCWPRLRPA*RLPGSELVDLR
Trigger: CCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGA
74% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp ACCGGCGCGGGCAGCCGCCACAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAA +
Preference number: 3 (lower is better)
Translates to: TGAGSRHSRRLT*STLSAVASSSE
Trigger: TTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGTGGCGGCTGCCCGCGCCGGT
74% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAAGCCTCCCTCCCTTCTaGAGGGAGCTCTTGCGGAGG +
Preference number: 3 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRSLPPF*RELLRR
Trigger: CCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGCT...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp CCAGGCTGCCCAGGCCCTGCACTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGTAGCTCCGGAGCACCT +
Preference number: 3 (lower is better)
Translates to: PGCPGPALGRLG*GSQRPCSSGAP
Trigger: AGGTGCTCCGGAGCTACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGCAGCCTGG
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp ACTATGAGCGTCTGCACCAGCTGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGCCCAGCGGGCACCGGT +
Preference number: 3 (lower is better)
Translates to: TMSVCTSWFTRP*SATGSCPAGTG
Trigger: ACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGT
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp GGGCGTCCCCCAGGCAGCTGGCGGAAGGCGGTGCCATaGACTTCTCGTAGACGGGGCCAGGCAGCGAGGTCA +
Preference number: 3 (lower is better)
Translates to: GRPPGSWRKAVP*TSRRRGQAARS
Trigger: TGACCTCGCTGCCTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACGCCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp CAGCTGGGCGTCCCCCAGGCAGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGACGGGGCCAGGCAGCGA +
Preference number: 3 (lower is better)
Translates to: QLGVPQAAGGRR*HALLVDGARQR
Trigger: TCGCTGCCTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACGCCCAGCTG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTGCCCAGGCCCTGCACTaGGGAGGCTTGGGTGCGGCT +
Preference number: 3 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLAQALH*GGLGAA
Trigger: AGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGC...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp CCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTCTCGTAGACGGGGCCAGGCAGGCACCCTGCACTaGCTGGACAGGGCTGGAGAG +
Preference number: 3 (lower is better)
Translates to: PPGSWRKAVPCTSRRRGQAGTLH*LDRAGE
Trigger: CTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGC...CTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp GGCGGGAAGACCCGATCGGGCTGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGGCCCTGCAGCGCCACC +
Preference number: 3 (lower is better)
Translates to: GGKTRSGCTMSV*TSWFTRPCSAT
Trigger: GGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCC
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp ACCCGATCGGGCTGCACTATGAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGCGCCACCGGGTCCTGC +
Preference number: 3 (lower is better)
Translates to: TRSGCTMSVCTS*FTRPCSATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGT
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp TCAGCACCCCGGCCACCGAGTCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGTCCTCCCCTCTCTCGA +
Preference number: 3 (lower is better)
Translates to: SAPRPPSPGHGQ*SPPPVGPPLSR
Trigger: TCGAGAGAGGGGAGGACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGCTGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp GGCAGCGAGGTCAGGGGCGGGAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACCAGCTGGTTCACCCGG +
Preference number: 3 (lower is better)
Translates to: GSEVRGGKTRSG*TMSVCTSWFTR
Trigger: CCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCTCGCTGCC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp TTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGA +
Preference number: 3 (lower is better)
Translates to: FVPAQAAAGRGL*ASGPRTGRGGR
Trigger: TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR CCA 72 bp GGCACGCATCTCCAGCAGCGGCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTG +
Preference number: 3 (lower is better)
Translates to: GTHLQQRHLSVA*GSCLGPGGGKL
Trigger: CAGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATGCGTGCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CAA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCAGCAGGCACCCTGCACTaGCTGGACAGGGCTGGAGAG +
Preference number: 3 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPAGTLH*LDRAGE
Trigger: CTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGC...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CAA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTTCTGAGCTGGTGGACTaGAGGGACTCGGTGGAGGGG +
Preference number: 3 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEASELVD*RDSVEG
Trigger: CCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGA...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR TCA 72 bp AGGTCAGGGGCGGGAAGACCCGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGTTCACCCGGCCCTGCA +
Preference number: 3 (lower is better)
Translates to: RSGAGRPDRAAL*ASAPAGSPGPA
Trigger: TGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTTCCCGCCCCTGACCT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR TCA 72 bp GCGTCGTCTGTGTCCAGAGGGTCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGA +
Preference number: 3 (lower is better)
Translates to: ASSVSRGSHGLR*GAWLWPVDQLR
Trigger: TCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACCCTCTGGACACAGACGACGC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR GCA 72 bp GAGGGGCAGGCAGGATGTGGAGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTCTCTGCACAGGGTGAA +
Preference number: 3 (lower is better)
Translates to: EGQAGCGAGIPV*TAPSHLSAQGE
Trigger: TTCACCCTGTGCAGAGAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGCTCCACATCCTGCCTGCCCCTC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR CCA 72 bp TGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTTGTaGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCC +
Preference number: 3 (lower is better)
Translates to: CFSVPAGSVIYL*GMRPRMPLCSP
Trigger: GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR GCA 72 bp GCACGGCCCCATCCCACCTCTCTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCTGGACAGGGCTGGAGA +
Preference number: 3 (lower is better)
Translates to: ARPHPTSLHRVK*RHPALAGQGWR
Trigger: TCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGCCGTGC
65% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR CCA 72 bp GGACCAAGCAGCGTCGTCTGTGTCCAGAGGGTCCCATaGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGA +
Preference number: 3 (lower is better)
Translates to: GPSSVVCVQRVP*PQVRCMALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTTGGTCC
65% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CAA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAGCAGGCACCCTGCACTaGCTGGACAGGGCTGGAGAG +
Preference number: 3 (lower is better)
Translates to: YESPPSPARHLSKGTRHPAGTLH*LDRAGE
Trigger: CTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGC...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
3UTR-3UTR CAA 90 bp CTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTTTGTGCTCCATGAACTaGGCCTGCCGCTTCTCCACC +
Preference number: 3 (lower is better)
Translates to: LGGAFGLRGPGLGEVVDALCSMN*ACRFST
Trigger: GGTGGAGAAGCGGCAGGCCAAGTTCATGGAGCACAA...AGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp GCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGACGCGCCTTTGTGCACTaGAGTTTGTGCTCCATGAAC +
Preference number: 3 (lower is better)
Translates to: AAGRGLWASGPRTGRGGRRAFVH*SLCSMN
Trigger: GTTCATGGAGCACAAACTCAAGTGCACAAAGGCGCG...TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp GGAAGTAGAGCTTCAGCACCCCGGCCACCGAGTCCAGGTCATGGGCAGTGCAGCTGCACCTCGAGAACCTaGGCTTTGTCCCCTGGAGGA +
Preference number: 3 (lower is better)
Translates to: GSRASAPRPPSPGHGQCSCTSRT*ALSPGG
Trigger: TCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGCA...GCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGCTGAAGCTCTACTTCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp CCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTCTCGTAGACGGGGCCAGTCATGCTGCAGGCCATaGAGGTTGATGAAGCGAATG +
Preference number: 3 (lower is better)
Translates to: PPGSWRKAVPCTSRRRGQSCCRP*RLMKRM
Trigger: CATTCGCTTCATCAACCTCAATGGCCTGCAGCATGA...CTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR TCA 72 bp TGGGTCCTCCCCTCTCTCGAAGGCATCACGGATCTCTaGGACCCGGAGCTGGGCACCCGATACCCGGAAGAT +
Preference number: 3 (lower is better)
Translates to: WVLPSLEGITDL*DPELGTRYPED
Trigger: ATCTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGAGAGGGGAGGACCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp CTGGTGGACTTGAGGGACTCGGTGGAGGGGCTGGTCTaGAAGGAATCAAGCACATCCCCGTCATCCGAGGCC +
Preference number: 3 (lower is better)
Translates to: LVDLRDSVEGLV*KESSTSPSSEA
Trigger: GGCCTCGGATGACGGGGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp TCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGC +
Preference number: 3 (lower is better)
Translates to: SVGPGGSGCSGL*AESRPAAPFQR
Trigger: GCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp TCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGCAGAATCTCGTCCCGC +
Preference number: 3 (lower is better)
Translates to: SSVSMVCRSRRL*MFWALGRISSR
Trigger: GCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp CTCTCGAAGGCATCACGGATCTCTGAGACCCGGAGCTaGGCACCCGATACCCGGAAGATGCCTTCATGCTGC +
Preference number: 3 (lower is better)
Translates to: LSKASRISETRS*APDTRKMPSCC
Trigger: GCAGCATGAAGGCATCTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR TCA 72 bp GGATGCTCCGTCCACTCAGATACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCTCCTGCTGCTGGCCGC +
Preference number: 3 (lower is better)
Translates to: GCSVHSDTPGAS*GRRFRSPAAGR
Trigger: GCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR GCA 72 bp ATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACCAAGCAGCGTCGTCTG +
Preference number: 3 (lower is better)
Translates to: MFCATALSTSTC*SGEAGTKQRRL
Trigger: CAGACGACGCTGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACAT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR CCA 72 bp TCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATT +
Preference number: 3 (lower is better)
Translates to: SMVCRSRRLWMF*ALGRISSRSSI
Trigger: AATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp GGACTGGGAGAGGTGGTAGATGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCCAAGAGCTCCTTAAAC +
Preference number: 3 (lower is better)
Translates to: GLGEVVDAGPRP*RTEVFPKSSLN
Trigger: GTTTAAGGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCCAGTCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
3UTR-3UTR CAA 90 bp CCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGGCTCCTAAGCAGGTACTCGTaGCGCGCCTTTGTGCACTTG +
Preference number: 3 (lower is better)
Translates to: PPLSQWSVGPGGSGCSGLLSRYS*RAFVHL
Trigger: CAAGTGCACAAAGGCGCGCAACGAGTACCTGCTTAG...GAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR-3UTR CAA 90 bp CCATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGTTACTGACAGCAGCGTaGACACTAGCCAGGCTAAGC +
Preference number: 3 (lower is better)
Translates to: PCSVPQPYPPPRVALGRLLLTAA*TLARLS
Trigger: GCTTAGCCTGGCTAGTGTCAACGCTGCTGTCAGTAA...CAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACATGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CCA 72 bp TCGCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGG +
Preference number: 3 (lower is better)
Translates to: SPSESCSPPLSQ*SVGPGGSGCSG
Trigger: CCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGCGA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGCCCGCTTCTCCTCCTaGCGCTCGGCCTCCCGGAGC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQARFSS*RSASRS
Trigger: GCTCCGGGAGGCCGAGCGGCAGGAGGAGAAGCGGGC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
76% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
76% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
76% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTCCTGCCCAGGCGGCTaGTGGGCGGGGCCTTTGGGC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQSCPGG*WAGPLG
Trigger: GCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
76% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGCCGTCGAACCCCACTaGTCCCACGCGGCCGTGAGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHAVEPH*SHAAVS
Trigger: GCTCACGGCCGCGTGGGAGCAGTGGGGTTCGACGGC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000404127.6
CDS-3UTR GCA 90 bp CCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGC +
Preference number: 4 (lower is better)
Translates to: PAQAAAGRGLWASGPRTGLSRLC*RVCCSS
Trigger: GCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAG...CCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGG
74% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHWFTRP*SATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGGCGGCCTCCACGGCTaGAGAAGCGCTCGGCCAGCT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRGGLHG*RSARPA
Trigger: AGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACCAGCGGTGGTGGTaGGGACACTCCGGCCTGCCC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQHQRWW*GHSGLP
Trigger: GGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTCACCAGCGGTGGTGGTaGGGACACTCCGGCCTGCCC +
Preference number: 4 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPHQRWW*GHSGLP
Trigger: GGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTG...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGGGGCCCTGCCTCAGTaGCACCAGCGGTGGTGGTGG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHGALPQ*HQRWWW
Trigger: CCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCGTCCCCCAGGCAGCTaGCGGAAGGCGGTGCCATGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHRPPGS*RKAVPC
Trigger: GCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCGTCCCCCAGGCAGCTaGCGGAAGGCGGTGCCATGC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQRPPGS*RKAVPC
Trigger: GCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHAGRGL*ASGPRT
Trigger: AGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRAGRGL*ASGPRT
Trigger: AGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCCCTGCCAGGCATCTaGGCAAGGGTACCCGCCACC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRALPGI*ARVPAT
Trigger: GGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGTCTCATACTCAGCCTaGAGCCCCCGCTCCCGCCGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHVSYSA*SPRSRR
Trigger: GCGGCGGGAGCGGGGGCTGCAGGCTGAGTATGAGAC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHSRQRS*SLSCQR
Trigger: GCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQFGAPG*SPGGLH
Trigger: GTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHCCRVC*SSTAQQ
Trigger: CTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQLSRLC*RVCCSS
Trigger: GCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGC +
Preference number: 4 (lower is better)
Translates to: AAAGRGLWASGPRTGRGGALSRL*CRVCCS
Trigger: GCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGC...ACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGC
73% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGCTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGT +
Preference number: 4 (lower is better)
Translates to: PAQAAAGRGLWASGPRTGLGRLG*GSQRPC
Trigger: ACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAG...CCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGG
73% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGACTCGAGGCCCTCTCGTaGAGCCGCAGTACGTCCCCC +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRLEALS*SRSTSP
Trigger: GGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAG...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGACTCCCCTGCAGTCTaGAGCCCTGCGCCCACCACC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHDSPAV*SPAPTT
Trigger: GGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGACTCCCCTGCAGTCTaGAGCCCTGCGCCCACCACC +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRDSPAV*SPAPTT
Trigger: GGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTC...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
73% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGGCGGCCTCCACGGCTaGAGAAGCGCTCGGCCAGCT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAGGLHG*RSARPA
Trigger: AGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
73% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCCCAGGCCCTGCACTTaGGAGGCTTGGGTGCGGCTC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQPRPCT*EAWVRL
Trigger: GAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTGAGCTGGTGGACTTaGGGGACTCGGTGGAGGGGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHLSWWT*GTRWRG
Trigger: GCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGGCATCACGGATCTCTaGGACCCGGAGCTGGGCACC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQGITDL*DPELGT
Trigger: GGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRSHGLR*GAWLWP
Trigger: CGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCATTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAFGAPG*SPGGLH
Trigger: GTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAA...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
72% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGAC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRSTAQQ*KGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCT...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGAC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHSTAQQ*KGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGCCCGCTTCTCCTCCTaGCGCTCGGCCTCCCGGAGC +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGARFSS*RSASRS
Trigger: GCTCCGGGAGGCCGAGCGGCAGGAGGAGAAGCGGGC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
72% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRLGRLG*GSQRPC
Trigger: ACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGAGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 4 (lower is better)
Translates to: AAGRGLWASGPRTGRGGRGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGC
72% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACTCGAGGCCCTCTCGTaGAGCCGCAGTACGTCCCCC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPALEALS*SRSTSP
Trigger: GGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGTGGACCAGCTCCGATaGCAGGAGGCCCTCGGGACT +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQVDQLR*QEALGT
Trigger: AGTCCCGAGGGCCTCCTGGCATCGGAGCTGGTCCAC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGGGAGAGGTGGTAGATaGTGGCCCAAGGCCCTGGCG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHGRGGR*WPKALA
Trigger: CGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRRSRRL*MFWALG
Trigger: GCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCATGGCTCTGGCCGGTaGACCAGCTCCGATGCCAGG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRHGSGR*TSSDAR
Trigger: CCTGGCATCGGAGCTGGTCCACCGGCCAGAGCCATG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTACAGCGCGGCGCCGCATaGACTCTGCCAGCTCCTGCA +
Preference number: 4 (lower is better)
Translates to: RLLGGAFGLRGPGLGEVVQRGAA*TLPAPA
Trigger: TGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTG...TACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCG
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAACGTCCTCTGCAATGTaGCTCAGGCGCTGGGCCAGG +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRTSSAM*LRRWAR
Trigger: CCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGT...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACCGTCTGGAGCTCTaGGACCACCTCCAGGAGCTC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQHRLEL*DHLQEL
Trigger: GAGCTCCTGGAGGTGGTCTCAGAGCTCCAGACGGTG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRNSASS*SNSRRS
Trigger: GCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTT...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHNSASS*SNSRRS
Trigger: GCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGC +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGALSRL*CRVCCS
Trigger: GCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQAPHVL*NVTQAL
Trigger: CAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPALGRLG*GSQRPC
Trigger: ACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCAGCTTCTTCCAGGCTaGCCAGGCCCTGCACTTGGG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRQLLPG*PGPALG
Trigger: CCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRPGHGQ*SPPPVG
Trigger: ACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPASRRLT*STLSAV
Trigger: CACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGC +
Preference number: 4 (lower is better)
Translates to: AAGRGLWASGPRTGRGGRWFTRP*SATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCA...TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCGGAAGGCGGTGCCATaGACTTCTCGTAGACGGGGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHRKAVP*TSRRRG
Trigger: GCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTGGCCTCAGGTGAGGTaGATGGCTCTGGCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQWPQVR*MALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQSTSTC*SGEAGT
Trigger: GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGGGAGAGGTGGTAGATaGTGGCCCAAGGCCCTGGCG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAGRGGR*WPKALA
Trigger: CGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTCCTTCCGGAAGCTTTaGTGCTCCCGGCTGCTCCCC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRSFRKL*CSRLLP
Trigger: GGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTCGGCCTCCCGGAGCTTaGCCTCGGCATTCACGCTCT +
Preference number: 4 (lower is better)
Translates to: AAAGRGLWASGPRTGRGGRPPGA*PRHSRS
Trigger: AGAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCG...ACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGGGGCCCTGCCTCAGTaGCACCAGCGGTGGTGGTGG +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGGALPQ*HQRWWW
Trigger: CCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
71% GC, longest homopolymer 7 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTGCCCCAGGGCCAGGTaGAACCCTGTGTCACAGCAG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQCPRAR*NPVSQQ
Trigger: CTGCTGTGACACAGGGTTCCACCTGGCCCTGGGGCA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPARSRRL*MFWALG
Trigger: GCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTCTGAGACCCGGAGCTaGGCACCCGATACCCGGAAG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQSETRS*APDTRK
Trigger: CTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGACCGAGTCCAGGTCATaGGCAGTGCAGCCCTCCACC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQTESRS*AVQPST
Trigger: GGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGT...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTCTAGGCCCTGGGGGTaGGAAGCTGAGGGTGAGGCT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHSRPWG*EAEGEA
Trigger: AGCCTCACCCTCAGCTTCCCACCCCCAGGGCCTAGA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGTCGTGTCTAGGCCCTaGGGGTGGGAAGCTGAGGGT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHVVSRP*GWEAEG
Trigger: ACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGAC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
3UTR CAA 72 bp TCCTGTGCGGGCATCTCGGCTTCCAGCTCCGGCTCATaGTCCGCCCCCAGGCTCTCCAGCTGGGCGTCCCCC +
Preference number: 4 (lower is better)
Translates to: SCAGISASSSGS*SAPRLSSWASP
Trigger: GGGGGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCCGAGATGCCCGCACAGGA
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCGCCGCAGCTTCCCGTaGGCGGCCATGGCGGCCTCG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWRRSFP*AAMAAS
Trigger: CGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTCCTTGTCACCTCGCTaGAGGGCCTCCTGCAGCTTC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRSLSPR*RASCSF
Trigger: GAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGATCCTTGTCACCTCGCTaGAGGGCCTCCTGCAGCTTC +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRSLSPR*RASCSF
Trigger: GAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGA...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHDRAAL*ASAPAG
Trigger: ACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp GAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGGCCCTGCCAGGCATCTaGGCAAGGGTACCCGCCACC +
Preference number: 4 (lower is better)
Translates to: EAFVPAQAAAGRGLWASGALPGI*ARVPAT
Trigger: GGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGC...CCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGCGCCGCATGAACTCTaGCAGCTCCTGCAGCAACTC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQAPHEL*QLLQQL
Trigger: GAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCTCTCCAGCTGGGCGTCCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTTTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: ALQLGVPQAAGGRRCHALFGAPG*SPGGLH
Trigger: GTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAA...AAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACGCCCAGCTGGAGAGC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTCTCGTAGACGGGGCCAGTGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAG +
Preference number: 4 (lower is better)
Translates to: PPGSWRKAVPCTSRRRGQCCRVC*SSTAQQ
Trigger: CTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCA...CTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAAPHVL*NVTQAL
Trigger: CAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTACCTCCAGCAGGGCCTaGAGTGTCGCCTTCAGAGTC +
Preference number: 4 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPTSSRA*SVAFRV
Trigger: GACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGT...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGAC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRAGGRR*HALLVD
Trigger: GTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCAGGTCATCCTCCTGTaGGGGCATCTCGGCTTCCAG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHQVILL*GHLGFQ
Trigger: CTGGAAGCCGAGATGCCCGCACAGGAGGATGACCTG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGGAGGCCCTCGGGACTaGTCCCAGACTCCCCTGCAG +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGGGPRD*SQTPLQ
Trigger: CTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTCC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 19 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQEVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGAGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTC +
Preference number: 4 (lower is better)
Translates to: AAGRGLWASGPRTGRGGRAGIPV*TAPSHL
Trigger: GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGC...TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTGGGGCCCTGCCTCAGTaGCACCAGCGGTGGTGGTGG +
Preference number: 4 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLGALPQ*HQRWWW
Trigger: CCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCC...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCTTGGCTTTGTCCCCTaGAGGATCCAGGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRLGFVP*RIQGLH
Trigger: GTGGAGGCCCTGGATCCTCCAGGGGACAAAGCCAAG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHPPLSQ*SVGPGG
Trigger: GCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGACCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGC +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRPPLSQ*SVGPGG
Trigger: GCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGAGCTGGGGCGGGGCTaGCGGCTCTTCTGGAATTTT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHELGRG*RLFWNF
Trigger: AAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCATCTGAGACCCGGAGCTaGGCACCCGATACCCGGAAG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPASETRS*APDTRK
Trigger: CTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGA...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp ACAGCAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGCGTCCCCCAGGCAGCTaGCGGAAGGCGGTGCCATGC +
Preference number: 4 (lower is better)
Translates to: TAGGSRAPPSPLWPPAPKRPPGS*RKAVPC
Trigger: GCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACG...CTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGT
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGAC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPARGGRC*PKALAD
Trigger: GTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCGCCGCAGCTTCCCGTaGGCGGCCATGGCGGCCTCG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGRRSFP*AAMAAS
Trigger: CGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCATCCTTGTCACCTCGCTaGAGGGCCTCCTGCAGCTTC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPASLSPR*RASCSF
Trigger: GAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGA...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTATACTTGTGGGGGATaGGGCCCCGCATGCCGTTGT +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQYTCGG*GPACRC
Trigger: ACAACGGCATGCGGGGCCTCATCCCCCACAAGTATA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCG +
Preference number: 4 (lower is better)
Translates to: AAGRGLWASGPRTGRGGRSHGLR*GAWLWP
Trigger: CGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGA...TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCCACCCAGCAGCCACTaGTCAGCCTTCCACAAAGCT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHPPSSH*SAFHKA
Trigger: AGCTTTGTGGAAGGCTGATCAGTGGCTGCTGGGTGG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTCTCGTAGACGGGGCCAGAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGAC +
Preference number: 4 (lower is better)
Translates to: PPGSWRKAVPCTSRRRGQSTAQQ*KGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCT...CTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGAC +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGSTAQQ*KGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCT...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGC +
Preference number: 4 (lower is better)
Translates to: LRPGGQRDILVGDEAPHALSRLC*RVCCSS
Trigger: GCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAG...GGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCCCGCTTCTCCTCCTaGCGCTCGGCCTCCCGGAGC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWARFSS*RSASRS
Trigger: GCTCCGGGAGGCCGAGCGGCAGGAGGAGAAGCGGGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGCCGATACCCGGAAGATaGCTTCATGCTGCAGGCCAT +
Preference number: 4 (lower is better)
Translates to: PAQAAAGRGLWASGPRTGPIPGR*LHAAGH
Trigger: ATGGCCTGCAGCATGAAGGCATCTTCCGGGTATCGG...CCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCAGCGCCACCGGGTCCTaGCCAGCGGGCACCGGTAGC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGSATGS*PAGTGS
Trigger: GCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCT...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHCTMSV*TSWFTR
Trigger: CCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGTGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQCTMSV*TSWFTR
Trigger: CCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCA...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHKTRSG*TMSVCT
Trigger: GGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRKTRSG*TMSVCT
Trigger: GGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTT...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGAC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAAGGRR*HALLVD
Trigger: GTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACAGGTCATCCTCCTGTaGGGGCATCTCGGCTTCCAG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAQVILL*GHLGFQ
Trigger: CTGGAAGCCGAGATGCCCGCACAGGAGGATGACCTG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTCAGGTCATCCTCCTGTaGGGGCATCTCGGCTTCCAG +
Preference number: 4 (lower is better)
Translates to: AAAGRGLWASGPRTGRGGQVILL*GHLGFQ
Trigger: CTGGAAGCCGAGATGCCCGCACAGGAGGATGACCTG...ACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGGGAGGCCCTCGGGACTaGTCCCAGACTCCCCTGCAG +
Preference number: 4 (lower is better)
Translates to: SPAAAPQCGLGVVSRPWGGGPRD*SQTPLQ
Trigger: CTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTCC...CCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGA
69% GC, longest homopolymer 7 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TGCGGCTCTCAGCGGCCGTGTAGCTCCGGAGCACCTGCCCCAGGGCCAGGTGGATGGCCTCAGGTGAGGTaGATGGCTCTGGCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: CGSQRPCSSGAPAPGPGGWPQVR*MALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCA...TCCACCTGGCCCTGGGGCAGGTGCTCCGGAGCTACACGGCCGCTGAGAGCCGCA
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GAGGCTGGGACCAAGCAGCGTCGTCTGTGTCCAGAGGGTCCCATGGCCTCAGGTTCCTGCCCAGGCGGCTaGTGGGCGGGGCCTTTGGGC +
Preference number: 4 (lower is better)
Translates to: EAGTKQRRLCPEGPMASGSCPGG*WAGPLG
Trigger: GCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGA...ACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTTGGTCCCAGCCTC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRLHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHLHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTCCCAAAGCAAGGTGGTaGGTCTGGAGCTCTGAGACC +
Preference number: 4 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPPKARW*VWSSET
Trigger: GGTCTCAGAGCTCCAGACGCACCACCTTGCTTTGGG...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTTGGCACCAGCGGTGGTaGTGGGGACACTCCGGCCTG +
Preference number: 4 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEAWHQRW*WGHSGL
Trigger: CAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCA...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCA +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHGCSGL*AESRPA
Trigger: TGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQRLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHRLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRRLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 4 (lower is better)
Translates to: EAFVPAQAAAGRGLWASGGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...CCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTC
69% GC, longest homopolymer 6 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 19 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGTCTCTGGTTATACTaGGAGCTGGGGCGGGGCTGG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPASLWLY*ELGRGW
Trigger: CCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCATGCCCAGGCGGCTGCTaGGCGGGGCCTTTGGGCTTC +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPCPGGC*AGPLGF
Trigger: GAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCA...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTTCCAGCTCCGGCTCATTGTCCGCCCCCAGGCTCTCCAGCTGGGCGTCCCCTCTAGGCCCTGGGGGTaGGAAGCTGAGGGTGAGGCT +
Preference number: 4 (lower is better)
Translates to: GFQLRLIVRPQALQLGVPSRPWG*EAEGEA
Trigger: AGCCTCACCCTCAGCTTCCCACCCCCAGGGCCTAGA...GGGGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCAAGGTGGTGCGTCTaGAGCTCTGAGACCACCTCC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAARWCV*SSETTS
Trigger: GGAGGTGGTCTCAGAGCTCCAGACGCACCACCTTGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACGCCGCAGCTTCCCGTaGGCGGCCATGGCGGCCTCG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRERRSFP*AAMAAS
Trigger: CGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGGCCAGCGCATCTCTTTaGCTTGCGTCTCATACTCAG +
Preference number: 4 (lower is better)
Translates to: PAQAAAGRGLWASGPRTGASASL*LASHTQ
Trigger: CTGAGTATGAGACGCAAGTCAAAGAGATGCGCTGGC...CCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATCAGCGCGGCGCCGCATaGACTCTGCCAGCTCCTGCA +
Preference number: 4 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDQRGAA*TLPAPA
Trigger: TGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTG...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTGCCTCCCTCCCTTCTTaGGGGAGCTCTTGCGGAGGG +
Preference number: 4 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLASLPS*GSSCGG
Trigger: CCCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGC...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGAGCTGCTCGCTCAGCTaGCAGCGCATCTCTTTGACT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRSCSLS*QRISLT
Trigger: AGTCAAAGAGATGCGCTGGCAGCTGAGCGAGCAGCT...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCATCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGC +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPSRQRS*SLSCQR
Trigger: GCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGA...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
68% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CGTGAGGTAGAAGGTTTCGGTCTCCTGCTGCTGGCCGCGCCTCCGGCCCGCCTGAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGC +
Preference number: 4 (lower is better)
Translates to: REVEGFGLLLLAAPPARLNSASS*SNSRRS
Trigger: GCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTT...CAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACG
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWALSRL*CRVCCS
Trigger: GCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTG +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGAPHVL*NVTQAL
Trigger: CAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
68% GC, longest homopolymer 7 nt, total homopolymer stretches 7 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGCAGCTTGGCGAGGATaGTCCGTCCACTCAGATACT +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQAAWRG*SVHSDT
Trigger: AGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTG +
Preference number: 4 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEASRRLT*STLSAV
Trigger: CACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCT...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAGCGCCACCGGGTCCTaGCCAGCGGGCACCGGTAGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSATGS*PAGTGS
Trigger: GCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCATGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPACTMSV*TSWFTR
Trigger: CCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCA...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTCCTGCCCAGGCGGCTaGTGGGCGGGGCCTTTGGGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSCPGG*WAGPLG
Trigger: GCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCTCCTGCCCAGGCGGCTaGTGGGCGGGGCCTTTGGGC +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSSCPGG*WAGPLG
Trigger: GCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGA...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPALHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CATCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTC +
Preference number: 4 (lower is better)
Translates to: HLQQRHLSVAWGSCLGPGAGIPV*TAPSHL
Trigger: GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGC...CCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TGCGGCTCTCAGCGGCCGTGTAGCTCCGGAGCACCTGCCCCAGGGCCAGGTGGAGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 4 (lower is better)
Translates to: CGSQRPCSSGAPAPGPGGASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...TCCACCTGGCCCTGGGGCAGGTGCTCCGGAGCTACACGGCCGCTGAGAGCCGCA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GGAAGTAGAGCTTCAGCACCCCGGCCACCGAGTCCAGGTCATGGGCAGTGCAGCGGCGGCCTCCACGGCTaGAGAAGCGCTCGGCCAGCT +
Preference number: 4 (lower is better)
Translates to: GSRASAPRPPSPGHGQCSGGLHG*RSARPA
Trigger: AGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCC...GCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGCTGAAGCTCTACTTCC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp CTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCCGGCCTCCCGGAGCTTaGCCTCGGCATTCACGCTCT +
Preference number: 4 (lower is better)
Translates to: LRPGGQRDILVGDEAPHARPPGA*PRHSRS
Trigger: AGAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCG...GGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCACCTCGAGAACCTTaGCTTTGTCCCCTGGAGGAT +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRAPREP*LCPLED
Trigger: ATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCA +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAGCSGL*AESRPA
Trigger: TGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPARLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGTGGAGGGGCTGGTCTaGAAGGAATCAAGCACATCC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQVEGLV*KESSTS
Trigger: GGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCAC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGTGGAGGGGCTGGTCTaGAAGGAATCAAGCACATCC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRVEGLV*KESSTS
Trigger: GGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCAC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGTGGAGGGGCTGGTCTaGAAGGAATCAAGCACATCC +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRVEGLV*KESSTS
Trigger: GGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCAC...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACACTCGGTGGAGGGGCTaGTCTGGAAGGAATCAAGCA +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHTRWRG*SGRNQA
Trigger: TGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCTGTACTGGGCCAGGTaGTTGAGGAAGGTGAAGAGG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRLYWAR*LRKVKR
Trigger: CCTCTTCACCTTCCTCAACCACCTGGCCCAGTACAG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTGTACTGGGCCAGGTaGTTGAGGAAGGTGAAGAGG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHLYWAR*LRKVKR
Trigger: CCTCTTCACCTTCCTCAACCACCTGGCCCAGTACAG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGACTGTACTGGGCCAGGTaGTTGAGGAAGGTGAAGAGG +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRLYWAR*LRKVKR
Trigger: CCTCTTCACCTTCCTCAACCACCTGGCCCAGTACAG...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGAGCGTGATATACTTGTaGGGGATGAGGCCCCGCATG +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQSVIYL*GMRPRM
Trigger: CATGCGGGGCCTCATCCCCCACAAGTATATCACGCT...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTAGCGTGATATACTTGTaGGGGATGAGGCCCCGCATG +
Preference number: 4 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPSVIYL*GMRPRM
Trigger: CATGCGGGGCCTCATCCCCCACAAGTATATCACGCT...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGAC +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGRGGRC*PKALAD
Trigger: GTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCT...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGAGRGL*ASGPRT
Trigger: AGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTGCCCAGGCGGCTGCTaGGCGGGGCCTTTGGGCTTC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWCPGGC*AGPLGF
Trigger: GAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGTGCCCAGGCGGCTGCTaGGCGGGGCCTTTGGGCTTC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWCPGGC*AGPLGF
Trigger: GAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCA...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACACGAGAAACCCAGCTTaGAGCCAGCACACAGGTGCA +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHTRNPA*SQHTGA
Trigger: TGCACCTGTGTGCTGGCTCCAAGCTGGGTTTCTCGT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAATCTCAGCCACCGTCTaGAGCTCTGAGACCACCTCC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAISATV*SSETTS
Trigger: GGAGGTGGTCTCAGAGCTCCAGACGGTGGCTGAGAT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000393721.5
3UTR CAA 72 bp CCCGCCTGCCGGCTGCCTGGGTCTGAGCTGGTGGACTaGAGGGACTCGGTGGAGGGGCTGGTCTGGAAGGAA +
Preference number: 4 (lower is better)
Translates to: PACRLPGSELVD*RDSVEGLVWKE
Trigger: TTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
3UTR CAA 72 bp GGGCACGCATCTCCAGCAGCGGCACCTCAGTGTGGCTaGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCT +
Preference number: 4 (lower is better)
Translates to: GHASPAAAPQCG*GVVSRPWGWEA
Trigger: AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATGCGTGCCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCGCCGCAGCTTCCCGTaGGCGGCCATGGCGGCCTCG +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARRRSFP*AAMAAS
Trigger: CGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCG...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR TCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGCCAGCGCATCTCTTTaGCTTGCGTCTCATACTCAG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRASASL*LASHTQ
Trigger: CTGAGTATGAGACGCAAGTCAAAGAGATGCGCTGGC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGTCACAGCAGTCCATaGGGTCCAAGACGTCATGCA +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHCHSSP*GPRRHA
Trigger: TGCATGACGTCTTGGACCTCATGGACTGCTGTGACA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGT +
Preference number: 4 (lower is better)
Translates to: EAFVPAQAAAGRGLWASGDRAAL*ASAPAG
Trigger: ACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATC...CCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGCCCTGCCAGGCATCTaGGCAAGGGTACCCGCCACC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWALPGI*ARVPAT
Trigger: GGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCGCCGTCGAACCCCACTaGTCCCACGCGGCCGTGAGC +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSAVEPH*SHAAVS
Trigger: GCTCACGGCCGCGTGGGAGCAGTGGGGTTCGACGGC...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGTCTCATACTCAGCCTaGAGCCCCCGCTCCCGCCGC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWVSYSA*SPRSRR
Trigger: GCGGCGGGAGCGGGGGCTGCAGGCTGAGTATGAGAC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWSRQRS*SLSCQR
Trigger: GCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGA...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWCCRVC*SSTAQQ
Trigger: CTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGCCRVC*SSTAQQ
Trigger: CTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGTGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWCCRVC*SSTAQQ
Trigger: CTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCA...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGLCCRV*CSSTAQ
Trigger: CTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCCCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAG +
Preference number: 4 (lower is better)
Translates to: GSVIYLWGMRPRMPLCSPLCCRV*CSSTAQ
Trigger: CTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAG...GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC
67% GC, longest homopolymer 6 nt, total homopolymer stretches 15 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAG +
Preference number: 4 (lower is better)
Translates to: HLLLRPGGQRDILVGDEALCCRV*CSSTAQ
Trigger: CTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAG...GGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCAGGTG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWLSRLC*RVCCSS
Trigger: GCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGALSRL*CRVCCS
Trigger: GCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
67% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGALSRL*CRVCCS
Trigger: GCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCCGCTTCTCCTCCTaGCGCTCGGCCTCCCGGAGC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREARFSS*RSASRS
Trigger: GCTCCGGGAGGCCGAGCGGCAGGAGGAGAAGCGGGC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGGGGACACTCCGGCCTaGCCGCTTCTCCTCCTGCCG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGGDTPA*PLLLLP
Trigger: CGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
67% GC, longest homopolymer 9 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGGGGACACTCCGGCCTaGCCGCTTCTCCTCCTGCCG +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSGDTPA*PLLLLP
Trigger: CGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCGGGGACACTCCGGCCTaGCCGCTTCTCCTCCTGCCG +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSGDTPA*PLLLLP
Trigger: CGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCC...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCTTGCGGAGGGGCCCTaGCTCAGTGGCACCAGCGGT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWLAEGP*LSGTSG
Trigger: ACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCAGAAGACGGTAGCATaGACCTCGAGAACCTTGGCT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHQKTVA*TSRTLA
Trigger: AGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGACAGAAGACGGTAGCATaGACCTCGAGAACCTTGGCT +
Preference number: 4 (lower is better)
Translates to: AQAAAGRGLWASGPRTGRQKTVA*TSRTLA
Trigger: AGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTG...TCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGGCTCGGCCCGCCTGCCGGCTaGCTGGGTCTGAGCTGGTGG +
Preference number: 4 (lower is better)
Translates to: PPLSQWSVGPGGSGCSGLGPPAG*LGLSWW
Trigger: CCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCC...GAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCAGCTTGGCGAGGATaGTCCGTCCACTCAGATACT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAAAWRG*SVHSDT
Trigger: AGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTATTCTCGTGCTTGGCCTaGAGCTTGGCGAGGATGCTC +
Preference number: 4 (lower is better)
Translates to: RLLGGAFGLRGPGLGEVVFSCLA*SLARML
Trigger: GAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAA...TACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCGGAAGATGCCTTCATaGTGCAGGCCATTGAGGTTG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHRKMPS*CRPLRL
Trigger: CAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCGGAAGATGCCTTCATaGTGCAGGCCATTGAGGTTG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRRKMPS*CRPLRL
Trigger: CAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCG...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACCGATACCCGGAAGATaGCTTCATGCTGCAGGCCAT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAPIPGR*LHAAGH
Trigger: ATGGCCTGCAGCATGAAGGCATCTTCCGGGTATCGG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACAGCGCCACCGGGTCCTaGCCAGCGGGCACCGGTAGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHSATGS*PAGTGS
Trigger: GCTACCGGTGCCCGCTGGGCAGGACCCGGTGGCGCT...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGWFTRP*SATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSWFTRP*SATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTCGGAAGGCGGTGCCATaGACTTCTCGTAGACGGGGC +
Preference number: 4 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEARKAVP*TSRRRG
Trigger: GCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCG...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCTCGAGGCCCTCTCGTaGAGCCGCAGTACGTCCCCC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWLEALS*SRSTSP
Trigger: GGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGACTCCCCTGCAGTCTaGAGCCCTGCGCCCACCACC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWDSPAV*SPAPTT
Trigger: GGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGACTCCCCTGCAGTCTaGAGCCCTGCGCCCACCACC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGDSPAV*SPAPTT
Trigger: GGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGGAGGCCCTCGGGACTaGTCCCAGACTCCCCTGCAG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGGGPRD*SQTPLQ
Trigger: CTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTCC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGGAGGCCCTCGGGACTaGTCCCAGACTCCCCTGCAG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWGGPRD*SQTPLQ
Trigger: CTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTCC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTTGGCCTCAGGTGAGGTaGATGGCTCTGGCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLWPQVR*MALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCA...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACTCCTGCCCAGGCGGCTaGTGGGCGGGGCCTTTGGGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHSCPGG*WAGPLG
Trigger: GCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGA...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGAGIPV*TAPSHL
Trigger: GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACAGCCTTCCACAAAGCTaGAGAAGAGGGCTTTCCCCA +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHSLPQS*RRGLSP
Trigger: TGGGGAAAGCCCTCTTCTGCAGCTTTGTGGAAGGCT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTATCGCCACCCAGCCCTaGCAGGCATCTGAGCAAGGG +
Preference number: 4 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLIATQP*QASEQG
Trigger: CCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGAT...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCACCAGCGGTGGTGGTaGGGACACTCCGGCCTGCCC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSHQRWW*GHSGLP
Trigger: GGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCACACCAGCGGTGGTGGTaGGGACACTCCGGCCTGCCC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPHQRWW*GHSGLP
Trigger: GGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTG...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTGGCACCAGCGGTGGTaGTGGGGACACTCCGGCCTG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWWHQRW*WGHSGL
Trigger: CAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGGGCCCTGCCTCAGTaGCACCAGCGGTGGTGGTGG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGGALPQ*HQRWWW
Trigger: CCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
67% GC, longest homopolymer 8 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCCCAGGCCCTGCACTTaGGAGGCTTGGGTGCGGCTC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGPRPCT*EAWVRL
Trigger: GAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCCCCCAGGCCCTGCACTTaGGAGGCTTGGGTGCGGCTC +
Preference number: 4 (lower is better)
Translates to: GSVIYLWGMRPRMPLCSPPRPCT*EAWVRL
Trigger: GAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGG...GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC
67% GC, longest homopolymer 8 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAACTCGGTGGAGGGGCTaGTCTGGAAGGAATCAAGCA +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPATRWRG*SGRNQA
Trigger: TGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGAGAGCTGGGGCGGGGCTaGCGGCTCTTCTGGAATTTT +
Preference number: 4 (lower is better)
Translates to: AAGRGLWASGPRTGRGGRELGRG*RLFWNF
Trigger: AAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTC...TCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACCCCCAAAGAGTCTCTaGTTATACTGGGAGCTGGGG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAPPKSL*LYWELG
Trigger: CCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGGGCTGGCCTGAGCTCTaGATAAACTTCTCCATGTCT +
Preference number: 4 (lower is better)
Translates to: PAQAAAGRGLWASGPRTGGWPEL*INFSMS
Trigger: AGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCC...CCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTTCTCATCGCTGTACTaGGCCAGGTGGTTGAGGAAG +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHFSSLY*ARWLRK
Trigger: CTTCCTCAACCACCTGGCCCAGTACAGCGATGAGAA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTTCTCATCGCTGTACTaGGCCAGGTGGTTGAGGAAG +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRFSSLY*ARWLRK
Trigger: CTTCCTCAACCACCTGGCCCAGTACAGCGATGAGAA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCGTCCCCCAGGCAGCTaGCGGAAGGCGGTGCCATGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGRPPGS*RKAVPC
Trigger: GCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGCGTGATATACTTGTaGGGGATGAGGCCCCGCATG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPASVIYL*GMRPRM
Trigger: CATGCGGGGCCTCATCCCCCACAAGTATATCACGCT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCATGCCCAGGCGGCTGCTaGGCGGGGCCTTTGGGCTTC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPCPGGC*AGPLGF
Trigger: GAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCA...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTGCCCAGGCGGCTGCTaGGCGGGGCCTTTGGGCTTC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGCPGGC*AGPLGF
Trigger: GAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTCTAGGCCCTGGGGGTaGGAAGCTGAGGGTGAGGCT +
Preference number: 4 (lower is better)
Translates to: SPAAAPQCGLGVVSRPWGSRPWG*EAEGEA
Trigger: AGCCTCACCCTCAGCTTCCCACCCCCAGGGCCTAGA...CCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 15 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTGTCGTGTCTAGGCCCTaGGGGTGGGAAGCTGAGGGT +
Preference number: 4 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLVVSRP*GWEAEG
Trigger: ACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGAC...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCAGCGCGGCGCCGCATaGACTCTGCCAGCTCCTGCA +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGQRGAA*TLPAPA
Trigger: TGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTTCACGCTCTCCATGTaGTATGCCTGGTACGTCTTC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHFTLSM*YAWYVF
Trigger: GAAGACGTACCAGGCATATCACATGGAGAGCGTGAA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCTGAGCTGGTGGACTTaGGGGACTCGGTGGAGGGGC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWLSWWT*GTRWRG
Trigger: GCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPATPGAS*GRRFRS
Trigger: AGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 4 (lower is better)
Translates to: QQRHLSVAWGSCLGPGGGGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...CCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTG
66% GC, longest homopolymer 6 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGGCATCACGGATCTCTaGGACCCGGAGCTGGGCACC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGGITDL*DPELGT
Trigger: GGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp GGAAGTAGAGCTTCAGCACCCCGGCCACCGAGTCCAGGTCATGGGCAGTGCAGCGGCATCACGGATCTCTaGGACCCGGAGCTGGGCACC +
Preference number: 4 (lower is better)
Translates to: GSRASAPRPPSPGHGQCSGITDL*DPELGT
Trigger: GGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCC...GCTGCACTGCCCATGACCTGGACTCGGTGGCCGGGGTGCTGAAGCTCTACTTCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGTCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWSHGLR*GAWLWP
Trigger: CGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGA...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGCCCTGCCAGGCATCTaGGCAAGGGTACCCGCCACC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGALPGI*ARVPAT
Trigger: GGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
66% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCGTCGAACCCCACTaGTCCCACGCGGCCGTGAGC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREAVEPH*SHAAVS
Trigger: GCTCACGGCCGCGTGGGAGCAGTGGGGTTCGACGGC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000404127.6
CDS-3UTR GCA 90 bp GGCTTCCAGCTCCGGCTCATTGTCCGCCCCCAGGCTCTCCAGCTGGGCGTCCCCAGCTGCTCGCTCAGCTaGCAGCGCATCTCTTTGACT +
Preference number: 4 (lower is better)
Translates to: GFQLRLIVRPQALQLGVPSCSLS*QRISLT
Trigger: AGTCAAAGAGATGCGCTGGCAGCTGAGCGAGCAGCT...GGGGACGCCCAGCTGGAGAGCCTGGGGGCGGACAATGAGCCGGAGCTGGAAGCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSRQRS*SLSCQR
Trigger: GCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGGCGCCGCATGAACTCTaGCAGCTCCTGCAGCAACTC +
Preference number: 4 (lower is better)
Translates to: SPAAAPQCGLGVVSRPWGAPHEL*QLLQQL
Trigger: GAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGC...CCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGA
66% GC, longest homopolymer 6 nt, total homopolymer stretches 11 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSFGAPG*SPGGLH
Trigger: GTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCTTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSFGAPG*SPGGLH
Trigger: GTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAA...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCATTCCGGAAGCTTTGGTaGTCCCGGCTGCTCCCCAGG +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPFRKLW*SRLLPR
Trigger: CCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAA...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGAC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWSTAQQ*KGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCT...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGLCCRV*CSSTAQ
Trigger: CTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGLCCRV*CSSTAQ
Trigger: CTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CATCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTG +
Preference number: 4 (lower is better)
Translates to: HLQQRHLSVAWGSCLGPGAPHVL*NVTQAL
Trigger: CAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGC...CCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGCTCTCCATGTGATATaGCTGGTACGTCTTCTTGGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHALHVI*LVRLLG
Trigger: GCCAAGAAGACGTACCAGGCATATCACATGGAGAGC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGGGGACACTCCGGCCTaGCCGCTTCTCCTCCTGCCG +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHGDTPA*PLLLLP
Trigger: CGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCTTGCGGAGGGGCCCTaGCTCAGTGGCACCAGCGGT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSLAEGP*LSGTSG
Trigger: ACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCTTGCGGAGGGGCCCTaGCTCAGTGGCACCAGCGGT +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGLAEGP*LSGTSG
Trigger: ACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGGTGCACTTGAGTTTGTaGTCCATGAACTTGGCCTGC +
Preference number: 4 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQVHLSL*SMNLAC
Trigger: GCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCAC...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGTGCACTTGAGTTTGTaGTCCATGAACTTGGCCTGC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHVHLSL*SMNLAC
Trigger: GCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCAC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACGGAAGATGCCTTCATaGTGCAGGCCATTGAGGTTG +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPARKMPS*CRPLRL
Trigger: CAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATGGTTCACCCGGCCCTaGAGCGCCACCGGGTCCTGC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREWFTRP*SATGSC
Trigger: GCAGGACCCGGTGGCGCTGCAGGGCCGGGTGAACCA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTCGAGGCCCTCTCGTaGAGCCGCAGTACGTCCCCC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGLEALS*SRSTSP
Trigger: GGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCTCGAGGCCCTCTCGTaGAGCCGCAGTACGTCCCCC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSLEALS*SRSTSP
Trigger: GGGGGACGTACTGCGGCTGCACGAGAGGGCCTCGAG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGACTCCCCTGCAGTCTaGAGCCCTGCGCCCACCACC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGDSPAV*SPAPTT
Trigger: GGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGTGGACCAGCTCCGATaGCAGGAGGCCCTCGGGACT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGVDQLR*QEALGT
Trigger: AGTCCCGAGGGCCTCCTGGCATCGGAGCTGGTCCAC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGTGGACCAGCTCCGATaGCAGGAGGCCCTCGGGACT +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWVDQLR*QEALGT
Trigger: AGTCCCGAGGGCCTCCTGGCATCGGAGCTGGTCCAC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACAGAGTCCATGTTCTGTaGCACAGCCTTATCCACCTC +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHRVHVL*HSLIHL
Trigger: GAGGTGGATAAGGCTGTGGCACAGAACATGGACTCT...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCTCCTGCCCAGGCGGCTaGTGGGCGGGGCCTTTGGGC +
Preference number: 4 (lower is better)
Translates to: APIGESTRGLYESPPSPASCPGG*WAGPLG
Trigger: GCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGA...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCAAGAAGCCTTTGTTCCTaGCCAGGCGGCTGCTGGGCG +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPRSLCS*PGGCWA
Trigger: CGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCT...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSAGIPV*TAPSHL
Trigger: GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGGCGGCCTCCACGGCTaGAGAAGCGCTCGGCCAGCT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHGGLHG*RSARPA
Trigger: AGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCGGCCTCCCGGAGCTTaGCCTCGGCATTCACGCTCT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWRPPGA*PRHSRS
Trigger: AGAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCGGCCTCCCGGAGCTTaGCCTCGGCATTCACGCTCT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGRPPGA*PRHSRS
Trigger: AGAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTGGCACCAGCGGTGGTaGTGGGGACACTCCGGCCTG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGWHQRW*WGHSGL
Trigger: CAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTGGCACCAGCGGTGGTaGTGGGGACACTCCGGCCTG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGWHQRW*WGHSGL
Trigger: CAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGGGGCCCTGCCTCAGTaGCACCAGCGGTGGTGGTGG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREGALPQ*HQRWWW
Trigger: CCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CATCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGTGCCCCAGGGCCAGGTaGAACCCTGTGTCACAGCAG +
Preference number: 4 (lower is better)
Translates to: HLQQRHLSVAWGSCLGPGCPRAR*NPVSQQ
Trigger: CTGCTGTGACACAGGGTTCCACCTGGCCCTGGGGCA...CCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCCCAGGCCCTGCACTTaGGAGGCTTGGGTGCGGCTC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGPRPCT*EAWVRL
Trigger: GAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGGGTGGTAGTCAAAGCGCAGCGGGGGACAGAAGACGGTAGCATGCACCTCGAGCCCAGGCCCTGCACTTaGGAGGCTTGGGTGCGGCTC +
Preference number: 4 (lower is better)
Translates to: GVVVKAQRGTEDGSMHLEPRPCT*EAWVRL
Trigger: GAGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGG...CTCGAGGTGCATGCTACCGTCTTCTGTCCCCCGCTGCGCTTTGACTACCACCCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTCTTGGCTTTGTCCCCTaGAGGATCCAGGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEALGFVP*RIQGLH
Trigger: GTGGAGGCCCTGGATCCTCCAGGGGACAAAGCCAAG...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWRSRRL*MFWALG
Trigger: GCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTTTCTCTGTGTGTACTaGGTCCAAGACACCTCCTGC +
Preference number: 4 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRFLCVY*VQDTSC
Trigger: GCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTTTTCTCTGTGTGTACTaGGTCCAAGACACCTCCTGC +
Preference number: 4 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPFLCVY*VQDTSC
Trigger: GCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAA...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGAGTCTCTGGTTATACTaGGAGCTGGGGCGGGGCTGG +
Preference number: 4 (lower is better)
Translates to: SPAAAPQCGLGVVSRPWGSLWLY*ELGRGW
Trigger: CCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACT...CCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGGCTGGCCTGAGCTCTaGATAAACTTCTCCATGTCT +
Preference number: 4 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHGWPEL*INFSMS
Trigger: AGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp ACAGCAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 4 (lower is better)
Translates to: TAGGSRAPPSPLWPPAPKLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...CTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp TCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 4 (lower is better)
Translates to: SPAAAPQCGLGVVSRPWGLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...CCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWAGPRP*RTEVFP
Trigger: GGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREAGRGL*ASGPRT
Trigger: AGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATGCCCAGGCGGCTGCTaGGCGGGGCCTTTGGGCTTC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRECPGGC*AGPLGF
Trigger: GAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGGTGGGAAGCTGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 4 (lower is better)
Translates to: AAPQCGLGVVSRPWGWEAAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...AGCTTCCCACCCCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCCCAGGCTCTCCAGCTaGGCGTCCCCGAAGAAGCCA +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWPRLSS*ASPKKP
Trigger: TGGCTTCTTCGGGGACGCCCAGCTGGAGAGCCTGGG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000420383.5
3UTR CAA 72 bp ACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTaGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCC +
Preference number: 4 (lower is better)
Translates to: TCFSVPAGSVIY*WGMRPRMPLCS
Trigger: GGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCAGGT
65% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp AGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATCGCCGCAGCTTCCCGTaGGCGGCCATGGCGGCCTCG +
Preference number: 4 (lower is better)
Translates to: SLVHLLCLNGLSVQAALDRRSFP*AAMAAS
Trigger: CGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCG...ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACAGCGCGGCGCCGCATaGACTCTGCCAGCTCCTGCA +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREQRGAA*TLPAPA
Trigger: TGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACGTCCTCTGCAATGTaGCTCAGGCGCTGGGCCAGG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWTSSAM*LRRWAR
Trigger: CCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGT...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCACGTCCTCTGCAATGTaGCTCAGGCGCTGGGCCAGG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGTSSAM*LRRWAR
Trigger: CCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGT...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGATCCCTGCTCTTCTTaGCCAGGCGCCCCACGTCCT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWDPCSS*PGAPRP
Trigger: AGGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGGCCGTCTGGAGCTCTaGGACCACCTCCAGGAGCTC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGGRLEL*DHLQEL
Trigger: GAGCTCCTGGAGGTGGTCTCAGAGCTCCAGACGGCC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
64% GC, longest homopolymer 7 nt, total homopolymer stretches 7 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR TCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAGCCTCCCTCCCTTCTTaGGGGAGCTCTTGCGGAGGG +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPASLPS*GSSCGG
Trigger: CCCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGC...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCTGAGCTGGTGGACTTaGGGGACTCGGTGGAGGGGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGLSWWT*GTRWRG
Trigger: GCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGAGCTGGTGGACTTaGGGGACTCGGTGGAGGGGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGLSWWT*GTRWRG
Trigger: GCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCATCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCG +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPSHGLR*GAWLWP
Trigger: CGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGA...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGSHGLR*GAWLWP
Trigger: CGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTCCCATGGCCTCAGGTaGGGTGCATGGCTCTGGCCG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSHGLR*GAWLWP
Trigger: CGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHSRQRS*SLSCQR
Trigger: GCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGA...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CATCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGGCGCCGCATGAACTCTaGCAGCTCCTGCAGCAACTC +
Preference number: 4 (lower is better)
Translates to: HLQQRHLSVAWGSCLGPGAPHEL*QLLQQL
Trigger: GAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGC...CCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACTTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHFGAPG*SPGGLH
Trigger: GTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAA...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTTCCGGAAGCTTTGGTaGTCCCGGCTGCTCCCCAGG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGFRKLW*SRLLPR
Trigger: CCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGAC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSTAQQ*KGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRECCRVC*SSTAQQ
Trigger: CTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHLSRLC*RVCCSS
Trigger: GCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAG...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGAPHVL*NVTQAL
Trigger: CAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp ACAGCAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGAGCTCATCCTGCAGCTaGTGCTCCAGATCCCTGCTC +
Preference number: 4 (lower is better)
Translates to: TAGGSRAPPSPLWPPAPKSSSCS*CSRSLL
Trigger: GAGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCT...CTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCTCTCCATGTGATATaGCTGGTACGTCTTCTTGGC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAALHVI*LVRLLG
Trigger: GCCAAGAAGACGTACCAGGCATATCACATGGAGAGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACTTGCGGAGGGGCCCTaGCTCAGTGGCACCAGCGGT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRELAEGP*LSGTSG
Trigger: ACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCACTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGT +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPLGRLG*GSQRPC
Trigger: ACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAG...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATACCTCCAGCAGGGCCTaGAGTGTCGCCTTCAGAGTC +
Preference number: 4 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDTSSRA*SVAFRV
Trigger: GACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGT...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp ACAGCAGGCGGCTCACGTGCTCCACCCTCTCCGCTGTGGCCTCCAGCTCCGAAGTTCTCGTGCTTGGCCTaGAGCTTGGCGAGGATGCTC +
Preference number: 4 (lower is better)
Translates to: TAGGSRAPPSPLWPPAPKFSCLA*SLARML
Trigger: GAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAA...CTTCGGAGCTGGAGGCCACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCTGT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWPGHGQ*SPPPVG
Trigger: ACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGPGHGQ*SPPPVG
Trigger: ACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGSRRLT*STLSAV
Trigger: CACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCT...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTG +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPSRRLT*STLSAV
Trigger: CACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCT...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCGGAAGGCGGTGCCATaGACTTCTCGTAGACGGGGC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWRKAVP*TSRRRG
Trigger: GCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCAGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGAC +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPAGGRR*HALLVD
Trigger: GTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGC...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
64% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGCSLQP*AHHLLL
Trigger: GAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGTGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWCSLQP*AHHLLL
Trigger: GAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCA...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTGGACCAGCTCCGATaGCAGGAGGCCCTCGGGACT +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGVDQLR*QEALGT
Trigger: AGTCCCGAGGGCCTCCTGGCATCGGAGCTGGTCCAC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTGGCCTCAGGTGAGGTaGATGGCTCTGGCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWWPQVR*MALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCCTCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACC +
Preference number: 4 (lower is better)
Translates to: GSVIYLWGMRPRMPLCSPSTSTC*SGEAGT
Trigger: GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGA...GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGAGTCCATGTTCTGTaGCACAGCCTTATCCACCTC +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPARVHVL*HSLIHL
Trigger: GAGGTGGATAAGGCTGTGGCACAGAACATGGACTCT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGGGAGAGGTGGTAGATaGTGGCCCAAGGCCCTGGCG +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSGRGGR*WPKALA
Trigger: CGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCGGGAGAGGTGGTAGATaGTGGCCCAAGGCCCTGGCG +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSGRGGR*WPKALA
Trigger: CGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCC...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCAGAAGCCTTTGTTCCTaGCCAGGCGGCTGCTGGGCG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGRSLCS*PGGCWA
Trigger: CGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCT...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGATCGCCACCCAGCCCTaGCAGGCATCTGAGCAAGGG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWIATQP*QASEQG
Trigger: CCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGAT...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp CCATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGCGGCCTCCACGGCTaGAGAAGCGCTCGGCCAGCT +
Preference number: 4 (lower is better)
Translates to: PCSVPQPYPPPRVALGRLGGLHG*RSARPA
Trigger: AGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCC...CAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACATGG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTCCTTCCGGAAGCTTTaGTGCTCCCGGCTGCTCCCC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGSFRKL*CSRLLP
Trigger: GGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACTGGCACCAGCGGTGGTaGTGGGGACACTCCGGCCTG +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHWHQRW*WGHSGL
Trigger: CAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCA...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTGCACTTGGGAGGCTTaGGTGCGGCTCTCAGCGGCC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGCTWEA*VRLSAA
Trigger: GGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTGCACTTGGGAGGCTTaGGTGCGGCTCTCAGCGGCC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSCTWEA*VRLSAA
Trigger: GGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCATGCACTTGGGAGGCTTaGGTGCGGCTCTCAGCGGCC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPCTWEA*VRLSAA
Trigger: GGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCA...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 6 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAGGTTATACTGGGAGCTaGGGCGGGGCTGGCGGCTCT +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPGYTGS*GGAGGS
Trigger: AGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACC...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGGCTGGCCTGAGCTCTaGATAAACTTCTCCATGTCT +
Preference number: 4 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAGWPEL*INFSMS
Trigger: AGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSVCTS*FTRPCS
Trigger: GCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSVCTS*FTRPCS
Trigger: GCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GCTCTCCAGCTGGGCGTCCCCCAGGCAGCTGGCGGAAGGCGGTGCCATGCACTTAGCGTGATATACTTGTaGGGGATGAGGCCCCGCATG +
Preference number: 4 (lower is better)
Translates to: ALQLGVPQAAGGRRCHALSVIYL*GMRPRM
Trigger: CATGCGGGGCCTCATCCCCCACAAGTATATCACGCT...AAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGGACGCCCAGCTGGAGAGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCATGGCTCTGGCCGGTaGACCAGCTCCGATGCCAGG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGHGSGR*TSSDAR
Trigger: CCTGGCATCGGAGCTGGTCCACCGGCCAGAGCCATG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CGAAGGCATCACGGATCTCTGAGACCCGGAGCTGGGCACCCGATACCCGGAAGACATGGCTCTGGCCGGTaGACCAGCTCCGATGCCAGG +
Preference number: 4 (lower is better)
Translates to: RRHHGSLRPGAGHPIPGRHGSGR*TSSDAR
Trigger: CCTGGCATCGGAGCTGGTCCACCGGCCAGAGCCATG...TCTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCCTTCG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCATGGCTCTGGCCGGTaGACCAGCTCCGATGCCAGG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGHGSGR*TSSDAR
Trigger: CCTGGCATCGGAGCTGGTCCACCGGCCAGAGCCATG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGAGPRP*RTEVFP
Trigger: GGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSAGPRP*RTEVFP
Trigger: GGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGAC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWRGGRC*PKALAD
Trigger: GTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCT...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGAC +
Preference number: 4 (lower is better)
Translates to: HLLLRPGGQRDILVGDEARGGRC*PKALAD
Trigger: GTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCT...GGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCAGGTG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACT +
Preference number: 4 (lower is better)
Translates to: APIGESTRGLYESPPSPAAGRGL*ASGPRT
Trigger: AGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGC...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp TGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGAGCTGGGCGGGGCCTTTaGGCTTCGGGGCCCAGGACT +
Preference number: 4 (lower is better)
Translates to: CSVPQPYPPPRVALGRLGAGRGL*ASGPRT
Trigger: AGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGC...TCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTCTAGGCCCTGGGGGTaGGAAGCTGAGGGTGAGGCT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWSRPWG*EAEGEA
Trigger: AGCCTCACCCTCAGCTTCCCACCCCCAGGGCCTAGA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGTCGTGTCTAGGCCCTaGGGGTGGGAAGCTGAGGGT +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWVVSRP*GWEAEG
Trigger: ACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGAC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGTCGTGTCTAGGCCCTaGGGGTGGGAAGCTGAGGGT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWVVSRP*GWEAEG
Trigger: ACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGAC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGAGAAGCAAGGGGGCTaGGGAGAGTGGCCGGTCCAG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGEKQGG*GEWPVQ
Trigger: CTGGACCGGCCACTCTCCCCAGCCCCCTTGCTTCTC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
64% GC, longest homopolymer 6 nt, total homopolymer stretches 11 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 4 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CGTGAGGTAGAAGGTTTCGGTCTCCTGCTGCTGGCCGCGCCTCCGGCCCGCCTGAGACCCAAAGCAAGGTaGTGCGTCTGGAGCTCTGAG +
Preference number: 4 (lower is better)
Translates to: REVEGFGLLLLAAPPARLRPKAR*CVWSSE
Trigger: CTCAGAGCTCCAGACGCACCACCTTGCTTTGGGTCT...CAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGACGTCCTCTGCAATGTaGCTCAGGCGCTGGGCCAGG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGTSSAM*LRRWAR
Trigger: CCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGACGTCCTCTGCAATGTaGCTCAGGCGCTGGGCCAGG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGTSSAM*LRRWAR
Trigger: CCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGT...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGATCCCTGCTCTTCTTaGCCAGGCGCCCCACGTCCT +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGDPCSS*PGAPRP
Trigger: AGGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 6 nt, total homopolymer stretches 10 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGATCCCTGCTCTTCTTaGCCAGGCGCCCCACGTCCT +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGDPCSS*PGAPRP
Trigger: AGGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGGCCGTCTGGAGCTCTaGGACCACCTCCAGGAGCTC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHGRLEL*DHLQEL
Trigger: GAGCTCCTGGAGGTGGTCTCAGAGCTCCAGACGGCC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR TCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCTCCCTCCCTTCTTaGGGGAGCTCTTGCGGAGGG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREASLPS*GSSCGG
Trigger: CCCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGGCTCCTGAGCTGGTGGACTTaGGGGACTCGGTGGAGGGGC +
Preference number: 4 (lower is better)
Translates to: PPLSQWSVGPGGSGCSGLLSWWT*GTRWRG
Trigger: GCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAG...GAGCCCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCTGAGCTGGTGGACTTaGGGGACTCGGTGGAGGGGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHLSWWT*GTRWRG
Trigger: GCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAG...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTCCTTGTCACCTCGCTaGAGGGCCTCCTGCAGCTTC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWSLSPR*RASCSF
Trigger: GAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGGCATCACGGATCTCTaGGACCCGGAGCTGGGCACC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREGITDL*DPELGT
Trigger: GGTGCCCAGCTCCGGGTCTCAGAGATCCGTGATGCC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTCTTCTTGGCCTTCTTaGCCAGGCGCCCCACGTCCT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGSSWPS*PGAPRP
Trigger: AGGACGTGGGGCGCCTGGTCAAGAAGGCCAAGAAGA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000370016.5
CDS-3UTR TCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGTGCGTCTGGAGCTCTaGGACCACCTCCAGGAGCTC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSVRLEL*DHLQEL
Trigger: GAGCTCCTGGAGGTGGTCTCAGAGCTCCAGACGCAC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTTGAGTTTGTGCTCCATGAACTTGGCCTGCCGCTTCTCCACCAGCCTCCCTCCTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGC +
Preference number: 4 (lower is better)
Translates to: LEFVLHELGLPLLHQPPSSRQRS*SLSCQR
Trigger: GCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGA...GGAGGGAGGCTGGTGGAGAAGCGGCAGGCCAAGTTCATGGAGCACAAACTCAAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGNSASS*SNSRRS
Trigger: GCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSNSASS*SNSRRS
Trigger: GCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCATTCCGGAAGCTTTGGTaGTCCCGGCTGCTCCCCAGG +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPFRKLW*SRLLPR
Trigger: CCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAA...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTTCCGGAAGCTTTGGTaGTCCCGGCTGCTCCCCAGG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGFRKLW*SRLLPR
Trigger: CCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGC +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARLSRLC*RVCCSS
Trigger: GCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAG...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGAPHVL*NVTQAL
Trigger: CAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 6 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGCCCGCTTCTCCTCCTaGCGCTCGGCCTCCCGGAGC +
Preference number: 4 (lower is better)
Translates to: SLVHLLCLNGLSVQAALDARFSS*RSASRS
Trigger: GCTCCGGGAGGCCGAGCGGCAGGAGGAGAAGCGGGC...ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGACCTCCAGCAGGGCCTaGAGTGTCGCCTTCAGAGTC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWTSSRA*SVAFRV
Trigger: GACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGT...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGT +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGPGHGQ*SPPPVG
Trigger: ACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCGGAAGGCGGTGCCATaGACTTCTCGTAGACGGGGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGRKAVP*TSRRRG
Trigger: GCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGAC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWAGGRR*HALLVD
Trigger: GTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSCSLQP*AHHLLL
Trigger: GAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCAGTGGGTCCTCCCCTCTCTCGAAGGCATCACGGATCTCTGAGACCCGGAGCTTGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTC +
Preference number: 4 (lower is better)
Translates to: PVGPPLSRRHHGSLRPGACSLQP*AHHLLL
Trigger: GAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCA...AGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGAGAGGGGAGGACCCACTGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGTGGACCAGCTCCGATaGCAGGAGGCCCTCGGGACT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHVDQLR*QEALGT
Trigger: AGTCCCGAGGGCCTCCTGGCATCGGAGCTGGTCCAC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTGGCCTCAGGTGAGGTaGATGGCTCTGGCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGWPQVR*MALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSTSTC*SGEAGT
Trigger: GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAAGAAGCCTTTGTTCCTaGCCAGGCGGCTGCTGGGCG +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPRSLCS*PGGCWA
Trigger: CGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCT...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAGAAGCCTTTGTTCCTaGCCAGGCGGCTGCTGGGCG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGRSLCS*PGGCWA
Trigger: CGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCAGTGGGTCCTCCCCTCTCTCGAAGGCATCACGGATCTCTGAGACCCGGAGCTAGAAGCCTTTGTTCCTaGCCAGGCGGCTGCTGGGCG +
Preference number: 4 (lower is better)
Translates to: PVGPPLSRRHHGSLRPGARSLCS*PGGCWA
Trigger: CGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCT...AGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGAGAGGGGAGGACCCACTGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWEVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCGCGGGCATCCCTGTGTaGACGGCCCCATCCCACCTC +
Preference number: 4 (lower is better)
Translates to: APIGESTRGLYESPPSPAAGIPV*TAPSHL
Trigger: GAGGTGGGATGGGGCCGTGCACACAGGGATGCCCGC...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCCGCATCCTTCCTCAGCTaGCTCCAAAAGGGGCCTGGG +
Preference number: 4 (lower is better)
Translates to: GSVIYLWGMRPRMPLCSPASFLS*LQKGPG
Trigger: CCCAGGCCCCTTTTGGAGGCAGCTGAGGAAGGATGC...GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 22 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGATCGCCACCCAGCCCTaGCAGGCATCTGAGCAAGGG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGIATQP*QASEQG
Trigger: CCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGAT...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGATCGCCACCCAGCCCTaGCAGGCATCTGAGCAAGGG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGIATQP*QASEQG
Trigger: CCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGAT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTCCTTCCGGAAGCTTTaGTGCTCCCGGCTGCTCCCC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSFRKL*CSRLLP
Trigger: GGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCACCAGCGGTGGTGGTaGGGACACTCCGGCCTGCCC +
Preference number: 4 (lower is better)
Translates to: AFRVLFTSSVSMVCRSRRHQRWW*GHSGLP
Trigger: GGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTG...CCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACTGCACTTGGGAGGCTTaGGTGCGGCTCTCAGCGGCC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHCTWEA*VRLSAA
Trigger: GGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCA...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCTTGGCTTTGTCCCCTaGAGGATCCAGGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGLGFVP*RIQGLH
Trigger: GTGGAGGCCCTGGATCCTCCAGGGGACAAAGCCAAG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGAGCTGGGGCGGGGCTaGCGGCTCTTCTGGAATTTT +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWELGRG*RLFWNF
Trigger: AAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGAGTCTCTGGTTATACTaGGAGCTGGGGCGGGGCTGG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWSLWLY*ELGRGW
Trigger: CCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACT...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTCTGAGACCCGGAGCTaGGCACCCGATACCCGGAAG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGSETRS*APDTRK
Trigger: CTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTCTGAGACCCGGAGCTaGGCACCCGATACCCGGAAG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSETRS*APDTRK
Trigger: CTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAACCGAGTCCAGGTCATaGGCAGTGCAGCCCTCCACC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPTESRS*AVQPST
Trigger: GGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGT...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCACCGAGTCCAGGTCATaGGCAGTGCAGCCCTCCACC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSTESRS*AVQPST
Trigger: GGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHSVCTS*FTRPCS
Trigger: GCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCT...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACATGGCTCTGGCCGGTaGACCAGCTCCGATGCCAGG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREHGSGR*TSSDAR
Trigger: CCTGGCATCGGAGCTGGTCCACCGGCCAGAGCCATG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGAC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSRGGRC*PKALAD
Trigger: GTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGHLSVA*GSCLGP
Trigger: AGGGCCTAGACACGACCCCCAAGCCACACTGAGGTG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCT +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWHLSVA*GSCLGP
Trigger: AGGGCCTAGACACGACCCCCAAGCCACACTGAGGTG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWHLSVA*GSCLGP
Trigger: AGGGCCTAGACACGACCCCCAAGCCACACTGAGGTG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTGGAAGGTGCGCACATaGCACCCCACCATGGAGGGT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWWKVRT*HPTMEG
Trigger: ACCCTCCATGGTGGGGTGCCATGTGCGCACCTTCCA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR TCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGATCCCTGCTCTTCTTaGCCAGGCGCCCCACGTCCT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREDPCSS*PGAPRP
Trigger: AGGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp TGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGAGGCCGTCTGGAGCTCTaGGACCACCTCCAGGAGCTC +
Preference number: 4 (lower is better)
Translates to: CSVPQPYPPPRVALGRLGGRLEL*DHLQEL
Trigger: GAGCTCCTGGAGGTGGTCTCAGAGCTCCAGACGGCC...TCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000420383.5
CDS-3UTR TCA 90 bp CTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTTGTCACAGCAGTCCATaGGGTCCAAGACGTCATGCA +
Preference number: 4 (lower is better)
Translates to: LGGAFGLRGPGLGEVVDACHSSP*GPRRHA
Trigger: TGCATGACGTCTTGGACCTCATGGACTGCTGTGACA...AGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTCCTTGTCACCTCGCTaGAGGGCCTCCTGCAGCTTC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSLSPR*RASCSF
Trigger: GAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GAGGCTGGGACCAAGCAGCGTCGTCTGTGTCCAGAGGGTCCCATGGCCTCAGGTGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 4 (lower is better)
Translates to: EAGTKQRRLCPEGPMASGGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...ACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTTGGTCCCAGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSDRAAL*ASAPAG
Trigger: ACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGATCGGGCTGCACTATaGGCGTCTGCACCAGCTGGT +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGDRAAL*ASAPAG
Trigger: ACCAGCTGGTGCAGACGCTCATAGTGCAGCCCGATC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
62% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGTATACTTGTGGGGGATaGGGCCCCGCATGCCGTTGT +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWYTCGG*GPACRC
Trigger: ACAACGGCATGCGGGGCCTCATCCCCCACAAGTATA...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTATACTTGTGGGGGATaGGGCCCCGCATGCCGTTGT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWYTCGG*GPACRC
Trigger: ACAACGGCATGCGGGGCCTCATCCCCCACAAGTATA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCCACCCAGCAGCCACTaGTCAGCCTTCCACAAAGCT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGPPSSH*SAFHKA
Trigger: AGCTTTGTGGAAGGCTGATCAGTGGCTGCTGGGTGG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCAAACACGAGGTCTTTATaGATCGCCACCCAGCCCTGC +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPNTRSL*IATQPC
Trigger: GCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTT...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRENSASS*SNSRRS
Trigger: GCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTT...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCGCCGCATGAACTCTaGCAGCTCCTGCAGCAACTC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGAPHEL*QLLQQL
Trigger: GAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATTCCGGAAGCTTTGGTaGTCCCGGCTGCTCCCCAGG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREFRKLW*SRLLPR
Trigger: CCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAG +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALLCCRV*CSSTAQ
Trigger: CTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAG...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp ATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGC +
Preference number: 4 (lower is better)
Translates to: IGESTRGLYESPPSPARHALSRL*CRVCCS
Trigger: GCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGC...ATGCCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp TTCTCTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTGGGGACACTCCGGCCTaGCCGCTTCTCCTCCTGCCG +
Preference number: 4 (lower is better)
Translates to: FSVCTGSKTPPAPPCHLAGDTPA*PLLLLP
Trigger: CGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCC...AGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp TTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGCTTGCGGAGGGGCCCTaGCTCAGTGGCACCAGCGGT +
Preference number: 4 (lower is better)
Translates to: FTSSVSMVCRSRRLWMFWLAEGP*LSGTSG
Trigger: ACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAG...CCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCAGCTTCTTCCAGGCTaGCCAGGCCCTGCACTTGGG +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHQLLPG*PGPALG
Trigger: CCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACAGCTTCTTCCAGGCTaGCCAGGCCCTGCACTTGGG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREQLLPG*PGPALG
Trigger: CCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCACCTCCAGCAGGGCCTaGAGTGTCGCCTTCAGAGTC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSTSSRA*SVAFRV
Trigger: GACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGACCTCCAGCAGGGCCTaGAGTGTCGCCTTCAGAGTC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGTSSRA*SVAFRV
Trigger: GACTCTGAAGGCGACACTGCAGGCCCTGCTGGAGGT...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTTCTCGTGCTTGGCCTaGAGCTTGGCGAGGATGCTC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWFSCLA*SLARML
Trigger: GAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTTCTCGTGCTTGGCCTaGAGCTTGGCGAGGATGCTC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGFSCLA*SLARML
Trigger: GAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGKTRSG*TMSVCT
Trigger: GGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTT...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGAC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGAGGRR*HALLVD
Trigger: GTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRECSLQP*AHHLLL
Trigger: GAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTGAAGGACTCCCCTGCAGTCTaGAGCCCTGCGCCCACCACC +
Preference number: 4 (lower is better)
Translates to: LCVLGPRHLLLLLVTSLKDSPAV*SPAPTT
Trigger: GGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTC...CTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGGGAGGCCCTCGGGACTaGTCCCAGACTCCCCTGCAG +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALGGPRD*SQTPLQ
Trigger: CTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTCC...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATGGCCTCAGGTGAGGTaGATGGCTCTGGCCGGTGGA +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREWPQVR*MALAGG
Trigger: TCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRESTSTC*SGEAGT
Trigger: GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWLHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGAGCCAGCACACAGGTaGACAGCTGGAAGCGGCCAC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHEPAHR*TAGSGH
Trigger: GTGGCCGCTTCCAGCTGTGCACCTGTGTGCTGGCTC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCTGATGAGTGGAAGGTaGGCACATGGCACCCCACCA +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWLMSGR*AHGTPP
Trigger: TGGTGGGGTGCCATGTGCGCACCTTCCACTCATCAG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTTGGCTTTGTCCCCTaGAGGATCCAGGGCCTCCAC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGLGFVP*RIQGLH
Trigger: GTGGAGGCCCTGGATCCTCCAGGGGACAAAGCCAAG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCA +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWGCSGL*AESRPA
Trigger: TGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCA +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWGCSGL*AESRPA
Trigger: TGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSPPLSQ*SVGPGG
Trigger: GCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGPPLSQ*SVGPGG
Trigger: GCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAGTCTCTGGTTATACTaGGAGCTGGGGCGGGGCTGG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSLWLY*ELGRGW
Trigger: CCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAGTCTCTGGTTATACTaGGAGCTGGGGCGGGGCTGG +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSLWLY*ELGRGW
Trigger: CCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATGGCTCTGGCCGGTaGACCAGCTCCGATGCCAGG +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARHGSGR*TSSDAR
Trigger: CCTGGCATCGGAGCTGGTCCACCGGCCAGAGCCATG...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACAGAGGTGGTAGATGCTaGCCCAAGGCCCTGGCGGAC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHRGGRC*PKALAD
Trigger: GTCCGCCAGGGCCTTGGGCCAGCATCTACCACCTCT...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACTCTAGGCCCTGGGGGTaGGAAGCTGAGGGTGAGGCT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHSRPWG*EAEGEA
Trigger: AGCCTCACCCTCAGCTTCCCACCCCCAGGGCCTAGA...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGTCGTGTCTAGGCCCTaGGGGTGGGAAGCTGAGGGT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREVVSRP*GWEAEG
Trigger: ACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGAC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGTCGTGTCTAGGCCCTaGGGGTGGGAAGCTGAGGGT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHVVSRP*GWEAEG
Trigger: ACCCTCAGCTTCCCACCCCCAGGGCCTAGACACGAC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCT +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGHLSVA*GSCLGP
Trigger: AGGGCCTAGACACGACCCCCAAGCCACACTGAGGTG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSHLSVA*GSCLGP
Trigger: AGGGCCTAGACACGACCCCCAAGCCACACTGAGGTG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGGGTGGTAGTCAAAGCGCAGCGGGGGACAGAAGACGGTAGCATGCACCTCGAGCACCTCAGTGTGGCTTaGGGGTCGTGTCTAGGCCCT +
Preference number: 4 (lower is better)
Translates to: GVVVKAQRGTEDGSMHLEHLSVA*GSCLGP
Trigger: AGGGCCTAGACACGACCCCCAAGCCACACTGAGGTG...CTCGAGGTGCATGCTACCGTCTTCTGTCCCCCGCTGCGCTTTGACTACCACCCC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCACCCTGCACTTGCTaGACAGGGCTGGAGAGAAGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGAPCTC*TGLERS
Trigger: GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCACCTGCCGCTGATGAGTaGAAGGTGCGCACATGGCAC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPPAADE*KVRTWH
Trigger: GTGCCATGTGCGCACCTTCCACTCATCAGCGGCAGG...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
61% GC, longest homopolymer 7 nt, total homopolymer stretches 7 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCATATACTTGTGGGGGATaGGGCCCCGCATGCCGTTGT +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPYTCGG*GPACRC
Trigger: ACAACGGCATGCGGGGCCTCATCCCCCACAAGTATA...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCCACCCAGCAGCCACTaGTCAGCCTTCCACAAAGCT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSPPSSH*SAFHKA
Trigger: AGCTTTGTGGAAGGCTGATCAGTGGCTGCTGGGTGG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCAACACGAGGTCTTTATaGATCGCCACCCAGCCCTGC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGNTRSL*IATQPC
Trigger: GCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTT...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGAACACGAGGTCTTTATaGATCGCCACCCAGCCCTGC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWNTRSL*IATQPC
Trigger: GCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTT...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTCGCATCTCTTTGACTTaGGTCTCATACTCAGCCTGC +
Preference number: 4 (lower is better)
Translates to: LGGAFGLRGPGLGEVVDARISLT*VSYSAC
Trigger: GCAGGCTGAGTATGAGACGCAAGTCAAAGAGATGCG...AGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GAGGCTGGGACCAAGCAGCGTCGTCTGTGTCCAGAGGGTCCCATGGCCTCAGGTAGCTGCTCGCTCAGCTaGCAGCGCATCTCTTTGACT +
Preference number: 4 (lower is better)
Translates to: EAGTKQRRLCPEGPMASGSCSLS*QRISLT
Trigger: AGTCAAAGAGATGCGCTGGCAGCTGAGCGAGCAGCT...ACCTGAGGCCATGGGACCCTCTGGACACAGACGACGCTGCTTGGTCCCAGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCCGCATGAACTCTaGCAGCTCCTGCAGCAACTC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREAPHEL*QLLQQL
Trigger: GAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGAGCTCATCCTGCAGCTaGTGCTCCAGATCCCTGCTC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGSSSCS*CSRSLL
Trigger: GAGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCT...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAGCTCATCCTGCAGCTaGTGCTCCAGATCCCTGCTC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSSSCS*CSRSLL
Trigger: GAGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTAGATGCTGTGCACTTGAGTTTGTaGTCCATGAACTTGGCCTGC +
Preference number: 4 (lower is better)
Translates to: LGGAFGLRGPGLGEVVDAVHLSL*SMNLAC
Trigger: GCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCAC...AGCATCTACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTGAAGCTTGGGAGGCTTGGGTaGGGCTCTCAGCGGCCGTGT +
Preference number: 4 (lower is better)
Translates to: LCVLGPRHLLLLLVTSLKLGRLG*GSQRPC
Trigger: ACACGGCCGCTGAGAGCCGCACCCAAGCCTCCCAAG...CTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CCATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGCAGCTTCTTCCAGGCTaGCCAGGCCCTGCACTTGGG +
Preference number: 4 (lower is better)
Translates to: PCSVPQPYPPPRVALGRLQLLPG*PGPALG
Trigger: CCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG...CAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACATGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTTCTCGTGCTTGGCCTaGAGCTTGGCGAGGATGCTC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGFSCLA*SLARML
Trigger: GAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTTCTCGTGCTTGGCCTaGAGCTTGGCGAGGATGCTC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGFSCLA*SLARML
Trigger: GAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGACCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGT +
Preference number: 4 (lower is better)
Translates to: CSVPQPYPPPRVALGRLGPGHGQ*SPPPVG
Trigger: ACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGG...TCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGG +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSCTMSV*TSWFTR
Trigger: CCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACC +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSKTRSG*TMSVCT
Trigger: GGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCAAGACCCGATCGGGCTaGACTATGAGCGTCTGCACC +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSKTRSG*TMSVCT
Trigger: GGTGCAGACGCTCATAGTGCAGCCCGATCGGGTCTT...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACAGGTCATCCTCCTGTaGGGGCATCTCGGCTTCCAG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREQVILL*GHLGFQ
Trigger: CTGGAAGCCGAGATGCCCGCACAGGAGGATGACCTG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGATGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTC +
Preference number: 4 (lower is better)
Translates to: CSVPQPYPPPRVALGRLGCSLQP*AHHLLL
Trigger: GAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCA...TCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTGAGTTTGTGCTCCATGAACTTGGCCTGCCGCTTCTCCACCAGCCTCCCTCCTCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACC +
Preference number: 4 (lower is better)
Translates to: LEFVLHELGLPLLHQPPSSTSTC*SGEAGT
Trigger: GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGA...GGAGGGAGGCTGGTGGAGAAGCGGCAGGCCAAGTTCATGGAGCACAAACTCAAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGGATGTTCTGGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGCAGGGAGAGGTGGTAGATaGTGGCCCAAGGCCCTGGCG +
Preference number: 4 (lower is better)
Translates to: LDVLGSGQNLVPQLHFNAGRGGR*WPKALA
Trigger: CGCCAGGGCCTTGGGCCAGCATCTACCACCTCTCCC...TGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGAAGTGCAGGCACCCTaGACTTGCTGGACAGGGCTG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREEVQAP*TCWTGL
Trigger: CAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCACTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPLHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCCCACCATGGAGGGTaGACGAGAAACCCAGCTTGG +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHPHHGG*TRNPAW
Trigger: CCAAGCTGGGTTTCTCGTGCACCCTCCATGGTGGGG...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR GCA 90 bp CATCTCCAGCAGCGGCACCTCAGTGTGGCTTGGGGGTCGTGTCTAGGCCCTGGGTACGTCTTCTTGGCCTaGAGGGAGACCCAAAGCAAG +
Preference number: 4 (lower is better)
Translates to: HLQQRHLSVAWGSCLGPGYVFLA*RETQSK
Trigger: CTTGCTTTGGGTCTCCCTGCAGGCCAAGAAGACGTA...CCCAGGGCCTAGACACGACCCCCAAGCCACACTGAGGTGCCGCTGCTGGAGATG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp CTGGATGTTCTGGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGCATGCACTTGGGAGGCTTaGGTGCGGCTCTCAGCGGCC +
Preference number: 4 (lower is better)
Translates to: LDVLGSGQNLVPQLHFNACTWEA*VRLSAA
Trigger: GGCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCA...TGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCACCTCGAGAACCTTaGCTTTGTCCCCTGGAGGAT +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWAPREP*LCPLED
Trigger: ATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCCGCACCTCGAGAACCTTaGCTTTGTCCCCTGGAGGAT +
Preference number: 4 (lower is better)
Translates to: GSVIYLWGMRPRMPLCSPAPREP*LCPLED
Trigger: ATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGC...GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGATGTTCTGGGCTCTaGGCAGAATCTCGTCCCGCA +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGGCSGL*AESRPA
Trigger: TGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
61% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSRLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCGGCTCTGGATGTTCTaGGCTCTGGGCAGAATCTCG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGRLWMF*ALGRIS
Trigger: CGAGATTCTGCCCAGAGCCCAGAACATCCAGAGCCG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGGATGTTCTGGGCTCTGGGCAGAATCTCGTCCCGCAGCTCCATTTCAACGCACGGTCCAGGCGGCTCTaGATGTTCTGGGCTCTGGGC +
Preference number: 4 (lower is better)
Translates to: LDVLGSGQNLVPQLHFNARSRRL*MFWALG
Trigger: GCCCAGAGCCCAGAACATCCAGAGCCGCCTGGACCG...TGCGTTGAAATGGAGCTGCGGGACGAGATTCTGCCCAGAGCCCAGAACATCCAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp CACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCACTCGGTGGAGGGGCTaGTCTGGAAGGAATCAAGCA +
Preference number: 4 (lower is better)
Translates to: HLLLRPGGQRDILVGDEATRWRG*SGRNQA
Trigger: TGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGT...GGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCAGGTG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 4 (lower is better)
Translates to: PCSVPQPYPPPRVALGRLAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...CAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACATGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CGGGAGAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTTTTCTCTGTGTGTACTaGGTCCAAGACACCTCCTGC +
Preference number: 4 (lower is better)
Translates to: REKPLFLPRRLLGGAFGLFLCVY*VQDTSC
Trigger: GCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAA...AAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGAGCTGGGGCGGGGCTaGCGGCTCTTCTGGAATTTT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREELGRG*RLFWNF
Trigger: AAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTC...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGCCCCCAAAGAGTCTCTaGTTATACTGGGAGCTGGGG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWPPKSL*LYWELG
Trigger: CCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGG...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCCCCCAAAGAGTCTCTaGTTATACTGGGAGCTGGGG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWPPKSL*LYWELG
Trigger: CCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTTGAGTTTGTGCTCCATGAACTTGGCCTGCCGCTTCTCCACCAGCCTCCCTCCTCTGAGACCCGGAGCTaGGCACCCGATACCCGGAAG +
Preference number: 4 (lower is better)
Translates to: LEFVLHELGLPLLHQPPSSETRS*APDTRK
Trigger: CTTCCGGGTATCGGGTGCCCAGCTCCGGGTCTCAGA...GGAGGGAGGCTGGTGGAGAAGCGGCAGGCCAAGTTCATGGAGCACAAACTCAAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCACCGAGTCCAGGTCATaGGCAGTGCAGCCCTCCACC +
Preference number: 4 (lower is better)
Translates to: APIGESTRGLYESPPSPATESRS*AVQPST
Trigger: GGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGT...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp CCATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGACCGAGTCCAGGTCATaGGCAGTGCAGCCCTCCACC +
Preference number: 4 (lower is better)
Translates to: PCSVPQPYPPPRVALGRLTESRS*AVQPST
Trigger: GGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGT...CAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACATGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGCTGTACTGGGCCAGGTaGTTGAGGAAGGTGAAGAGG +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWLYWAR*LRKVKR
Trigger: CCTCTTCACCTTCCTCAACCACCTGGCCCAGTACAG...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALSVCTS*FTRPCS
Trigger: GCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCT...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp GCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGAGCGTCTGCACCAGCTaGTTCACCCGGCCCTGCAGC +
Preference number: 4 (lower is better)
Translates to: AFRVLFTSSVSMVCRSRRSVCTS*FTRPCS
Trigger: GCTGCAGGGCCGGGTGAACCAGCTGGTGCAGACGCT...CCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCC +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALAGPRP*RTEVFP
Trigger: GGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGC...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACACACAGGTGCACAGCTaGAAGCGGCCACAGGCCTCT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHTQVHS*KRPQAS
Trigger: AGAGGCCTGTGGCCGCTTCCAGCTGTGCACCTGTGT...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000370028.7
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACATGGCACCCCACCATaGAGGGTGCACGAGAAACCC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREHGTPP*RVHEKP
Trigger: GGGTTTCTCGTGCACCCTCCATGGTGGGGTGCCATG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000370028.7
3UTR CAA 72 bp GGGGGACAGAAGACGGTAGCATGCACCTCGAGAACCTaGGCTTTGTCCCCTGGAGGATCCAGGGCCTCCACA +
Preference number: 4 (lower is better)
Translates to: GGQKTVACTSRT*ALSPGGSRAST
Trigger: TGTGGAGGCCCTGGATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTGTCCCCC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCCAGCGCATCTCTTTaGCTTGCGTCTCATACTCAG +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWASASL*LASHTQ
Trigger: CTGAGTATGAGACGCAAGTCAAAGAGATGCGCTGGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGCCAGCGCATCTCTTTaGCTTGCGTCTCATACTCAG +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGASASL*LASHTQ
Trigger: CTGAGTATGAGACGCAAGTCAAAGAGATGCGCTGGC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCATTCACGCTCTCCATGTaGTATGCCTGGTACGTCTTC +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPFTLSM*YAWYVF
Trigger: GAAGACGTACCAGGCATATCACATGGAGAGCGTGAA...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
60% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CACCTGCTTCTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCTGTCACAGCAGTCCATaGGGTCCAAGACGTCATGCA +
Preference number: 4 (lower is better)
Translates to: HLLLRPGGQRDILVGDEACHSSP*GPRRHA
Trigger: TGCATGACGTCTTGGACCTCATGGACTGCTGTGACA...GGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAGAAGCAGGTG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCACCCAGCAGCCACTaGTCAGCCTTCCACAAAGCT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHPPSSH*SAFHKA
Trigger: AGCTTTGTGGAAGGCTGATCAGTGGCTGCTGGGTGG...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAAACACGAGGTCTTTATaGATCGCCACCCAGCCCTGC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPNTRSL*IATQPC
Trigger: GCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTT...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAGCTGCTCGCTCAGCTaGCAGCGCATCTCTTTGACT +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGSCSLS*QRISLT
Trigger: AGTCAAAGAGATGCGCTGGCAGCTGAGCGAGCAGCT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAAGCTCATCCTGCAGCTaGTGCTCCAGATCCCTGCTC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRESSSCS*CSRSLL
Trigger: GAGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCT...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATGTTCTGGCAGCTTCTTCCAGGCTaGCCAGGCCCTGCACTTGGG +
Preference number: 4 (lower is better)
Translates to: FTSSVSMVCRSRRLWMFWQLLPG*PGPALG
Trigger: CCCAAGTGCAGGGCCTGGGCAGCCTGGAAGAAGCTG...CCAGAACATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCCAGAAGACGGTAGCATaGACCTCGAGAACCTTGGCT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGQKTVA*TSRTLA
Trigger: AGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTG...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGCAGCTTGGCGAGGATaGTCCGTCCACTCAGATACT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSAAWRG*SVHSDT
Trigger: AGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTGAAGCCAGGTCATGGGCAGTaGAGCCCTCCACCAGTGGGT +
Preference number: 4 (lower is better)
Translates to: LCVLGPRHLLLLLVTSLKPGHGQ*SPPPVG
Trigger: ACCCACTGGTGGAGGGCTGCACTGCCCATGACCTGG...CTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp ATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATAGCAGGCGGCTCACGTaGTCCACCCTCTCCGCTGTG +
Preference number: 4 (lower is better)
Translates to: IGESTRGLYESPPSPARHSRRLT*STLSAV
Trigger: CACAGCGGAGAGGGTGGAGCACGTGAGCCGCCTGCT...ATGCCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGAT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCGGAAGGCGGTGCCATaGACTTCTCGTAGACGGGGC +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALRKAVP*TSRRRG
Trigger: GCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCG...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp CCATGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGCAGGTCATCCTCCTGTaGGGGCATCTCGGCTTCCAG +
Preference number: 4 (lower is better)
Translates to: PCSVPQPYPPPRVALGRLQVILL*GHLGFQ
Trigger: CTGGAAGCCGAGATGCCCGCACAGGAGGATGACCTG...CAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACATGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATGCCAAGAGTCCATGTTCTGTaGCACAGCCTTATCCACCTC +
Preference number: 4 (lower is better)
Translates to: PWPQVRCMALAGGPAPMPRVHVL*HSLIHL
Trigger: GAGGTGGATAAGGCTGTGGCACAGAACATGGACTCT...TGGCATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGG
60% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTCCCATGGCCTCAGGTGAGGTGCATGGCTCTGGCCGGTGGACCAGCTCCGATAGAGTCCATGTTCTGTaGCACAGCCTTATCCACCTC +
Preference number: 4 (lower is better)
Translates to: GPMASGEVHGSGRWTSSDRVHVL*HSLIHL
Trigger: GAGGTGGATAAGGCTGTGGCACAGAACATGGACTCT...ATCGGAGCTGGTCCACCGGCCAGAGCCATGCACCTCACCTGAGGCCATGGGACC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACTGCACAGGGTGAAGTaGAGGCACCCTGCACTTGCT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRELHRVK*RHPALA
Trigger: AGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGAGCCTTCCACAAAGCTaGAGAAGAGGGCTTTCCCCA +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWSLPQS*RRGLSP
Trigger: TGGGGAAAGCCCTCTTCTGCAGCTTTGTGGAAGGCT...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGAGCCTTCCACAAAGCTaGAGAAGAGGGCTTTCCCCA +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWSLPQS*RRGLSP
Trigger: TGGGGAAAGCCCTCTTCTGCAGCTTTGTGGAAGGCT...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCGCACCTCGAGAACCTTaGCTTTGTCCCCTGGAGGAT +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSAPREP*LCPLED
Trigger: ATCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGC...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCAGTGGGTCCTCCCCTCTCTCGAAGGCATCACGGATCTCTGAGACCCGGAGCTGTGGAGGGGCTGGTCTaGAAGGAATCAAGCACATCC +
Preference number: 4 (lower is better)
Translates to: PVGPPLSRRHHGSLRPGAVEGLV*KESSTS
Trigger: GGATGTGCTTGATTCCTTCCAGACCAGCCCCTCCAC...AGCTCCGGGTCTCAGAGATCCGTGATGCCTTCGAGAGAGGGGAGGACCCACTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGACTCGGTGGAGGGGCTaGTCTGGAAGGAATCAAGCA +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGTRWRG*SGRNQA
Trigger: TGCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGT...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGGCTTGGCCTGCAGCTTaGCGAGGATGCTCCGTCCAC +
Preference number: 4 (lower is better)
Translates to: AFRVLFTSSVSMVCRSRRAWPAA*RGCSVH
Trigger: GTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGC...CCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCCCCCAAAGAGTCTCTaGTTATACTGGGAGCTGGGG +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGPPKSL*LYWELG
Trigger: CCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGACCGAGTCCAGGTCATaGGCAGTGCAGCCCTCCACC +
Preference number: 4 (lower is better)
Translates to: AFRVLFTSSVSMVCRSRRTESRS*AVQPST
Trigger: GGTGGAGGGCTGCACTGCCCATGACCTGGACTCGGT...CCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCTGTACTGGGCCAGGTaGTTGAGGAAGGTGAAGAGG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGLYWAR*LRKVKR
Trigger: CCTCTTCACCTTCCTCAACCACCTGGCCCAGTACAG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCTCCACGTGTTGCTCTaGGGAGGCTGGGACCAAGCA +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARLHVLL*GGWDQA
Trigger: TGCTTGGTCCCAGCCTCCCCAGAGCAACACGTGGAG...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR TCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAGCCAGCGCATCTCTTTaGCTTGCGTCTCATACTCAG +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPASASL*LASHTQ
Trigger: CTGAGTATGAGACGCAAGTCAAAGAGATGCGCTGGC...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCCAGCGCATCTCTTTaGCTTGCGTCTCATACTCAG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGASASL*LASHTQ
Trigger: CTGAGTATGAGACGCAAGTCAAAGAGATGCGCTGGC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp AGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATACGTCCTCTGCAATGTaGCTCAGGCGCTGGGCCAGG +
Preference number: 4 (lower is better)
Translates to: SLVHLLCLNGLSVQAALDTSSAM*LRRWAR
Trigger: CCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGT...ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp ATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATGATCCCTGCTCTTCTTaGCCAGGCGCCCCACGTCCT +
Preference number: 4 (lower is better)
Translates to: IGESTRGLYESPPSPARHDPCSS*PGAPRP
Trigger: AGGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATC...ATGCCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGAT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR TCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGTTCACGCTCTCCATGTaGTATGCCTGGTACGTCTTC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWFTLSM*YAWYVF
Trigger: GAAGACGTACCAGGCATATCACATGGAGAGCGTGAA...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTTCACGCTCTCCATGTaGTATGCCTGGTACGTCTTC +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGFTLSM*YAWYVF
Trigger: GAAGACGTACCAGGCATATCACATGGAGAGCGTGAA...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTGTCACAGCAGTCCATaGGGTCCAAGACGTCATGCA +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGCHSSP*GPRRHA
Trigger: TGCATGACGTCTTGGACCTCATGGACTGCTGTGACA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTGTCACAGCAGTCCATaGGGTCCAAGACGTCATGCA +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGCHSSP*GPRRHA
Trigger: TGCATGACGTCTTGGACCTCATGGACTGCTGTGACA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSTPGAS*GRRFRS
Trigger: AGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp GTGGTAGATGCTGGCCCAAGGCCCTGGCGGACAGAGGTCTTTCCCAAGAGCTCCACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCT +
Preference number: 4 (lower is better)
Translates to: VVDAGPRPWRTEVFPKSSTPGAS*GRRFRS
Trigger: AGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGT...GGAGCTCTTGGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGCATCTACCAC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGGGGCACAGGCTGGCCTaGGCTCTGGATAAACTTCTC +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARGHRLA*ALDKLL
Trigger: GAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCC...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACAGCTGCTCGCTCAGCTaGCAGCGCATCTCTTTGACT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHSCSLS*QRISLT
Trigger: AGTCAAAGAGATGCGCTGGCAGCTGAGCGAGCAGCT...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGGCGCCGCATGAACTCTaGCAGCTCCTGCAGCAACTC +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALAPHEL*QLLQQL
Trigger: GAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGC...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGAGCTCATCCTGCAGCTaGTGCTCCAGATCCCTGCTC +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARSSSCS*CSRSLL
Trigger: GAGCAGGGATCTGGAGCAGCAGCTGCAGGATGAGCT...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGCTCTCCATGTGATATaGCTGGTACGTCTTCTTGGC +
Preference number: 4 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWALHVI*LVRLLG
Trigger: GCCAAGAAGACGTACCAGGCATATCACATGGAGAGC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCTCTCCATGTGATATaGCTGGTACGTCTTCTTGGC +
Preference number: 4 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWALHVI*LVRLLG
Trigger: GCCAAGAAGACGTACCAGGCATATCACATGGAGAGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCAGAAGACGGTAGCATaGACCTCGAGAACCTTGGCT +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGQKTVA*TSRTLA
Trigger: AGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCACAGAAGACGGTAGCATaGACCTCGAGAACCTTGGCT +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPQKTVA*TSRTLA
Trigger: AGCCAAGGTTCTCGAGGTGCATGCTACCGTCTTCTG...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000420383.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACGCAGCTTGGCGAGGATaGTCCGTCCACTCAGATACT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHAAWRG*SVHSDT
Trigger: AGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGC...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCGGAAGATGCCTTCATaGTGCAGGCCATTGAGGTTG +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGRKMPS*CRPLRL
Trigger: CAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACCGATACCCGGAAGATaGCTTCATGCTGCAGGCCAT +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREPIPGR*LHAAGH
Trigger: ATGGCCTGCAGCATGAAGGCATCTTCCGGGTATCGG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR GCA 90 bp TGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGATGCACTATGAGCGTCTaGACCAGCTGGTTCACCCGG +
Preference number: 4 (lower is better)
Translates to: CSVPQPYPPPRVALGRLGCTMSV*TSWFTR
Trigger: CCGGGTGAACCAGCTGGTGCAGACGCTCATAGTGCA...TCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp ATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATTCCACCTCCACGTGTTaGTCTGGGGAGGCTGGGACC +
Preference number: 4 (lower is better)
Translates to: IGESTRGLYESPPSPARHSTSTC*SGEAGT
Trigger: GGTCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGA...ATGCCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGAT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAGCCTTCCACAAAGCTaGAGAAGAGGGCTTTCCCCA +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSSLPQS*RRGLSP
Trigger: TGGGGAAAGCCCTCTTCTGCAGCTTTGTGGAAGGCT...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp TTCTCTGTGTGTACTGGGTCCAAGACACCTCCTGCTCCTCCTTGTCACCTCGCTTCCTTCCGGAAGCTTTaGTGCTCCCGGCTGCTCCCC +
Preference number: 4 (lower is better)
Translates to: FSVCTGSKTPPAPPCHLASFRKL*CSRLLP
Trigger: GGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGA...AGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp AGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATTGCCCCAGGGCCAGGTaGAACCCTGTGTCACAGCAG +
Preference number: 4 (lower is better)
Translates to: SLVHLLCLNGLSVQAALDCPRAR*NPVSQQ
Trigger: CTGCTGTGACACAGGGTTCCACCTGGCCCTGGGGCA...ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCTCCTCTGTCTCAATaGTCTGTCGGTCCAGGCGGC +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALPPLSQ*SVGPGG
Trigger: GCCGCCTGGACCGACAGACCATTGAGACAGAGGAGG...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACCCCCAAAGAGTCTCTaGTTATACTGGGAGCTGGGG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREPPKSL*LYWELG
Trigger: CCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCGGCTGGCCTGAGCTCTaGATAAACTTCTCCATGTCT +
Preference number: 4 (lower is better)
Translates to: PTSLHRVKCRHPALAGQGGWPEL*INFSMS
Trigger: AGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCC...GCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCGTTGTGCTCCCCCGGCTGGCCTGAGCTCTaGATAAACTTCTCCATGTCT +
Preference number: 4 (lower is better)
Translates to: GSVIYLWGMRPRMPLCSPGWPEL*INFSMS
Trigger: AGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCC...GGGGGAGCACAACGGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCTTCTCATCGCTGTACTaGGCCAGGTGGTTGAGGAAG +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSFSSLY*ARWLRK
Trigger: CTTCCTCAACCACCTGGCCCAGTACAGCGATGAGAA...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR TCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGTTCACGCTCTCCATGTaGTATGCCTGGTACGTCTTC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGFTLSM*YAWYVF
Trigger: GAAGACGTACCAGGCATATCACATGGAGAGCGTGAA...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR TCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCT +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHTPGAS*GRRFRS
Trigger: AGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGT...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCGCATCTCTTTGACTTaGGTCTCATACTCAGCCTGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGRISLT*VSYSAC
Trigger: GCAGGCTGAGTATGAGACGCAAGTCAAAGAGATGCG...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGCGCATCTCTTTGACTTaGGTCTCATACTCAGCCTGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGRISLT*VSYSAC
Trigger: GCAGGCTGAGTATGAGACGCAAGTCAAAGAGATGCG...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGGCTCTCCATGTGATATaGCTGGTACGTCTTCTTGGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGALHVI*LVRLLG
Trigger: GCCAAGAAGACGTACCAGGCATATCACATGGAGAGC...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
58% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTGCACTTGAGTTTGTaGTCCATGAACTTGGCCTGC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGVHLSL*SMNLAC
Trigger: GCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCAC...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp GGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGAGAGTCCATGTTCTGTaGCACAGCCTTATCCACCTC +
Preference number: 4 (lower is better)
Translates to: GEVQAPCTCWTGLERSKGRVHVL*HSLIHL
Trigger: GAGGTGGATAAGGCTGTGGCACAGAACATGGACTCT...CCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCAAGAGTCCATGTTCTGTaGCACAGCCTTATCCACCTC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPRVHVL*HSLIHL
Trigger: GAGGTGGATAAGGCTGTGGCACAGAACATGGACTCT...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp TATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCCATTTCTCTGTGTGTACTaGGTCCAAGACACCTCCTGC +
Preference number: 4 (lower is better)
Translates to: YESPPSPARHLSKGTRHPFLCVY*VQDTSC
Trigger: GCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAA...TGGGTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR CCA 90 bp GTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGTTTCTCTGTGTGTACTaGGTCCAAGACACCTCCTGC +
Preference number: 4 (lower is better)
Translates to: VKCRHPALAGQGWREARGFLCVY*VQDTSC
Trigger: GCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAA...CCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCAC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp GCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCGGCTGGCCTGAGCTCTaGATAAACTTCTCCATGTCT +
Preference number: 4 (lower is better)
Translates to: AQGEVQAPCTCWTGLERSGWPEL*INFSMS
Trigger: AGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCC...GCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAATTCTCATCGCTGTACTaGGCCAGGTGGTTGAGGAAG +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWREFSSLY*ARWLRK
Trigger: CTTCCTCAACCACCTGGCCCAGTACAGCGATGAGAA...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CCA 90 bp CGATACCCGGAAGATGCCTTCATGCTGCAGGCCATTGAGGTTGATGAAGCGAATGCTGGCCCAAGGCCCTaGCGGACAGAGGTCTTTCCC +
Preference number: 4 (lower is better)
Translates to: RYPEDAFMLQAIEVDEANAGPRP*RTEVFP
Trigger: GGGAAAGACCTCTGTCCGCCAGGGCCTTGGGCCAGC...ATTCGCTTCATCAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCGGGTATCG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp TGTTCTGTGCCACAGCCTTATCCACCTCCACGTGTTGCTCTGGGGAGGCTGGGACCTGGTACGTCTTCTTaGCCTGCAGGGAGACCCAAA +
Preference number: 4 (lower is better)
Translates to: CSVPQPYPPPRVALGRLGPGTSS*PAGRPK
Trigger: TTTGGGTCTCCCTGCAGGCCAAGAAGACGTACCAGG...TCCCAGCCTCCCCAGAGCAACACGTGGAGGTGGATAAGGCTGTGGCACAGAACA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR TCA 90 bp CCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCT +
Preference number: 4 (lower is better)
Translates to: PIGESTRGLYESPPSPARTPGAS*GRRFRS
Trigger: AGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGT...CCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR GCA 90 bp CTTTATGAATCGCCACCCAGCCCTGCCAGGCATCTGAGCAAGGGTACCCGCCACCGCATCTCTTTGACTTaGGTCTCATACTCAGCCTGC +
Preference number: 4 (lower is better)
Translates to: LYESPPSPARHLSKGTRHRISLT*VSYSAC
Trigger: GCAGGCTGAGTATGAGACGCAAGTCAAAGAGATGCG...GTGGCGGGTACCCTTGCTCAGATGCCTGGCAGGGCTGGGTGGCGATTCATAAAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000420383.5
CDS-3UTR GCA 90 bp CTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAACGCATCTCTTTGACTTaGGTCTCATACTCAGCCTGC +
Preference number: 4 (lower is better)
Translates to: LHRVKCRHPALAGQGWRERISLT*VSYSAC
Trigger: GCAGGCTGAGTATGAGACGCAAGTCAAAGAGATGCG...TTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR GCA 90 bp CGATACCCGGAAGATGCCTTCATGCTGCAGGCCATTGAGGTTGATGAAGCGAATTTCCGGAAGCTTTGGTaGTCCCGGCTGCTCCCCAGG +
Preference number: 4 (lower is better)
Translates to: RYPEDAFMLQAIEVDEANFRKLW*SRLLPR
Trigger: CCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAA...ATTCGCTTCATCAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCGGGTATCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp GCCTTCAGAGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGGCAGCTTGGCGAGGATaGTCCGTCCACTCAGATACT +
Preference number: 4 (lower is better)
Translates to: AFRVLFTSSVSMVCRSRRAAWRG*SVHSDT
Trigger: AGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGC...CCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACTCTGAAGGC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CCA 90 bp TGGCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCCCCAAAGAGTCTCTaGTTATACTGGGAGCTGGGG +
Preference number: 4 (lower is better)
Translates to: WLPSGNQHEVFMNRHPALPPKSL*LYWELG
Trigger: CCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGG...CAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGCCA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp GCTCCCATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCTTCTCATCGCTGTACTaGGCCAGGTGGTTGAGGAAG +
Preference number: 4 (lower is better)
Translates to: APIGESTRGLYESPPSPAFSSLY*ARWLRK
Trigger: CTTCCTCAACCACCTGGCCCAGTACAGCGATGAGAA...GGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGATGGGAGC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR TCA 90 bp AGTCTTGTTCACCTCCTCTGTCTCAATGGTCTGTCGGTCCAGGCGGCTCTGGATACTCCTGGAGCTTCGTaGGGTAGAAGGTTTCGGTCT +
Preference number: 4 (lower is better)
Translates to: SLVHLLCLNGLSVQAALDTPGAS*GRRFRS
Trigger: AGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGT...ATCCAGAGCCGCCTGGACCGACAGACCATTGAGACAGAGGAGGTGAACAAGACT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp CTCGTCCCGCAGCTCCATTTCAACGCAGATCTCAGCCACCTCATCCCCATCATGGTGCACTTGAGTTTGTaGTCCATGAACTTGGCCTGC +
Preference number: 4 (lower is better)
Translates to: LVPQLHFNADLSHLIPIMVHLSL*SMNLAC
Trigger: GCAGGCCAAGTTCATGGAGCACAAACTCAAGTGCAC...CATGATGGGGATGAGGTGGCTGAGATCTGCGTTGAAATGGAGCTGCGGGACGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR GCA 90 bp ATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATCGGAAGATGCCTTCATaGTGCAGGCCATTGAGGTTG +
Preference number: 4 (lower is better)
Translates to: IGESTRGLYESPPSPARHRKMPS*CRPLRL
Trigger: CAACCTCAATGGCCTGCAGCATGAAGGCATCTTCCG...ATGCCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS-3UTR CCA 90 bp ATCGGGGAATCAACACGAGGTCTTTATGAATCGCCACCCAGCCCTGCCAGGCATTTTCTCTGTGTGTACTaGGTCCAAGACACCTCCTGC +
Preference number: 4 (lower is better)
Translates to: IGESTRGLYESPPSPARHFLCVY*VQDTSC
Trigger: GCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAA...ATGCCTGGCAGGGCTGGGTGGCGATTCATAAAGACCTCGTGTTGATTCCCCGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000393721.5
CDS GCA 90 bp CGGCGGGGCTCGCGGGTCCCAGCGGATCGTGAAGGCGCAGTCAGCTaGCGCCGCGCTCCGAAGCGACGCCGGGACGGCCGGGGCTGGGAC +
Preference number: 5 (lower is better)
Translates to: RRGSRVPADREGAVS*RRAPKRRRDGRGWD
Trigger: GTCCCAGCCCCGGCCGTCCCGGCGTCGCTTCGGAGCGCGGCGGCAGCTGACTGCGCCTTCACGATCCGCTGGGACCCGCGAGCCCCGCCG
79% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000494813.5
CDS CCA 90 bp CAGCCTGCAGCCCCCGCTCCCGCCGCAGCTTCCCGTGAGCGGCCATaGCGGCCTCGCGGCCGCGCCGTCGAACCCCACTGCTCCCACGCG +
Preference number: 5 (lower is better)
Translates to: QPAAPAPAAASRERP*RPRGRAVEPHCSHA
Trigger: CGCGTGGGAGCAGTGGGGTTCGACGGCGCGGCCGCGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCGGGAGCGGGGGCTGCAGGCTG
79% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
CDS-3UTR CAA 90 bp CCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGTGCTGGGCGGGGCCTTaGGGCTTCGGGGCCCAGGAC +
Preference number: 5 (lower is better)
Translates to: PAQAAAGRGLWASGPRTGCWAGP*GFGAQD
Trigger: GTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCA...CCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGG
77% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS TCA 90 bp GTCTCATACTCAGCCTGCAGCCCCCGCTCCCGCCGCAGCTTCCCGTaGGCGGCCATGGCGGCCTCGCGGCCGCGCCGTCGAACCCCACTG +
Preference number: 5 (lower is better)
Translates to: VSYSACSPRSRRSFP*AAMAASRPRRRTPL
Trigger: CAGTGGGGTTCGACGGCGCGGCCGCGAGGCCGCCATGGCCGCTCACGGGAAGCTGCGGCGGGAGCGGGGGCTGCAGGCTGAGTATGAGAC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 8 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000470209.5
ENST00000494302.5
CDS GCA 90 bp GGCCCGGCCAGCACCTCACTCAGGGCCGCGCTCTCCCGGCTCTGCTaGCGCGTGTGCTGCAGCAGCACCGCCCAGCAGTGCAAGGGCGAC +
Preference number: 5 (lower is better)
Translates to: GPASTSLRAALSRLC*RVCCSSTAQQCKGD
Trigger: GTCGCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGCGGCCCTGAGTGAGGTGCTGGCCGGGCC
74% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp AGGGGCCCGGCCAGCACCTCACTCAGGGCCGCGCTCTCCCGGCTCTaGTGCCGCGTGTGCTGCAGCAGCACCGCCCAGCAGTGCAAGGGC +
Preference number: 5 (lower is better)
Translates to: RGPASTSLRAALSRL*CRVCCSSTAQQCKG
Trigger: GCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGCGGCCCTGAGTGAGGTGCTGGCCGGGCCCCT
74% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGCCCAGGCCCTGCACTaGGGAGGCTTGGGTGCGGCT +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHAQALH*GGLGAA
Trigger: AGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS GCA 90 bp GCTGCCAGCGCATCTCTCGCCGCGGGCTTGCGAACCGGAAGACACTaGCGCCAGGCGCGGGGCGGGACAGGACTCCGCCTCCGGCCCATA +
Preference number: 5 (lower is better)
Translates to: AASASLAAGLRTGRH*RQARGGTGLRLRPI
Trigger: TATGGGCCGGAGGCGGAGTCCTGTCCCGCCCCGCGCCTGGCGGCAGTGTCTTCCGGTTCGCAAGCCCGCGGCGAGAGATGCGCTGGCAGC
73% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000442262.5
CDS CCA 90 bp GGGAGCTCTTGCGGAGGGGCCCTGCCTCAGTGGCACCAGCGGTGGTaGTGGGGACACTCCGGCCTGCCCGCTTCTCCTCCTGCCGCTCGG +
Preference number: 5 (lower is better)
Translates to: GSSCGGALPQWHQRW*WGHSGLPASPPAAR
Trigger: CCGAGCGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAGAGCTCCC
73% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 10 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000418750.5
ENST00000420383.5
ENST00000460782.1
ENST00000461052.5
ENST00000488269.5
ENST00000494813.5
CDS-3UTR CAA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTCGGCCTCCCGGAGCTaGGCCTCGGCATTCACGCTC +
Preference number: 5 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRSASRS*ASAFTL
Trigger: GAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCGA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS TCA 90 bp CGGATGTTCATAACGGCGGCGGGGCTCGCGGGTCCCAGCGGATCGTaGAGGCGCAGTCAGCTGCCGCCGCGCTCCGAAGCGACGCCGGGA +
Preference number: 5 (lower is better)
Translates to: RMFITAAGLAGPSGS*RRSQLPPRSEATPG
Trigger: TCCCGGCGTCGCTTCGGAGCGCGGCGGCAGCTGACTGCGCCTTCACGATCCGCTGGGACCCGCGAGCCCCGCCGCCGTTATGAACATCCG
72% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000494813.5
CDS GCA 90 bp ACCTCACTCAGGGCCGCGCTCTCCCGGCTCTGCTGCCGCGTGTGCTaGAGCAGCACCGCCCAGCAGTGCAAGGGCGACAGGAGGGACGGC +
Preference number: 5 (lower is better)
Translates to: TSLRAALSRLCCRVC*SSTAQQCKGDRRDG
Trigger: GCCGTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGCGGCCCTGAGTGAGGT
72% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp CCAGCGGTGGTGGTGGGGACACTCCGGCCTGCCCGCTTCTCCTCCTaGCGCTCGGCCTCCCGGAGCTTGGCCTCGGCATTCACGCTCTCC +
Preference number: 5 (lower is better)
Translates to: PAVVVGTLRPARFSS*RSASRSLASAFTLS
Trigger: GGAGAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCGAGCGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCCACCACCACCGCTGG
72% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000418750.5
ENST00000420383.5
ENST00000460782.1
ENST00000461052.5
ENST00000488269.5
ENST00000494813.5
CDS CCA 90 bp AGCTCTTGCGGAGGGGCCCTGCCTCAGTGGCACCAGCGGTGGTGGTaGGGACACTCCGGCCTGCCCGCTTCTCCTCCTGCCGCTCGGCCT +
Preference number: 5 (lower is better)
Translates to: SSCGGALPQWHQRWW*GHSGLPASPPAARP
Trigger: AGGCCGAGCGGCAGGAGGAGAAGCGGGCAGGCCGGAGTGTCCCCACCACCACCGCTGGTGCCACTGAGGCAGGGCCCCTCCGCAAGAGCT
72% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 10 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000418750.5
ENST00000420383.5
ENST00000460782.1
ENST00000461052.5
ENST00000488269.5
ENST00000494813.5
CDS-3UTR CAA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCTCCTTCCGGAAGCTTaGGTGCTCCCGGCTGCTCCC +
Preference number: 5 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQLLPEA*VLPAAP
Trigger: GGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGAG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACTGCACTTGGGAGGCTaGGGTGCGGCTCTCAGCGGC +
Preference number: 5 (lower is better)
Translates to: LGRVAGPAGSRRGHASPALHLGG*GAALSG
Trigger: GCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCAG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
72% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS GCA 90 bp TCCAGCTCCACCTCAGCGCGGCGCCGCATGAACTCTGCCAGCTCCTaGAGCAACTCCCGCCGCAGCTCGCCCTGCAGCTCCAGGCAGCGC +
Preference number: 5 (lower is better)
Translates to: SSSTSARRRMNSASS*SNSRRSSPCSSRQR
Trigger: GCGCTGCCTGGAGCTGCAGGGCGAGCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTGAGGTGGAGCTGGA
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp GCGACAGGAGGGACGGCTCCTTCCGGAAGCTTTGGTGCTCCCGGCTaGTCCCCAGGCGGCCTCCACGGCTGGAGAAGCGCTCGGCCAGCT +
Preference number: 5 (lower is better)
Translates to: ATGGTAPSGSFGAPG*SPGGLHGWRSARPA
Trigger: AGCTGGCCGAGCGCTTCTCCAGCCGTGGAGGCCGCCTGGGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGAGCCGTCCCTCCTGTCGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp AGCACCTCACTCAGGGCCGCGCTCTCCCGGCTCTGCTGCCGCGTGTaGTGCAGCAGCACCGCCCAGCAGTGCAAGGGCGACAGGAGGGAC +
Preference number: 5 (lower is better)
Translates to: STSLRAALSRLCCRV*CSSTAQQCKGDRRD
Trigger: GTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAGCCGGGAGAGCGCGGCCCTGAGTGAGGTGCT
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp AGCAACTCCCGCCGCAGCTCGCCCTGCAGCTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGCATCTCTCGCCGCGGGCTTGCGAAC +
Preference number: 5 (lower is better)
Translates to: SNSRRSSPCSSRQRS*SLSCQRISRRGLAN
Trigger: GTTCGCAAGCCCGCGGCGAGAGATGCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGAGCTGCAGGGCGAGCTGCGGCGGGAGTTGCT
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000442262.5
ENST00000470979.1
CDS GCA 90 bp GAGGCCCTCGGGACTGCTCCCAGACTCCCCTGCAGTCTGCAGCCCTaGGCCCACCACCTGCTTCTCCGTCCTGCGGTGGGAAGGACCGGC +
Preference number: 5 (lower is better)
Translates to: EALGTAPRLPCSLQP*AHHLLLRPAVGRTG
Trigger: GCCGGTCCTTCCCACCGCAGGACGGAGAAGCAGGTGGTGGGCGCAGGGCTGCAGACTGCAGGGGAGTCTGGGAGCAGTCCCGAGGGCCTC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000466928.5
CDS-3UTR CAA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCACTCCTTCCGGAAGCTTaGGTGCTCCCGGCTGCTCCC +
Preference number: 5 (lower is better)
Translates to: LGRVAGPAGSRRGHASPALLPEA*VLPAAP
Trigger: GGGAGCAGCCGGGAGCACCAAAGCTTCCGGAAGGAG...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGAGATCCCTGCTCTTCTaGACCAGGCGCCCCACGTCC +
Preference number: 5 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQRSLLF*TRRPTS
Trigger: GGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATCT...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTATCGGCCTCCCGGAGCTaGGCCTCGGCATTCACGCTC +
Preference number: 5 (lower is better)
Translates to: RLLGGAFGLRGPGLGEVVSASRS*ASAFTL
Trigger: GAGCGTGAATGCCGAGGCCAAGCTCCGGGAGGCCGA...TACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCG
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTTCTTGAGGGAGCTCTaGCGGAGGGGCCCTGCCTCA +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHFLREL*RRGPAS
Trigger: TGAGGCAGGGCCCCTCCGCAAGAGCTCCCTCAAGAA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGAGCCTCCCTCCCTTCTaGAGGGAGCTCTTGCGGAGG +
Preference number: 5 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQSLPPF*RELLRR
Trigger: CCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGCT...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTCTGAGCTGGTGGACTaGAGGGACTCGGTGGAGGGG +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHSELVD*RDSVEG
Trigger: CCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTTCTGAGCTGGTGGACTaGAGGGACTCGGTGGAGGGG +
Preference number: 5 (lower is better)
Translates to: VAGPAGSRRGHASPAAAPSELVD*RDSVEG
Trigger: CCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGA...AGGTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCAC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTGCTTGGCCTGCAGCTaGGCGAGGATGCTCCGTCCA +
Preference number: 5 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRCLACS*ARMLRP
Trigger: TGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGCTTGGCCTGCAGCTaGGCGAGGATGCTCCGTCCA +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHCLACS*ARMLRP
Trigger: TGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGTGCAGCTTCTCGTGCTaGGCCTGCAGCTTGGCGAGG +
Preference number: 5 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRCSFSC*ACSLAR
Trigger: CCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCA...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGCAGCTTCTCGTGCTaGGCCTGCAGCTTGGCGAGG +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHCSFSC*ACSLAR
Trigger: CCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGGGCAGCGTGATATACTaGTGGGGGATGAGGCCCCGC +
Preference number: 5 (lower is better)
Translates to: GEWPVQRVAAGGTHLQQRGSVIY*WGMRPR
Trigger: GCGGGGCCTCATCCCCCACAAGTATATCACGCTGCC...CCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCC
71% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCAGGCACCCTGCACTaGCTGGACAGGGCTGGAGAG +
Preference number: 5 (lower is better)
Translates to: LGRVAGPAGSRRGHASPAAGTLH*LDRAGE
Trigger: CTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGC...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCCCAGGACTGGGAGAGGTGGTGCAGGCACCCTGCACTaGCTGGACAGGGCTGGAGAG +
Preference number: 5 (lower is better)
Translates to: AAAGRGLWASGPRTGRGGAGTLH*LDRAGE
Trigger: CTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGC...ACCACCTCTCCCAGTCCTGGGCCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS TCA 90 bp CCAGGCCCCGGGAGTATTCCAGCTCCACCTCAGCGCGGCGCCGCATaGACTCTGCCAGCTCCTGCAGCAACTCCCGCCGCAGCTCGCCCT +
Preference number: 5 (lower is better)
Translates to: PGPGSIPAPPQRGAA*TLPAPAATPAAARP
Trigger: AGGGCGAGCTGCGGCGGGAGTTGCTGCAGGAGCTGGCAGAGTTCATGCGGCGCCGCGCTGAGGTGGAGCTGGAATACTCCCGGGGCCTGG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp CGTCCTGCGGTGGGAAGGACCGGCCTGTTTCGAGTGCTCCTTCCCTaGACGGGGTCCAGGGCCAGCAGCTCCGCGCCAGCCAGGAGTGGT +
Preference number: 5 (lower is better)
Translates to: RPAVGRTGLFRVLLP*TGSRASSSAPARSG
Trigger: ACCACTCCTGGCTGGCGCGGAGCTGCTGGCCCTGGACCCCGTGCAGGGAAGGAGCACTCGAAACAGGCCGGTCCTTCCCACCGCAGGACG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000466928.5
CDS GCA 90 bp AGCAACTCCCGCCGCAGCTCGCCCTGCAGCTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGCATCTCATTCACAGCGGGGCCGCTG +
Preference number: 5 (lower is better)
Translates to: SNSRRSSPCSSRQRS*SLSCQRISFTAGPL
Trigger: CAGCGGCCCCGCTGTGAATGAGATGCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGAGCTGCAGGGCGAGCTGCGGCGGGAGTTGCT
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000461052.5
CDS-3UTR CAA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGATCCCTGCTCTTCTaGACCAGGCGCCCCACGTCC +
Preference number: 5 (lower is better)
Translates to: LGRVAGPAGSRRGHASPARSLLF*TRRPTS
Trigger: GGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATCT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAAGCCTCCCTCCCTTCTaGAGGGAGCTCTTGCGGAGG +
Preference number: 5 (lower is better)
Translates to: LGRVAGPAGSRRGHASPASLPPF*RELLRR
Trigger: CCTCCGCAAGAGCTCCCTCAAGAAGGGAGGGAGGCT...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGCTGCACTTGGGAGGCTaGGGTGCGGCTCTCAGCGGC +
Preference number: 5 (lower is better)
Translates to: EAFVPAQAAAGRGLWASGLHLGG*GAALSG
Trigger: GCCGCTGAGAGCCGCACCCAAGCCTCCCAAGTGCAG...CCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACGCCTGGTACGTCTTCTaGGCCTGCAGGGAGACCCAA +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHAWYVF*ACRETQ
Trigger: TTGGGTCTCCCTGCAGGCCAAGAAGACGTACCAGGC...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
70% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS GCA 90 bp TCCCGGCTCTGCTGCCGCGTGTGCTGCAGCAGCACCGCCCAGCAGTaGAAGGGCGACAGGAGGGACGGCTCCTTCCGGAAGCTTTGGTGC +
Preference number: 5 (lower is better)
Translates to: SRLCCRVCCSSTAQQ*KGDRRDGSFRKLWC
Trigger: GCACCAAAGCTTCCGGAAGGAGCCGTCCCTCCTGTCGCCCTTGCACTGCTGGGCGGTGCTGCTGCAGCACACGCGGCAGCAGAGCCGGGA
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000393721.5
ENST00000404127.6
ENST00000420383.5
ENST00000422091.1
ENST00000442262.5
ENST00000461052.5
ENST00000470209.5
ENST00000470979.1
ENST00000488269.5
ENST00000494302.5
ENST00000494813.5
CDS GCA 90 bp AGCAACTCCCGCCGCAGCTCGCCCTGCAGCTCCAGGCAGCGCAGCTaGTCGCTCAGCTGCCAGCGCATCTCTCAGCAGCTGGCTGCCGTT +
Preference number: 5 (lower is better)
Translates to: SNSRRSSPCSSRQRS*SLSCQRISQQLAAV
Trigger: AACGGCAGCCAGCTGCTGAGAGATGCGCTGGCAGCTGAGCGAGCAGCTGCGCTGCCTGGAGCTGCAGGGCGAGCTGCGGCGGGAGTTGCT
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000422091.1
CDS GCA 90 bp CGCCAGGCACTGGAAGCTCTTCTTGACCAGGCGCCCCACGTCCTCTaGAATGTGACTCAGGCGCTGGGCCAGGGGCCCGGCCAGCACCTC +
Preference number: 5 (lower is better)
Translates to: RQALEALLDQAPHVL*NVTQALGQGPGQHL
Trigger: GAGGTGCTGGCCGGGCCCCTGGCCCAGCGCCTGAGTCACATTGCAGAGGACGTGGGGCGCCTGGTCAAGAAGAGCTTCCAGTGCCTGGCG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000470979.1
CDS GCA 90 bp CTCGGCAGCACCAAGGGTGTACCCCAGGCAGCTGGCGGAAGGCGGTaGCATGCACTTCTCGTAGACGGGGCCAGGCAGCGAGGTCAGGGG +
Preference number: 5 (lower is better)
Translates to: LGSTKGVPQAAGGRR*HALLVDGARQRGQG
Trigger: CCCCTGACCTCGCTGCCTGGCCCCGTCTACGAGAAGTGCATGGCACCGCCTTCCGCCAGCTGCCTGGGGTACACCCTTGGTGCTGCCGAG
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000461739.1
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACTGCACCTCGAGAACCTaGGCTTTGTCCCCTGGAGGA +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHCTSRT*ALSPGG
Trigger: TCCTCCAGGGGACAAAGCCAAGGTTCTCGAGGTGCA...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CTCCGTCCCGGCGGGCAGCGTGATATACTTGTGGGGGATGAGGCCCCGCATGCCCCCCGGGAGAAGCCTTaGTTCCTGCCCAGGCGGCTG +
Preference number: 5 (lower is better)
Translates to: LRPGGQRDILVGDEAPHAPREKP*FLPRRL
Trigger: CAGCCGCCTGGGCAGGAACAAAGGCTTCTCCCGGGG...GGCATGCGGGGCCTCATCCCCCACAAGTATATCACGCTGCCCGCCGGGACGGAG
69% GC, longest homopolymer 6 nt, total homopolymer stretches 15 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CGTGAGGTAGAAGGTTTCGGTCTCCTGCTGCTGGCCGCGCCTCCGGCCCGCCTGGCACCTCAGTGTGGCTaGGGGGTCGTGTCTAGGCCC +
Preference number: 5 (lower is better)
Translates to: REVEGFGLLLLAAPPARLAPQCG*GVVSRP
Trigger: GGGCCTAGACACGACCCCCAAGCCACACTGAGGTGC...CAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000404127.6
CDS-3UTR CAA 90 bp GAAGCCTTTGTTCCTGCCCAGGCGGCTGCTGGGCGGGGCCTTTGGGCTTCGGGGAGATCCCTGCTCTTCTaGACCAGGCGCCCCACGTCC +
Preference number: 5 (lower is better)
Translates to: EAFVPAQAAAGRGLWASGRSLLF*TRRPTS
Trigger: GGACGTGGGGCGCCTGGTCAAGAAGAGCAGGGATCT...CCCCGAAGCCCAAAGGCCCCGCCCAGCAGCCGCCTGGGCAGGAACAAAGGCTTC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp CTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCATTGTGCTCCATGAACTaGGCCTGCCGCTTCTCCACC +
Preference number: 5 (lower is better)
Translates to: LGRVAGPAGSRRGHASPALCSMN*ACRFST
Trigger: GGTGGAGAAGCGGCAGGCCAAGTTCATGGAGCACAA...TGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCAGCGGCACCTAAGCAGGTACTCGTaGCGCGCCTTTGTGCACTTG +
Preference number: 5 (lower is better)
Translates to: EWPVQRVAAGGTHLQQRHLSRYS*RAFVHL
Trigger: CAAGTGCACAAAGGCGCGCAACGAGTACCTGCTTAG...GTGCCGCTGCTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GGCTGGGGAGAGTGGCCGGTCCAGCGGGTAGCCGCCGGGGGCACGCATCTCCAGCTAAGCAGGTACTCGTaGCGCGCCTTTGTGCACTTG +
Preference number: 5 (lower is better)
Translates to: GWGEWPVQRVAAGGTHLQLSRYS*RAFVHL
Trigger: CAAGTGCACAAAGGCGCGCAACGAGTACCTGCTTAG...CTGGAGATGCGTGCCCCCGGCGGCTACCCGCTGGACCGGCCACTCTCCCCAGCC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp GCCCCATCCCACCTCTCTGCACAGGGTGAAGTGCAGGCACCCTGCACTTGCTGGGCCCAGGCCCTGCACTaGGGAGGCTTGGGTGCGGCT +
Preference number: 5 (lower is better)
Translates to: APSHLSAQGEVQAPCTCWAQALH*GGLGAA
Trigger: AGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGC...CCAGCAAGTGCAGGGTGCCTGCACTTCACCCTGTGCAGAGAGGTGGGATGGGGC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7
ENST00000404127.6
ENST00000420383.5
CDS-3UTR CAA 90 bp AGTGCAGGCACCCTGCACTTGCTGGACAGGGCTGGAGAGAAGCAAGGGGGCTGGGCCCAGGCCCTGCACTaGGGAGGCTTGGGTGCGGCT +
Preference number: 5 (lower is better)
Translates to: SAGTLHLLDRAGEKQGGWAQALH*GGLGAA
Trigger: AGCCGCACCCAAGCCTCCCAAGTGCAGGGCCTGGGC...CCAGCCCCCTTGCTTCTCTCCAGCCCTGTCCAGCAAGTGCAGGGTGCCTGCACT
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000350060.10
ENST00000370016.5
ENST00000370028.7