RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ADSL (Homo sapiens)

Ensembl gene IDs: ENSG00000239900

Ensembl transcript IDs: ENST00000216194.11, ENST00000342312.9, ENST00000423176.6, ENST00000466863.1, ENST00000477111.2, ENST00000480775.3, ENST00000498234.2, ENST00000623063.3, ENST00000623287.4, ENST00000623387.1, ENST00000623632.4, ENST00000623978.3, ENST00000624027.1, ENST00000624474.1, ENST00000624503.1, ENST00000625194.4, ENST00000636124.1, ENST00000636265.1, ENST00000636433.1, ENST00000636714.1, ENST00000637666.2, ENST00000637669.1, ENST00000638161.1, ENST00000674592.1, ENST00000675622.1, ENST00000679609.1, ENST00000679656.1, ENST00000679723.1, ENST00000679845.1, ENST00000679904.1, ENST00000680378.1, ENST00000680444.1, ENST00000680978.1, ENST00000681003.1, ENST00000681159.1

Found 1093 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR CCA 90 bp TGGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGC +
Preference number: 1 (lower is better)
Translates to: WTDAVCSGSMTRVIR*RARLQQRSERMGFR
Trigger: GCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 90 bp GTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTG +
Preference number: 1 (lower is better)
Translates to: VCVQTTGQMLSVAGP*QGSSGGGQDCSNVL
Trigger: CAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACAC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CCA 90 bp GCCACTGACCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCAGG +
Preference number: 1 (lower is better)
Translates to: ATDRLALSSSVRSNH*TDAVCSGSMTRVIR
Trigger: CCTGATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR CCA 90 bp GGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATaGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTT +
Preference number: 1 (lower is better)
Translates to: GSSGGGQDCSNVLNA*DSAYMASHLSQSAV
Trigger: AACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CCA 90 bp CAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCAGG +
Preference number: 1 (lower is better)
Translates to: QIRRLALSSSVRSNH*TDAVCSGSMTRVIR
Trigger: CCTGATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 90 bp TCGGCCAAACAGATCCGTTTGGTGTATGTGATGTCCCTGTGCCACTaGCCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGAC +
Preference number: 1 (lower is better)
Translates to: SAKQIRLVYVMSLCH*PVGTIIQCAFKPLD
Trigger: GTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGGGACATCACATACACCAAACGGATCTGTTTGGCCGA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR TCA 90 bp CACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTATGTCGGTGCAAATCTGGGGGAGGT +
Preference number: 1 (lower is better)
Translates to: HLSQSAVFQRVPPSP*GLPGGVCRCKSGGG
Trigger: ACCTCCCCCAGATTTGCACCGACATACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
3UTR CCA 90 bp ACAGATCCGTTTGGTGTATGTGATGTCCCTGTGCCACTGACCGGTTaGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTG +
Preference number: 1 (lower is better)
Translates to: TDPFGVCDVPVPLTG*HYHPVCVQTTGQML
Trigger: CAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGGGACATCACATACACCAAACGGATCTGT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR GCA 90 bp CTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCTGATTTTCTCATGGCAATCCTGGCG +
Preference number: 1 (lower is better)
Translates to: LYEVIVTPFLLNHRS*LLRKHSDFLMAILA
Trigger: CGCCAGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 90 bp CACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTATGTCGGTGCAAATCTTGTGCACTG +
Preference number: 1 (lower is better)
Translates to: HLSQSAVFQRVPPSP*GLPGGVCRCKSCAL
Trigger: CAGTGCACAAGATTTGCACCGACATACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000623287.4
3UTR GCA 90 bp GCTCAGTGTGTCTCTTGGGGCAACACACAATCAAGTCACTCTTCCTaGACCTGGCAATATTTGAAGTGCCGAGGAGTTTTCTTCTGTATA +
Preference number: 1 (lower is better)
Translates to: AQCVSWGNTQSSHSS*TWQYLKCRGVFFCI
Trigger: TATACAGAAGAAAACTCCTCGGCACTTCAAATATTGCCAGGTGCAGGAAGAGTGACTTGATTGTGTGTTGCCCCAAGAGACACACTGAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR GCA 90 bp GACCAATCCTTCAGAAATGTTCTGCAGCGTATTCAATATAGTATCTaGGGTAAGAAATGCCTCGGCCAAACAGATCCGTCGGTTGGCACT +
Preference number: 1 (lower is better)
Translates to: DQSFRNVLQRIQYSI*GKKCLGQTDPSVGT
Trigger: AGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTCTGAAGGATTGGTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 90 bp AGAAATGTTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGT +
Preference number: 1 (lower is better)
Translates to: RNVLQRIQYSICGKK*LGQTDPSVGTIIQC
Trigger: ACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 90 bp AGAAATGTTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCGTTTGGTGTATGTGATGTCCCTGTG +
Preference number: 1 (lower is better)
Translates to: RNVLQRIQYSICGKK*LGQTDPFGVCDVPV
Trigger: CACAGGGACATCACATACACCAAACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR GCA 90 bp CGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCC +
Preference number: 1 (lower is better)
Translates to: RSITLGYTTNPSEMF*SVFNIVSAVRNASA
Trigger: GGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 90 bp GACCAATCCTTCAGAAATGTTCTGCAGCGTATTCAATATAGTATCTaGGGTAAGAAATGCCTCGGCCAAACAGATCCGTTTGGTGTATGT +
Preference number: 1 (lower is better)
Translates to: DQSFRNVLQRIQYSI*GKKCLGQTDPFGVC
Trigger: ACATACACCAAACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTCTGAAGGATTGGTC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR GCA 90 bp GCCAGCACAGACAGTACTTCAATATCCACTTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTC +
Preference number: 1 (lower is better)
Translates to: ASTDSTSISTFRVYV*PVMMKALLNPAFSV
Trigger: GACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCACAGGGCAGACATATACACGAAAAGTGGATATTGAAGTACTGTCTGTGCTGGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR TCA 90 bp GCCAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATaGCACAGACAACGTTCTTGTCCAATGGCACTTGCTTACACTGTA +
Preference number: 1 (lower is better)
Translates to: AKYLMCSCYWKYNKE*HRQRSCPMALAYTV
Trigger: TACAGTGTAAGCAAGTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTGGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR TCA 90 bp ATATACAGTATTATAGAGTATATATGCTATTATACTCTGTGGCAGTaGGTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCAT +
Preference number: 1 (lower is better)
Translates to: IYSIIEYICYYTLWQ*VDGGIRRKPEGKIH
Trigger: ATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTACTCACTGCCACAGAGTATAATAGCATATATACTCTATAATACTGTATAT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
3UTR-3UTR GCA 90 bp ACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCACCTGCTGGGAGGCACGACGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 2 (lower is better)
Translates to: TGDTPPLLRISAPAGRHDGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GTCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp CCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 2 (lower is better)
Translates to: PSVGTIIQCAFKPLDRCCSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...ACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CGTTCAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 2 (lower is better)
Translates to: RSNHWTDAVCSGSMTRVIGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp AGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 2 (lower is better)
Translates to: RWRARLQQRSERMGFRLYVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...ATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 2 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000623287.4
3UTR-3UTR GCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 2 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000623287.4
3UTR-3UTR GCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 2 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000623287.4
3UTR-3UTR TCA 90 bp ACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGAGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 2 (lower is better)
Translates to: TDPSVGTIIQCAFKPLDRVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...TCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 2 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GTTCTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGAGGCGTATGTCGGTaGAAATCTGGGGGAGGTAGG +
Preference number: 2 (lower is better)
Translates to: VLCGHERQLLPNAPFNYFGGVCR*KSGGGR
Trigger: CCTACCTCCCCCAGATTTGCACCGACATACGCCTCC...AAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAAC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 2 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GTTCTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 2 (lower is better)
Translates to: VLCGHERQLLPNAPFNYFGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...AAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CTGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 2 (lower is better)
Translates to: LDTLYEVIVTPFLLNHRSKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...GCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCAG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAGGAGGCGTATGTCGGTaGAAATCTGGGGGAGGTAGG +
Preference number: 2 (lower is better)
Translates to: RMGFRLYGIALEPICCFSGGVCR*KSGGGR
Trigger: CCTACCTCCCCCAGATTTGCACCGACATACGCCTCC...TGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp TGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTAGCGCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 2 (lower is better)
Translates to: WHYHPVCVQTTGQMLSVAHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...CGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp ATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 2 (lower is better)
Translates to: MKGSSCRMRRSITLGYTTGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...GGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR GCA 90 bp TTTCCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAACCAGGAGGCGGAGCTTaGAGTGAGCCGTGCCACTGC +
Preference number: 2 (lower is better)
Translates to: FPSKKTVLLPLSDSPVTQPGGGA*SEPCHC
Trigger: GCAGTGGCACGGCTCACTGCAAGCTCCGCCTCCTGG...TTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGGAAA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
3UTR-3UTR GCA 90 bp TGCGGTAAGAAATGCCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 2 (lower is better)
Translates to: CGKKCLGQTDPSVGTIIQHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...CTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp TGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTAGCGCTCCCAAAGAGCTCCTaGAGAGTATCTTACTCCGAC +
Preference number: 2 (lower is better)
Translates to: WHYHPVCVQTTGQMLSVALPKSS*RVSYSD
Trigger: GTCGGAGTAAGATACTCTGCAGGAGCTCTTTGGGAG...CGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679609.1
3UTR-3UTR CCA 90 bp CTGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 2 (lower is better)
Translates to: LDTLYEVIVTPFLLNHRSVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...GCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCAG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp CGTTCAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 2 (lower is better)
Translates to: RSNHWTDAVCSGSMTRVISCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...GATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR CCA 90 bp CTGATTTTCTCATGGCAATCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 2 (lower is better)
Translates to: LIFSWQSWRLPPALTMAMSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...CATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAAAATCAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR GCA 90 bp CGTTCAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 2 (lower is better)
Translates to: RSNHWTDAVCSGSMTRVIALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...GATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 2 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 2 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp CCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: PRPNRSVGWHYHPVCVQTKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...GGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTATCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 2 (lower is better)
Translates to: SPSSRFHMVLTGDTPPLLSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...TAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp AATCTCTGCACCTGCTGGGAGGCACGACCAGTGAAAGAAGAAGGATCCAGTAAACACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 2 (lower is better)
Translates to: NLCTCWEARPVKEEGSSKHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...TTTACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCCAGCAGGTGCAGAGATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 2 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAGGAAGTCGGGCGCAGTaGCAGAAGCTGGAAGACTGC +
Preference number: 2 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLGSRAQ*QKLEDC
Trigger: GCAGTCTTCCAGCTTCTGCCACTGCGCCCGACTTCC...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp CGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGCAGCAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 2 (lower is better)
Translates to: RRSITLGYTTNPSEMFCSNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...GCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CAA 90 bp TTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATaGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCT +
Preference number: 2 (lower is better)
Translates to: LALQFISIPQTGYPK*NVMPRVRSSKPLVA
Trigger: AGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
3UTR-3UTR TCA 90 bp GCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 2 (lower is better)
Translates to: AFTFITLSYGFNRGYTSSTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...AGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 2 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp GTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTGTCAAGCTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 2 (lower is better)
Translates to: VMMKALLNPAFSVTILSSCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...GCTTGACAAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
3UTR-3UTR GCA 90 bp TTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 2 (lower is better)
Translates to: FCSVFNIVSAVRNASAKQHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...CTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGAGCTCTCTTAAATCCTaGCTTTTCTGTCACCATCTT +
Preference number: 2 (lower is better)
Translates to: LCGHERQLLPNAPFNYFGSSLKS*LFCHHL
Trigger: AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCT...CCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR TCA 90 bp ATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: IRRLALSSSVRSNHWTDAKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...AGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp CGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCAACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 2 (lower is better)
Translates to: RFHMVLTGDTPPLLRISATAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...TGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 2 (lower is better)
Translates to: STSTLFVFALLRNVRLRNSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCATGTCCCTGTGCCACTaGCCGGTTGGCACTATCATC +
Preference number: 2 (lower is better)
Translates to: SSRFHMVLTGDTPPLLRIMSLCH*PVGTII
Trigger: GATGATAGTGCCAACCGGTCAGTGGCACAGGGACAT...GATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR-3UTR TCA 90 bp TCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 2 (lower is better)
Translates to: SPSSRFHMVLTGDTPPLLGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...TAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TGTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTGTCAAGTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 2 (lower is better)
Translates to: CDDESSLKSCLFCHHLVKCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...CTTGACAAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCACA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
3UTR-3UTR GCA 90 bp CGTTCAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 2 (lower is better)
Translates to: RSNHWTDAVCSGSMTRVINALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...GATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 2 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHNALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTTTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 2 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAATGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 2 (lower is better)
Translates to: VNFNALCFCLVEKCETEKCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR TCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGATGGGCGGATCACTTaGGGTCAGGAGTTCAAGACC +
Preference number: 2 (lower is better)
Translates to: STSTLFVFALLRNVRLRNDGRIT*GQEFKT
Trigger: GGTCTTGAACTCCTGACCTCAAGTGATCCGCCCATC...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp CAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATGACACAGACACTGAGAGGCGGAGGTTaGAGTGAGCCAAGATTGTGC +
Preference number: 2 (lower is better)
Translates to: QVSDVLLLLEIQQGMTQTLRGGG*SEPRLC
Trigger: GCACAATCTTGGCTCACTGCAACCTCCGCCTCTCAG...TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp CGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 2 (lower is better)
Translates to: RMRRSITLGYTTNPSEMFNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...GAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp AGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGAACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 2 (lower is better)
Translates to: RHNSAFTFITLSYGFNRGTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...TCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp ATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCAACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 2 (lower is better)
Translates to: ILFQLYRHNSAFTFITLSTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...TGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGATGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 2 (lower is better)
Translates to: CLERTEIKYELHLLCKSRWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR CCA 90 bp CTGCCCTGTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 2 (lower is better)
Translates to: LPCDDESSLKSCLFCHHLSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCACAGGGCAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
3UTR-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAAAAATTAGCCAGGCATaGCGGCAGGCGCCTGTAATC +
Preference number: 2 (lower is better)
Translates to: RAESTSTLFVFALLRNVRKISQA*RQAPVI
Trigger: GATTACAGGCGCCTGCCGCCATGCCTGGCTAATTTT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAATAATCCCAGAACTTTaGGAGGCTGAGATGGGCGGA +
Preference number: 2 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGIIPEL*EAEMGG
Trigger: TCCGCCCATCTCAGCCTCCCAAAGTTCTGGGATTAT...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp CGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCAAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 2 (lower is better)
Translates to: RFHMVLTGDTPPLLRISANRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...TGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp AATCTCTGCACCTGCTGGGAGGCACGACCAGTGAAAGAAGAAGGATCCAGTAAACTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 2 (lower is better)
Translates to: NLCTCWEARPVKEEGSSKLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...TTTACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCCAGCAGGTGCAGAGATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 2 (lower is better)
Translates to: SSNSTDIILLSPSSRFHMGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...CATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGATGGGCGGATCACTTaGGGTCAGGAGTTCAAGACC +
Preference number: 2 (lower is better)
Translates to: SSMNYIYYARAESTSTLFDGRIT*GQEFKT
Trigger: GGTCTTGAACTCCTGACCTCAAGTGATCCGCCCATC...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp TCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 2 (lower is better)
Translates to: SSRFHMVLTGDTPPLLRIAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...GATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCGCCAAGTATCTGATGTaGTCTTGCTATTGGAAATAC +
Preference number: 2 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLAKYLM*SCYWKY
Trigger: GTATTTCCAATAGCAAGAGCACATCAGATACTTGGC...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp CGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCATTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 2 (lower is better)
Translates to: RMGFRLYGIALEPICCFSFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...TGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR CCA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCGTCTTCTCTCAGTTCTaGTGCATACTGAGTTTAAGA +
Preference number: 2 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLVFSQF*CILSLR
Trigger: TCTTAAACTCAGTATGCACCAGAACTGAGAGAAGAC...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
3UTR-3UTR CCA 90 bp TACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 2 (lower is better)
Translates to: YRHNSAFTFITLSYGFNRTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...CCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CAA 90 bp GCTGGAAGACTGCCTAGTTGCCAAGTATCTGATGTGCTCTTGCTATaGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAAT +
Preference number: 2 (lower is better)
Translates to: AGRLPSCQVSDVLLL*EIQQGMTQTTFLSN
Trigger: ATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTGGCAACTAGGCAGTCTTCCAGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 2 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTAGCCTTATCAAAAGATaGAATGAGCTTGGGCACAAC +
Preference number: 2 (lower is better)
Translates to: TTRSFWRLALQFISIPQTSLIKR*NELGHN
Trigger: GTTGTGCCCAAGCTCATTTCATCTTTTGATAAGGCT...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 2 (lower is better)
Translates to: VNFNALCFCLVEKCETEKICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp TACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 2 (lower is better)
Translates to: YRHNSAFTFITLSYGFNRGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...CCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR GCA 90 bp GCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTACCATCTTGTCAAGCTaGTCTACCTTATGGTCATCT +
Preference number: 2 (lower is better)
Translates to: AFTFITLSYGFNRGYTSSTILSS*STLWSS
Trigger: AGATGACCATAAGGTAGAGCAGCTTGACAAGATGGT...AGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR CCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTATGGCTTTTTGGGCACTaGACAACCATTAACACCTCC +
Preference number: 2 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLWLFGH*TTINTS
Trigger: GGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCA...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
3UTR-3UTR CCA 90 bp AGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGAGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 2 (lower is better)
Translates to: RHNSAFTFITLSYGFNRGVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...TCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp CTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 2 (lower is better)
Translates to: LFQLYRHNSAFTFITLSYVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...ATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp GCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAACTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 2 (lower is better)
Translates to: AWDSAYMASHLSQSAVFQLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...TTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTCTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 2 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 2 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFNALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 2 (lower is better)
Translates to: RLILFQLYRHNSAFTFITHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 2 (lower is better)
Translates to: EIKYELHLLCKSRVNFNAMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGATCAGCTATAAATCCATaGAACAAGGAAGTCGGGCGC +
Preference number: 2 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGSAINP*NKEVGR
Trigger: GCGCCCGACTTCCTTGTTGCATGGATTTATAGCTGA...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp GTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGATCCGTTTGAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 2 (lower is better)
Translates to: VFNIVSAVRNASAKQIRLNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...CAAACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATAC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR-3UTR CCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 2 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CAA 90 bp AATTCTCACATTACAGATAAACTGATAGTAGTTGCTGCCTCCAAGTaGCCCATAGCAGAGAAGGAAGTAGACAGAATATCTGGTCAGAGT +
Preference number: 2 (lower is better)
Translates to: NSHITDKLIVVAASK*PIAEKEVDRISGQS
Trigger: ACTCTGACCAGATATTCTGTCTACTTCCTTCTCTGCTATGGGCAACTTGGAGGCAGCAACTACTATCAGTTTATCTGTAATGTGAGAATT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 2 (lower is better)
Translates to: RLILFQLYRHNSAFTFITAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 2 (lower is better)
Translates to: STSTLFVFALLRNVRLRNALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTCAGAAGCTGGAAGACTaGCTAGTTGCCAAGTATCTG +
Preference number: 2 (lower is better)
Translates to: IKYELHLLCKSRVNFNALQKLED*LVAKYL
Trigger: CAGATACTTGGCAACTAGGCAGTCTTCCAGCTTCTG...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 2 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
3UTR-3UTR CCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 2 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 2 (lower is better)
Translates to: EIKYELHLLCKSRVNFNANVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGAACCACAAGATCTTTTTaGAGGTTGGCTCTCCAGTTC +
Preference number: 2 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGTTRSF*RLALQF
Trigger: GAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 2 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGEIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 2 (lower is better)
Translates to: EIKYELHLLCKSRVNFNANRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTGGCTTTTTGGGCACTaGACAACCATTAACACCTCC +
Preference number: 2 (lower is better)
Translates to: KEQRSSMNYIYYARAESTWLFGH*TTINTS
Trigger: GGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCA...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp CAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 2 (lower is better)
Translates to: QLYRHNSAFTFITLSYGFNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...AAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTG
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: STSTLFVFALLRNVRLRNKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
39% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 2 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEEIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
39% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAAATACAACAAGGAATaGCACAGACAACGTTCTTGT +
Preference number: 2 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLKYNKE*HRQRSC
Trigger: ACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTT...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 2 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRNALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
39% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 2 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 2 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGAGCCAAGTATCTGATGTaGTCTTGCTATTGGAAATAC +
Preference number: 2 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGAKYLM*SCYWKY
Trigger: GTATTTCCAATAGCAAGAGCACATCAGATACTTGGC...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 2 (lower is better)
Translates to: CLERTEIKYELHLLCKSRNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 2 (lower is better)
Translates to: IKYELHLLCKSRVNFNALNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR CAA 90 bp ACCAGGTCAAATCGCCAATCACTGGAGATCATTAGTCTAACAGAATaGTTAGGACAGGAACAAGACTGTTATTTCCTTATTTTCTATGAG +
Preference number: 2 (lower is better)
Translates to: TRSNRQSLEIISLTE*LGQEQDCYFLIFYE
Trigger: CTCATAGAAAATAAGGAAATAACAGTCTTGTTCCTGTCCTAACAATTCTGTTAGACTAATGATCTCCAGTGATTGGCGATTTGACCTGGT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 2 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACAATTAGCATTTCCCTaGTGTATAAGCCTTATCAAA +
Preference number: 2 (lower is better)
Translates to: RAESTSTLFVFALLRNVRQLAFP*CISLIK
Trigger: TTTGATAAGGCTTATACAGCAGGGAAATGCTAATTG...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTGTCTTCTCTCAGTTCTaGTGCATACTGAGTTTAAGA +
Preference number: 2 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLVFSQF*CILSLR
Trigger: TCTTAAACTCAGTATGCACCAGAACTGAGAGAAGAC...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR TCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 2 (lower is better)
Translates to: NNRNKRYLTIDSITESRLLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTCTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 2 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 2 (lower is better)
Translates to: NNRNKRYLTIDSITESRLEIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 2 (lower is better)
Translates to: SSMNYIYYARAESTSTLFEIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
37% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR TCA 90 bp TACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 2 (lower is better)
Translates to: YRHNSAFTFITLSYGFNREIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...CCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTA
37% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 2 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLNALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
37% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR GCA 90 bp CAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATGACACAGACACAATTAGCATTTCCCTaGTGTATAAGCCTTATCAAA +
Preference number: 2 (lower is better)
Translates to: QVSDVLLLLEIQQGMTQTQLAFP*CISLIK
Trigger: TTTGATAAGGCTTATACAGCAGGGAAATGCTAATTG...TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTG
37% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR GCA 90 bp TACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 2 (lower is better)
Translates to: YRHNSAFTFITLSYGFNRPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...CCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTA
36% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 72 bp CAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGCGGGCAAGACTGCAGC +
Preference number: 3 (lower is better)
Translates to: QTTGQMLSVAGP*QGSSGGGQDCS
Trigger: GCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 72 bp TGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGC +
Preference number: 3 (lower is better)
Translates to: WSSPSKSCRKLA*VPVVPFTPRKR
Trigger: GCGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
3UTR CCA 72 bp GCTGTCTGTAGCGGGTCCATGACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAACGTTCTGAACGCATG +
Preference number: 3 (lower is better)
Translates to: AVCSGSMTRVIR*RARLQQRSERM
Trigger: CATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACAGACAGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CCA 72 bp CAAGGGCTCGCTGTCACCCAGCCTGGACTAAACTCTTaGGCTCAAGTGACCCTATCGCCTCAGCTTCCCAAG +
Preference number: 3 (lower is better)
Translates to: QGLAVTQPGLNS*AQVTLSPQLPK
Trigger: CTTGGGAAGCTGAGGCGATAGGGTCACTTGAGCCCAAGAGTTTAGTCCAGGCTGGGTGACAGCGAGCCCTTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CAA 90 bp CCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTGGTTCCTCCATCTCCTaGAGGTTTGCCAGGAGGCGT +
Preference number: 3 (lower is better)
Translates to: PSVGTIIQCAFKPLDRCCGSSIS*RFARRR
Trigger: ACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAACC...ACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTGTGGCCCATGAAAGGCAGCTCTaGCCGAATGCGCCGTTCAAT +
Preference number: 3 (lower is better)
Translates to: SWRLPPALTMAMMMFSVAHERQL*PNAPFN
Trigger: ATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATG...GGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 72 bp GGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTTATATGGCATCGCACT +
Preference number: 3 (lower is better)
Translates to: GHQVAGKTAATF*THGIPLIWHRT
Trigger: AGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 72 bp CCTGTGCCACTGACCGGTTGGCACTATCATCCAGTGTaGGTTCAAACCACTGGACAGATGCTGTCTGTAGCG +
Preference number: 3 (lower is better)
Translates to: PVPLTGWHYHPV*VQTTGQMLSVA
Trigger: CGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR CCA 72 bp GGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATaGGATTCCGCTTATATGGCATCGCACTTGAGCCAA +
Preference number: 3 (lower is better)
Translates to: GGGQDCSNVLNA*DSAYMASHLSQ
Trigger: TTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACCGGCTACCTCCAGCTTaGACCATGGCCATGATGATG +
Preference number: 3 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHRLPPA*TMAMMM
Trigger: CATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCG...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAACTGTTCCCGAAGGACTaGTGCACTGATGCCCCCAAG +
Preference number: 3 (lower is better)
Translates to: ERQLLPNAPFNYFGVHDQLFPKD*CTDAPK
Trigger: CTTGGGGGCATCAGTGCACAAGTCCTTCGGGAACAG...TTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000679609.1
3UTR CCA 72 bp CGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGCGGGTCCATGACAAGG +
Preference number: 3 (lower is better)
Translates to: RLALSSSVRSNH*TDAVCSGSMTR
Trigger: CCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTGGTTCCTCCATCTCCTaGAGGTTTGCCAGGAGGCGT +
Preference number: 3 (lower is better)
Translates to: WIRSMRSLSPPSCLTTEAGSSIS*RFARRR
Trigger: ACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAACC...AGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACATGTCGGTGCAAATCTaGTGCACTGATGCCCCCAAG +
Preference number: 3 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHMSVQI*CTDAPK
Trigger: CTTGGGGGCATCAGTGCACAAGATTTGCACCGACAT...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000623287.4
3UTR GCA 72 bp CCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGTaGGTTCAAACCACTGGACAGATGCTGTCTGTAGCG +
Preference number: 3 (lower is better)
Translates to: PNRSVGWHYHPV*VQTTGQMLSVA
Trigger: CGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTACATGAAAGGCAGCTCTaGCCGAATGCGCCGTTCAAT +
Preference number: 3 (lower is better)
Translates to: GWHYHPVCVQTTGQMLSVHERQL*PNAPFN
Trigger: ATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATG...TACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAAAAACAGATCCGTCGGTaGGCACTATCATCCAGTGTG +
Preference number: 3 (lower is better)
Translates to: ERQLLPNAPFNYFGVHDQKQIRR*ALSSSV
Trigger: CACACTGGATGATAGTGCCAACCGACGGATCTGTTT...TTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR TCA 72 bp CAGATCCGTTTGGTGTATGTGATGTCCCTGTGCCACTaGCCGGTTGGCACTATCATCCAGTGTGCGTTCAAA +
Preference number: 3 (lower is better)
Translates to: QIRLVYVMSLCH*PVGTIIQCAFK
Trigger: TTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGGGACATCACATACACCAAACGGATCTG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR CCA 72 bp TTTGGTGTATGTGATGTCCCTGTGCCACTGACCGGTTaGCACTATCATCCAGTGTGCGTTCAAACCACTGGA +
Preference number: 3 (lower is better)
Translates to: FGVCDVPVPLTG*HYHPVCVQTTG
Trigger: TCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGGGACATCACATACACCAAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR GCA 72 bp ATGATGATGTTCTCTGTGGCCATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATTACTTTGGGGTACACG +
Preference number: 3 (lower is better)
Translates to: MMMFSVAMKGSS*RMRRSITLGYT
Trigger: CGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACATCATCAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 72 bp GTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCTGATTTTCTCATGGCA +
Preference number: 3 (lower is better)
Translates to: VIVTPFLLNHRS*LLRKHSDFLMA
Trigger: TGCCATGAGAAAATCAGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGAC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTGTGGCCAGGACCAGAAATTTCTaGCTACTTTACAAGCAAATG +
Preference number: 3 (lower is better)
Translates to: SWRLPPALTMAMMMFSVARTRNF*LLYKQM
Trigger: CATTTGCTTGTAAAGTAGCAAGAAATTTCTGGTCCT...GGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 72 bp GTCTCTTGGGGCAACACACAATCAAGTCACTCTTCCTaGACCTGGCAATATTTGAAGTGCCGAGGAGTTTTC +
Preference number: 3 (lower is better)
Translates to: VSWGNTQSSHSS*TWQYLKCRGVF
Trigger: GAAAACTCCTCGGCACTTCAAATATTGCCAGGTGCAGGAAGAGTGACTTGATTGTGTGTTGCCCCAAGAGAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR GCA 72 bp CTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCGTCGGTTGGCACTATC +
Preference number: 3 (lower is better)
Translates to: LQRIQYSICGKK*LGQTDPSVGTI
Trigger: GATAGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATGCCTCTGGTGGCTTTTaGGGCACTGGACAACCATTA +
Preference number: 3 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNASGGF*GTGQPL
Trigger: TAATGGTTGTCCAGTGCCCAAAAAGCCACCAGAGGC...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
3UTR-3UTR CAA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGGTTCCTCCATCTCCTaGAGGTTTGCCAGGAGGCGT +
Preference number: 3 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEGSSIS*RFARRR
Trigger: ACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAACC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAGGTTCCTCCATCTCCTaGAGGTTTGCCAGGAGGCGT +
Preference number: 3 (lower is better)
Translates to: RAESTSTLFVFALLRNVRGSSIS*RFARRR
Trigger: ACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAACC...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp CGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCACGGCTACCTCCAGCTTaGACCATGGCCATGATGATG +
Preference number: 3 (lower is better)
Translates to: RFHMVLTGDTPPLLRISARLPPA*TMAMMM
Trigger: CATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCG...TGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAGGCTGGAGAATCGCTaGAACCTGAGAGGCGGAGGT +
Preference number: 3 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRRLENR*NLRGGG
Trigger: ACCTCCGCCTCTCAGGTTCAAGCGATTCTCCAGCCT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CAA 90 bp GTTCTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTTATATGGCATCGCACTaGAGCCAATCTGCTGTTTTT +
Preference number: 3 (lower is better)
Translates to: VLCGHERQLLPNAPFNYFYMASH*SQSAVF
Trigger: AAAAACAGCAGATTGGCTCAAGTGCGATGCCATATA...AAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAAC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTATATATGGCATCGCACTaGAGCCAATCTGCTGTTTTT +
Preference number: 3 (lower is better)
Translates to: GWHYHPVCVQTTGQMLSVYMASH*SQSAVF
Trigger: AAAAACAGCAGATTGGCTCAAGTGCGATGCCATATA...TACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGGCCAAACAGATCCGTTaGGTGTATGTGATGTCCCTG +
Preference number: 3 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLAKQIR*VYVMSL
Trigger: CAGGGACATCACATACACCAAACGGATCTGTTTGGC...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR-3UTR CAA 90 bp TCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTACATGAAAGGCAGCTCTaGCCGAATGCGCCGTTCAAT +
Preference number: 3 (lower is better)
Translates to: SPSSRFHMVLTGDTPPLLHERQL*PNAPFN
Trigger: ATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATG...TAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCGCTCTATGAGGTCATaGTCACCCCCTTCCTGCTTA +
Preference number: 3 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLRSMRS*SPPSCL
Trigger: TAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCG...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR CCA 72 bp TGGGGCAACACACAATCAAGTCACTCTTCCTGCACCTaGCAATATTTGAAGTGCCGAGGAGTTTTCTTCTGT +
Preference number: 3 (lower is better)
Translates to: WGNTQSSHSSCT*QYLKCRGVFFC
Trigger: ACAGAAGAAAACTCCTCGGCACTTCAAATATTGCCAGGTGCAGGAAGAGTGACTTGATTGTGTGTTGCCCCA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CAA 90 bp GGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTACTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: GWHYHPVCVQTTGQMLSVLFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...TACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAGCCTCTGGTGGCTTTTaGGGCACTGGACAACCATTA +
Preference number: 3 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLASGGF*GTGQPL
Trigger: TAATGGTTGTCCAGTGCCCAAAAAGCCACCAGAGGC...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
3UTR-3UTR CAA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTCGCCGTTCAATTACTTaGGGGTACACGACCAATCCT +
Preference number: 3 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSRRSIT*GYTTNP
Trigger: AGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCG...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGCCTCTGGTGGCTTTTaGGGCACTGGACAACCATTA +
Preference number: 3 (lower is better)
Translates to: VNFNALCFCLVEKCETEKASGGF*GTGQPL
Trigger: TAATGGTTGTCCAGTGCCCAAAAAGCCACCAGAGGC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR GCA 72 bp CTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCGTTTGGTGTATGTGAT +
Preference number: 3 (lower is better)
Translates to: LQRIQYSICGKK*LGQTDPFGVCD
Trigger: ATCACATACACCAAACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
3UTR-3UTR CAA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGGACCAGAAATTTCTaGCTACTTTACAAGCAAATG +
Preference number: 3 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLRTRNF*LLYKQM
Trigger: CATTTGCTTGTAAAGTAGCAAGAAATTTCTGGTCCT...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR TCA 72 bp CTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATaGCACAGACAACGTTCTTGTCCAATGGCACTTGCT +
Preference number: 3 (lower is better)
Translates to: LMCSCYWKYNKE*HRQRSCPMALA
Trigger: AGCAAGTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CAA 90 bp GAAATGTTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCCTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: EMFCSVFNIVSAVRNASALFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...GGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp CCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGAAGGACCAGAAATTTCTaGCTACTTTACAAGCAAATG +
Preference number: 3 (lower is better)
Translates to: PPQDLFGGWLSSSSLFLRRTRNF*LLYKQM
Trigger: CATTTGCTTGTAAAGTAGCAAGAAATTTCTGGTCCT...TCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CAA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTTATATGGCATCGCACTaGAGCCAATCTGCTGTTTTT +
Preference number: 3 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSYMASH*SQSAVF
Trigger: AAAAACAGCAGATTGGCTCAAGTGCGATGCCATATA...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACACAGACAACGTTCTaGTCCAATGGCACTTGCTTA +
Preference number: 3 (lower is better)
Translates to: KSRVNFNALCFCLVEKCETQTTF*SNGTCL
Trigger: TAAGCAAGTGCCATTGGACAAGAACGTTGTCTGTGT...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR TCA 72 bp ATTATAGAGTATATATGCTATTATACTCTGTGGCAGTaGGTAGACGGAGGTATCAGAAGGAAACCTGAGGGC +
Preference number: 3 (lower is better)
Translates to: IIEYICYYTLWQ*VDGGIRRKPEG
Trigger: GCCCTCAGGTTTCCTTCTGATACCTCCGTCTACTCACTGCCACAGAGTATAATAGCATATATACTCTATAAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
3UTR-3UTR CAA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTTTTGTTTTTGCCTTGTaGAGAAATGTGAGACTGAGA +
Preference number: 3 (lower is better)
Translates to: TTRSFWRLALQFISIPQTFVFAL*RNVRLR
Trigger: TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAA...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR-3UTR CAA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGLFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGACTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRLFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATATATGGCATCGCACTaGAGCCAATCTGCTGTTTTT +
Preference number: 3 (lower is better)
Translates to: RHNSAFTFITLSYGFNRGYMASH*SQSAVF
Trigger: AAAAACAGCAGATTGGCTCAAGTGCGATGCCATATA...TCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR GCA 72 bp ACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTATCTGCGGTAAGAAAT +
Preference number: 3 (lower is better)
Translates to: TLGYTTNPSEMF*SVFNIVSAVRN
Trigger: ATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGCTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: ALKEQRSSMNYIYYARAELFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
39% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACCTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: STSTLFVFALLRNVRLRNLFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
39% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCCTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: LERTEIKYELHLLCKSRVLFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACTCTTTGTTTTTGCCTaGTTGAGAAATGTGAGACTG +
Preference number: 3 (lower is better)
Translates to: NNRNKRYLTIDSITESRLLFVFA*LRNVRL
Trigger: CAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
38% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCTTTGTTTTTGCCTTGTaGAGAAATGTGAGACTGAGA +
Preference number: 3 (lower is better)
Translates to: LERTEIKYELHLLCKSRVFVFAL*RNVRLR
Trigger: TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAA...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
37% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGTTTGTTTTTGCCTTGTaGAGAAATGTGAGACTGAGA +
Preference number: 3 (lower is better)
Translates to: YRHNSAFTFITLSYGFNRFVFAL*RNVRLR
Trigger: TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAA...CCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTA
37% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTATTTGTTTTTGCCTTGTaGAGAAATGTGAGACTGAGA +
Preference number: 3 (lower is better)
Translates to: NNRNKRYLTIDSITESRLFVFAL*RNVRLR
Trigger: TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAA...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
37% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAAGGACCAGAAATTTCTaGCTACTTTACAAGCAAATG +
Preference number: 3 (lower is better)
Translates to: NNRNKRYLTIDSITESRLRTRNF*LLYKQM
Trigger: CATTTGCTTGTAAAGTAGCAAGAAATTTCTGGTCCT...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTAGGACCAGAAATTTCTaGCTACTTTACAAGCAAATG +
Preference number: 3 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLRTRNF*LLYKQM
Trigger: CATTTGCTTGTAAAGTAGCAAGAAATTTCTGGTCCT...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
37% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTTTGTTTTTGCCTTGTaGAGAAATGTGAGACTGAGA +
Preference number: 3 (lower is better)
Translates to: KEQRSSMNYIYYARAESTFVFAL*RNVRLR
Trigger: TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAA...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
36% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
3UTR-3UTR CAA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTAGGACCAGAAATTTCTaGCTACTTTACAAGCAAATG +
Preference number: 3 (lower is better)
Translates to: KEQRSSMNYIYYARAESTRTRNF*LLYKQM
Trigger: CATTTGCTTGTAAAGTAGCAAGAAATTTCTGGTCCT...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
36% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TGTCCCTGTGCCACTGACCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: CPCATDRLALSSSVRSNHAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...GTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGGGACA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR GCA 90 bp AGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATCCGCCATCCCAACCCTaGGACCCCGCCAGGGTGGAC +
Preference number: 4 (lower is better)
Translates to: RWRARLQQRSERMGFRLYPPSQP*DPARVD
Trigger: GTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGG...ATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCGCCATCCCAACCCTaGGACCCCGCCAGGGTGGAC +
Preference number: 4 (lower is better)
Translates to: YGHLPQRAAGNWPECQWYPPSQP*DPARVD
Trigger: GTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGG...GTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp TCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCTGTCGGGCGAACCATaGTCGCCTCCAGCCGCCATC +
Preference number: 4 (lower is better)
Translates to: SLKELQETGLSASGTLYSLSGEP*SPPAAI
Trigger: GATGGCGGCTGGAGGCGATCATGGTTCGCCCGACAG...GGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR CCA 90 bp GAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGTGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: ELQETGLSASGTLYSPEAWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...CGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp TCAAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: SSCSTLWSSPSKSCRKLAAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...GGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR CCA 90 bp CAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCACATCTCCGGGCTaGCATAGCGGGAGGCAAGAG +
Preference number: 4 (lower is better)
Translates to: QRAAGNWPECQWYPLLPGSTSPG*HSGRQE
Trigger: CTCTTGCCTCCCGCTATGCCAGCCCGGAGATGTGCT...TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR CCA 90 bp CTGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCGCGACCCCGCCAGGGTaGACTGGACCAGGGAAGAGC +
Preference number: 4 (lower is better)
Translates to: LDTLYEVIVTPFLLNHRSATPPG*TGPGKS
Trigger: GCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGC...GCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR GCA 90 bp GAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: ELQETGLSASGTLYSPEAHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...CGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp TCTTGTCAAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: SCQAALPYGHLPQRAAGNAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...GTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGACAAGA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp CTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGCAGCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: LQETGLSASGTLYSPEAQPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...CTGCGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GTGCCACTGACCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGTGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: VPLTGWHYHPVCVQTTGQWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCAC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR CCA 90 bp GAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: ELQETGLSASGTLYSPEANRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...CGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR CCA 90 bp CTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGCAGAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCAGTA +
Preference number: 4 (lower is better)
Translates to: LQETGLSASGTLYSPEAQNVSQL*SAVQAV
Trigger: TACTGCCTGCACAGCTGACCACAGTTGGGAAACGTT...CTGCGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp TCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: SLKELQETGLSASGTLYSCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...GGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp CTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTGCCTGCTGTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: LYEVIVTPFLLNHRSCLLSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...CAGCAGGCAGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAAAGACCGCCATCCCAACCCTaGGACCCCGCCAGGGTGGAC +
Preference number: 4 (lower is better)
Translates to: PSKKTVLLPLSDSPVTQRPPSQP*DPARVD
Trigger: GTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGG...TCTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR GCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TGTAGCGGGTCCATGACAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: CSGSMTRVIRWRARLQQRAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...ACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGGAGGCGTATGTCGGTaGAAATCTGGGGGAGGTAGG +
Preference number: 4 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHGGVCR*KSGGGR
Trigger: CCTACCTCCCCCAGATTTGCACCGACATACGCCTCC...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGCAGAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: LQETGLSASGTLYSPEAQSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...CTGCGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR CCA 90 bp TGTAGCGGGTCCATGACAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: CSGSMTRVIRWRARLQQRNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...ACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAAAGAGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: PSKKTVLLPLSDSPVTQRAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...TCTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR TCA 90 bp TCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTGTGGCCCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: SWRLPPALTMAMMMFSVAPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...GGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TGGCAATCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: WQSWRLPPALTMAMMMFSCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...AGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGATTGCCA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: SAKQIRRLALSSSVRSNHCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...GTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: TDPSVGTIIQCAFKPLDRSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...TCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: PRPNRSVGWHYHPVCVQTGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...GGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: LPQRAAGNWPECQWYPLLGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp TCAAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: SSCSTLWSSPSKSCRKLAGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR GCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp TGTAGCGGGTCCATGACAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: CSGSMTRVIRWRARLQQRMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...ACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGTCATGGACCCGCTACA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCTGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: MKGSSCRMRRSITLGYTTWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...GGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCTGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp AGAGTATCTTACTCCGACTCCTCTCTGTTCCCGAAGGACTTGTGCACTGATGCCTGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: RVSYSDSSLFPKDLCTDAWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...GGCATCAGTGCACAAGTCCTTCGGGAACAGAGAGGAGTCGGAGTAAGATACTCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679609.1
CDS-3UTR CCA 90 bp GGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: GHERQLLPNAPFNYFGVHTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTGATTTTCTCATGGCAATCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: LIFSWQSWRLPPALTMAMTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...CATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAAAATCAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TGTCCCTGTGCCACTGACCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: CPCATDRLALSSSVRSNHFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...GTGGTTTGAACGCACACTGGATGATAGTGCCAACCGGTCAGTGGCACAGGGACA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR TCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTCTGTCGGGCGAACCATaGTCGCCTCCAGCCGCCATC +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTLSGEP*SPPAAI
Trigger: GATGGCGGCTGGAGGCGATCATGGTTCGCCCGACAG...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTGTGGCCATCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: LAATSSFDHGHDDVLCGHPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...ATGGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: LLYLMVISLKELQETGLSANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...ACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000623287.4
CDS-3UTR TCA 90 bp GTTCTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: VLCGHERQLLPNAPFNYFSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...AAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CGTTCAAACCACTGGACAGATGCTGTCTGTAGCGGGTCCATGACAAGGGTCATCTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: RSNHWTDAVCSGSMTRVICSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...GATGACCCTTGTCATGGACCCGCTACAGACAGCATCTGTCCAGTGGTTTGAACG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTGCCTGCTGCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: LYEVIVTPFLLNHRSCLLHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...CAGCAGGCAGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: IRRLALSSSVRSNHWTDAKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...AGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTCCCGCCAGGGTGGACTaGACCAGGGAAGAGCGGAAG +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKIPARVD*TREERK
Trigger: CTTCCGCTCTTCCCTGGTCCAGTCCACCCTGGCGGG...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGGAAGTCGGGCGCAGTaGCAGAAGCTGGAAGACTGC +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVGSRAQ*QKLEDC
Trigger: GCAGTCTTCCAGCTTCTGCCACTGCGCCCGACTTCC...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACTGTCGGGCGAACCATaGTCGCCTCCAGCCGCCATC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGLSGEP*SPPAAI
Trigger: GATGGCGGCTGGAGGCGATCATGGTTCGCCCGACAG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: CGHERQLLPNAPFNYFGVPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...TACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: RWRARLQQRSERMGFRLYPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...ATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: QGSSGGGQDCSNVLNAWDSMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...ATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAAACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: ERQLLPNAPFNYFGVHDQTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...TTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: LLYLMVISLKELQETGLSCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...ACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp ACAAGGGTCATCAGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGAGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: TRVIRWRARLQQRSERMGAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...TCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCTGCGGTAAGAAATGCCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: ICGKKCLGQTDPSVGTIIPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...GATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: LQQRSERMGFRLYGIALEPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...CTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AACGTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGAAGGACTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: NVLNAWDSAYMASHLSQSEGLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGTCCTTC...AGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AATCTCTGCACCTGCTGGGAGGCACGACCAGTGAAAGAAGAAGGATCCAGTAAAATGTCCCTGTGCCACTaGCCGGTTGGCACTATCATC +
Preference number: 4 (lower is better)
Translates to: NLCTCWEARPVKEEGSSKMSLCH*PVGTII
Trigger: GATGATAGTGCCAACCGGTCAGTGGCACAGGGACAT...TTTACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCCAGCAGGTGCAGAGATT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR GCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCCGCCATCCCAACCCTaGGACCCCGCCAGGGTGGAC +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQPPSQP*DPARVD
Trigger: GTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGG...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 8 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp TATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: YGIALEPICCFSKGSSISGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTGCCTGCTGATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: LYEVIVTPFLLNHRSCLLICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...CAGCAGGCAGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: RWRARLQQRSERMGFRLYAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...ATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ATCTGCGGTAAGAAATGCCTCGGCCAAACAGATCCGTTTGGTGTATGTGATGTCGGAGGCGTATGTCGGTaGAAATCTGGGGGAGGTAGG +
Preference number: 4 (lower is better)
Translates to: ICGKKCLGQTDPFGVCDVGGVCR*KSGGGR
Trigger: CCTACCTCCCCCAGATTTGCACCGACATACGCCTCC...GACATCACATACACCAAACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR CCA 90 bp CCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGAAGCACATCTCCGGGCTaGCATAGCGGGAGGCAAGAG +
Preference number: 4 (lower is better)
Translates to: PPQDLFGGWLSSSSLFLRSTSPG*HSGRQE
Trigger: CTCTTGCCTCCCGCTATGCCAGCCCGGAGATGTGCT...TCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp GGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: GHLPQRAAGNWPECQWYPTRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...AGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR CCA 90 bp CTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTGTGGCCATACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: LAATSSFDHGHDDVLCGHTLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...ATGGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGGAAGTCGGGCGCAGTaGCAGAAGCTGGAAGACTGC +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLGSRAQ*QKLEDC
Trigger: GCAGTCTTCCAGCTTCTGCCACTGCGCCCGACTTCC...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR CCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTGGAAGTCGGGCGCAGTaGCAGAAGCTGGAAGACTGC +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFGSRAQ*QKLEDC
Trigger: GCAGTCTTCCAGCTTCTGCCACTGCGCCCGACTTCC...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGACCGCCATCCCAACCCTaGGACCCCGCCAGGGTGGAC +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRPPSQP*DPARVD
Trigger: GTCCACCCTGGCGGGGTCGCAGGGTTGGGATGGCGG...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AATCTCTGCACCTGCTGGGAGGCACGACCAGTGAAAGAAGAAGGATCCAGTAAACATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: NLCTCWEARPVKEEGSSKHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...TTTACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCCAGCAGGTGCAGAGATT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: ERQLLPNAPFNYFGVHDQICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: MKGSSCRMRRSITLGYTTAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...GGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp CTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCCCCGGAAGCGCAGAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 4 (lower is better)
Translates to: LQETGLSASGTLYSPEAQNALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...CTGCGCTTCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR GCA 90 bp CTGATTTTCTCATGGCAATCCTGGCGGCTACCTCCAGCTTTGACCATGGCCATGAACTGTGGTCAGCTGTaGAGGCAGTATTGTCTCCAA +
Preference number: 4 (lower is better)
Translates to: LIFSWQSWRLPPALTMAMNCGQL*RQYCLQ
Trigger: TTGGAGACAATACTGCCTGCACAGCTGACCACAGTT...CATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAAAATCAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR GCA 90 bp AAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAACTGTGGTCAGCTGTaGAGGCCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: KLLYLMVISLKELQETGLNCGQL*RPLAKA
Trigger: TGCTTTTGCCAAAGGCCTGCACAGCTGACCACAGTT...CAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000624474.1
CDS-3UTR GCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGCTGAGAGGCGGAGGTTaGAGTGAGCCAAGATTGTGC +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVLRGGG*SEPRLC
Trigger: GCACAATCTTGGCTCACTGCAACCTCCGCCTCTCAG...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp ACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCACCTGCTGGGAGGCACGACGTCAGCTGTGCAGGCTaGAAATGTGTGAAACCTAAT +
Preference number: 4 (lower is better)
Translates to: TGDTPPLLRISAPAGRHDVSCAG*KCVKPN
Trigger: ATTAGGTTTCACACATTTCCAGCCTGCACAGCTGAC...GTCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR CCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAATGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp CGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: RMRRSITLGYTTNPSEMFWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...GAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTATTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: GWHYHPVCVQTTGQMLSVFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...TACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGCCCGCCAGGGTGGACTaGACCAGGGAAGAGCGGAAG +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEPARVD*TREERK
Trigger: CTTCCGCTCTTCCCTGGTCCAGTCCACCCTGGCGGG...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
CDS-3UTR CCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGGCGACCCCGCCAGGGTaGACTGGACCAGGGAAGAGC +
Preference number: 4 (lower is better)
Translates to: RLILFQLYRHNSAFTFITATPPG*TGPGKS
Trigger: GCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGC...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR CCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGAGCGACCCCGCCAGGGTaGACTGGACCAGGGAAGAGC +
Preference number: 4 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGATPPG*TGPGKS
Trigger: GCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGC...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCCACTCTGGCAAGCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVHSGKL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTG...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637669.1
3UTR CAA 72 bp ATTTTCTCATGGCAATCCTGGCGGCTACCTCCAGCTTaGACCATGGCCATGATGATGTTCTCTGTGGCCATG +
Preference number: 4 (lower is better)
Translates to: IFSWQSWRLPPA*TMAMMMFSVAM
Trigger: CATGGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAAAAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAACTGTCGGGCGAACCATaGTCGCCTCCAGCCGCCATC +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKLSGEP*SPPAAI
Trigger: GATGGCGGCTGGAGGCGATCATGGTTCGCCCGACAG...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: RWRARLQQRSERMGFRLYEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...ATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCCAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp TGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTCTGTAGCGCAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: WHYHPVCVQTTGQMLSVAQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...CGCTACAGACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCTGCGGTAAGAAATGCCTCGGCCAAACAGATCCGTTTGGTGTATGTGATGTCACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: ICGKKCLGQTDPFGVCDVTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...GACATCACATACACCAAACGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR TCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGCAGCGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: RRSITLGYTTNPSEMFCSGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...GCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGATGGGCGGATCACTTaGGGTCAGGAGTTCAAGACC +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLDGRIT*GQEFKT
Trigger: GGTCTTGAACTCCTGACCTCAAGTGATCCGCCCATC...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGCTTCCAGCTTCTGCCTaGCCTGGGGGATTGAGTGTA +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLLPASA*PGGLSV
Trigger: TACACTCAATCCCCCAGGTCAGGCAGAAGCTGGAAG...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp CCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCTTTCTCTTCCTCAGCTaGCATCTTGAAGTCGATGTT +
Preference number: 4 (lower is better)
Translates to: PRPNRSVGWHYHPVCVQTFLFLS*HLEVDV
Trigger: AACATCGACTTCAAGATGGCAGCTGAGGAAGAGAAA...GGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTAGCTCTCTTAAATCCTaGCTTTTCTGTCACCATCTT +
Preference number: 4 (lower is better)
Translates to: GHLPQRAAGNWPECQWYPSSLKS*LFCHHL
Trigger: AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCT...AGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp TGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTTCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: WIRSMRSLSPPSCLTTEASVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...AGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000623287.4
CDS-3UTR GCA 90 bp ATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: MGFRLYGIALEPICCFSKGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...CTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCAT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: LDTLYEVIVTPFLLNHRSHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...GCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCAG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp ATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTCTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: IRRLALSSSVRSNHWTDALNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...AGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp CGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGCAGCTTCCCGAAGGACTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: RRSITLGYTTNPSEMFCSFPKDL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGTCCTTCGGGAA...GCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: LQQRSERMGFRLYGIALESCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...CTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: ALPYGHLPQRAAGNWPECAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...GCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR CCA 90 bp TGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTAACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: CGHERQLLPNAPFNYFGVTLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...TACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACCCCGCCAGGGTGGACTaGACCAGGGAAGAGCGGAAG +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNPARVD*TREERK
Trigger: CTTCCGCTCTTCCCTGGTCCAGTCCACCCTGGCGGG...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
CDS-3UTR CCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTGCGACCCCGCCAGGGTaGACTGGACCAGGGAAGAGC +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLATPPG*TGPGKS
Trigger: GCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGC...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTGCGACCCCGCCAGGGTaGACTGGACCAGGGAAGAGC +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALATPPG*TGPGKS
Trigger: GCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGC...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AATCTCTGCACCTGCTGGGAGGCACGACCAGTGAAAGAAGAAGGATCCAGTAAACACTCTGGCAAGCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: NLCTCWEARPVKEEGSSKHSGKL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTG...TTTACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCCAGCAGGTGCAGAGATT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
3UTR CAA 72 bp CATGATGATGTTCTCTGTGGCCATGAAAGGCAGCTCTaGCCGAATGCGCCGTTCAATTACTTTGGGGTACAC +
Preference number: 4 (lower is better)
Translates to: HDDVLCGHERQL*PNAPFNYFGVH
Trigger: GTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACATCATCATG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAGATTAACTTATGCGGGAGGCAAGAGGTaGGCGGTAGCTGTCGGGCGA +
Preference number: 4 (lower is better)
Translates to: PKTVFSQFWCILSLRLTYAGGKR*AVAVGR
Trigger: TCGCCCGACAGCTACCGCTCACCTCTTGCCTCCCGC...ATAAGTTAATCTTAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp GGTGGCTTTTTGGGCACTGGACAACCATTAACACCTCCTAAAACAGTCTTCTCTCCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: GGFLGTGQPLTPPKTVFSPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...AGAGAAGACTGTTTTAGGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCACC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: LLYLMVISLKELQETGLSEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...ACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp TGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTAGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: CGHERQLLPNAPFNYFGVEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...TACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp GGTGGCTTTTTGGGCACTGGACAACCATTAACACCTCCTAAAACAGTCTTCTCTGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: GGFLGTGQPLTPPKTVFSGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...AGAGAAGACTGTTTTAGGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCACC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp GGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTCTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 4 (lower is better)
Translates to: GHLPQRAAGNWPECQWYPLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...AGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR GCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACACCATCTTGTCAAGCTaGTCTACCTTATGGTCATCT +
Preference number: 4 (lower is better)
Translates to: YGHLPQRAAGNWPECQWYTILSS*STLWSS
Trigger: AGATGACCATAAGGTAGAGCAGCTTGACAAGATGGT...GTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp CTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCCAGTGGTACCCTTTACTCTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 4 (lower is better)
Translates to: LPQRAAGNWPECQWYPLLFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR GCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TGGATACGCTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: WIRSMRSLSPPSCLTTEAHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...AGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAGCGTATCCA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: YGIALEPICCFSKGSSISICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...GGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp GTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: VLNAWDSAYMASHLSQSAMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...AGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTTCTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: VLCGHERQLLPNAPFNYFMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...AAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: FCSVFNIVSAVRNASAKQKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...CTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp AACGTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: NVLNAWDSAYMASHLSQSSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...AGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAAGTCAGCTGTGCAGGCTaGAAATGTGTGAAACCTAAT +
Preference number: 4 (lower is better)
Translates to: ERQLLPNAPFNYFGVHDQVSCAG*KCVKPN
Trigger: ATTAGGTTTCACACATTTCCAGCCTGCACAGCTGAC...TTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR CCA 90 bp GAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAAAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: ERQLLPNAPFNYFGVHDQNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...TTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: YGIALEPICCFSKGSSISVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...GGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACCCGCCAGGGTGGACTaGACCAGGGAAGAGCGGAAG +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLPARVD*TREERK
Trigger: CTTCCGCTCTTCCCTGGTCCAGTCCACCCTGGCGGG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
CDS-3UTR CCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTGCGACCCCGCCAGGGTaGACTGGACCAGGGAAGAGC +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTATPPG*TGPGKS
Trigger: GCTCTTCCCTGGTCCAGTCCACCCTGGCGGGGTCGC...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCACTTGCTTACACTGCTaGGAGGCACGACCAGTGAAA +
Preference number: 4 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLTCLHC*EARPVK
Trigger: TTTCACTGGTCGTGCCTCCCAGCAGTGTAAGCAAGT...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000624027.1
CDS-3UTR CCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGATAATCCCAGAACTTTaGGAGGCTGAGATGGGCGGA +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVIIPEL*EAEMGG
Trigger: TCCGCCCATCTCAGCCTCCCAAAGTTCTGGGATTAT...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTCTGTCGGGCGAACCATaGTCGCCTCCAGCCGCCATC +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTLSGEP*SPPAAI
Trigger: GATGGCGGCTGGAGGCGATCATGGTTCGCCCGACAG...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTGCCCTGTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTCCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: LPCDDESSLKSCLFCHHLPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCACAGGGCAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp ATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: ILLSPSSRFHMVLTGDTPSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...AGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGATCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp GCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: AFTFITLSYGFNRGYTSSPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...AGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKIGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp ATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: MGFRLYGIALEPICCFSKGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...CTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCAT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAAGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: FWRLALQFISIPQTGYPKGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...TTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp AGGTGGCGGGCAAGACTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 4 (lower is better)
Translates to: RWRARLQQRSERMGFRLYKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...ATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAGAAGGACTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLREGLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGTCCTTC...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACGATGGGCGGATCACTTaGGGTCAGGAGTTCAAGACC +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHDGRIT*GQEFKT
Trigger: GGTCTTGAACTCCTGACCTCAAGTGATCCGCCCATC...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TCAAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTTTCTCTTCCTCAGCTaGCATCTTGAAGTCGATGTT +
Preference number: 4 (lower is better)
Translates to: SSCSTLWSSPSKSCRKLAFLFLS*HLEVDV
Trigger: AACATCGACTTCAAGATGGCAGCTGAGGAAGAGAAA...GGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp CTCTATGAGGTCATTGTCACCCCCTTCCTGCTTAACCACAGAAGCTGCCTGCTGAGTTCTGGAGATCCATaGAAAGATCCTGAATCCAAA +
Preference number: 4 (lower is better)
Translates to: LYEVIVTPFLLNHRSCLLSSGDP*KDPESK
Trigger: TTTGGATTCAGGATCTTTGCATGGATCTCCAGAACT...CAGCAGGCAGCTTCTGTGGTTAAGCAGGAAGGGGGTGACAATGACCTCATAGAG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTGTAGTTCTGGAGATCCATaGAAAGATCCTGAATCCAAA +
Preference number: 4 (lower is better)
Translates to: PSVGTIIQCAFKPLDRCCSSGDP*KDPESK
Trigger: TTTGGATTCAGGATCTTTGCATGGATCTCCAGAACT...ACAGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGATGCTACCATCTTGTCAAGCTaGTCTACCTTATGGTCATCT +
Preference number: 4 (lower is better)
Translates to: IRRLALSSSVRSNHWTDATILSS*STLWSS
Trigger: AGATGACCATAAGGTAGAGCAGCTTGACAAGATGGT...AGCATCTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCCTGAGTGCAGCTCTCTTAAATCCTaGCTTTTCTGTCACCATCTT +
Preference number: 4 (lower is better)
Translates to: ALPYGHLPQRAAGNWPECSSLKS*LFCHHL
Trigger: AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCT...GCACTCAGGCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGCAGAAGCTGGAAGACTaGCTAGTTGCCAAGTATCTG +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVQKLED*LVAKYL
Trigger: CAGATACTTGGCAACTAGGCAGTCTTCCAGCTTCTG...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp GAAATGTTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCTTCCCGAAGGACTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: EMFCSVFNIVSAVRNASAFPKDL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGTCCTTCGGGAA...GGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAACATTTC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACTGAGAGGCGGAGGTTaGAGTGAGCCAAGATTGTGC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGLRGGG*SEPRLC
Trigger: GCACAATCTTGGCTCACTGCAACCTCCGCCTCTCAG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTAGCACATCTCCGGGCTaGCATAGCGGGAGGCAAGAG +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNASTSPG*HSGRQE
Trigger: CTCTTGCCTCCCGCTATGCCAGCCCGGAGATGTGCT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCACATCTCCGGGCTaGCATAGCGGGAGGCAAGAG +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNSTSPG*HSGRQE
Trigger: CTCTTGCCTCCCGCTATGCCAGCCCGGAGATGTGCT...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGATGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTATGGCCTGAGTGCCAGTaGTACCCTTTACTCCCCGGA +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLWPECQ*YPLLPG
Trigger: TCCGGGGAGTAAAGGGTACCACTGGCACTCAGGCCA...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGCAGCGTATTCACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: SITLGYTTNPSEMFCSVFTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...GAATACGCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: YGIALEPICCFSKGSSISTLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...GGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTGCAGCAACGTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: LQQRSERMGFRLYGIALENRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...CTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGGTACACGACCAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: MKGSSCRMRRSITLGYTTNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...GGTCGTGTACCCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGAGGAAGTCGGGCGCAGTaGCAGAAGCTGGAAGACTGC +
Preference number: 4 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGGSRAQ*QKLEDC
Trigger: GCAGTCTTCCAGCTTCTGCCACTGCGCCCGACTTCC...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGTGGCTTTTTGGGCACTaGACAACCATTAACACCTCC +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVWLFGH*TTINTS
Trigger: GGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCA...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR CCA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTGTGCCACTGACCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLVPLTG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGGTCAGTGGCAC...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR CCA 90 bp TTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAAAGCTTCTGCCTGACCTaGGGGATTGAGTGTAGGTTG +
Preference number: 4 (lower is better)
Translates to: FWRLALQFISIPQTGYPKSFCLT*GIECRL
Trigger: CAACCTACACTCAATCCCCCAGGTCAGGCAGAAGCT...TTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTCCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTTCCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAACCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: FPSKKTVLLPLSDSPVTQPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...TTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGGAAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR TCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAAAGACCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: PSKKTVLLPLSDSPVTQRPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...TCTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR TCA 90 bp TTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: FCSVFNIVSAVRNASAKQPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...CTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAACCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: FWRLALQFISIPQTGYPKPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...TTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAACAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGATGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR TCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAESVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCTCCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: PPPQDLFGGWLSSSSLFLAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...GAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGGAGG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCAGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: RFHMVLTGDTPPLLRISAGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...TGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 4 (lower is better)
Translates to: SAKQIRRLALSSSVRSNHEIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...GTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGAAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: PPQDLFGGWLSSSSLFLRNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...TCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCAGTTCTGGAGATCCATaGAAAGATCCTGAATCCAAA +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVSSGDP*KDPESK
Trigger: TTTGGATTCAGGATCTTTGCATGGATCTCCAGAACT...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTGTCAAGCGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: VMMKALLNPAFSVTILSSGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...GCTTGACAAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp GTAGACGGAGGTATCAGAAGGAAACCTGAGGGCAAGATCCATGTCTTAGCCGTCTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 4 (lower is better)
Translates to: VDGGIRRKPEGKIHVLAVFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...GACGGCTAAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATACCTCCGTCTAC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000623287.4
CDS-3UTR GCA 90 bp CGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGCAGCGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 4 (lower is better)
Translates to: RRSITLGYTTNPSEMFCSALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...GCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTGGCGGCTACCTCCAGCTTTGACCATGGCCATGATGATGTTCTCTGTGGCCATCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 4 (lower is better)
Translates to: LAATSSFDHGHDDVLCGHPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...ATGGCCACAGAGAACATCATCATGGCCATGGTCAAAGCTGGAGGTAGCCGCCAG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTCTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFLNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp ATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: ILLSPSSRFHMVLTGDTPKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...AGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp CTCTGTGGCCATGAAAGGCAGCTCTTGCCGAATGCGCCGTTCAATTACTTTGGGAACGCTCTTTGTTTTTaGCTTGTTGAGAAATGTGAG +
Preference number: 4 (lower is better)
Translates to: LCGHERQLLPNAPFNYFGNALCF*LVEKCE
Trigger: CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTT...CCCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCATGGCCACAGAG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAATCAGCTATAAATCCATaGAACAAGGAAGTCGGGCGC +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQSAINP*NKEVGR
Trigger: GCGCCCGACTTCCTTGTTGCATGGATTTATAGCTGA...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGGAGGCGTATGTCGGTaGAAATCTGGGGGAGGTAGG +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKGGVCR*KSGGGR
Trigger: CCTACCTCCCCCAGATTTGCACCGACATACGCCTCC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGTCAGCTGTGCAGGCTaGAAATGTGTGAAACCTAAT +
Preference number: 4 (lower is better)
Translates to: GYPKLNVMPRVRSSKPLVVSCAG*KCVKPN
Trigger: ATTAGGTTTCACACATTTCCAGCCTGCACAGCTGAC...CACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKIVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: AFTFITLSYGFNRGYTSSVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...AGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGCACTCTGGCAAGCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: FCSVFNIVSAVRNASAKQHSGKL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTG...CTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR CCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGGCCGAGAGATCACTCTaGCAAGCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLAERSL*QALAKA
Trigger: TGCTTTTGCCAAAGCTTGCCAGAGTGATCTCTCGGC...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR CCA 90 bp GGTGGCTTTTTGGGCACTGGACAACCATTAACACCTCCTAAAACAGTCTTCTCTTGGCTTTTTGGGCACTaGACAACCATTAACACCTCC +
Preference number: 4 (lower is better)
Translates to: GGFLGTGQPLTPPKTVFSWLFGH*TTINTS
Trigger: GGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCA...AGAGAAGACTGTTTTAGGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCACC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR CCA 90 bp GTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTGTCAAGCAGCTGTGCAGGCCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: VMMKALLNPAFSVTILSSSCAGL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGGCCTGCACAGCT...GCTTGACAAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000624474.1
CDS-3UTR CCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACAGCTTCTGCCTGACCTaGGGGATTGAGTGTAGGTTG +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHSFCLT*GIECRL
Trigger: CAACCTACACTCAATCCCCCAGGTCAGGCAGAAGCT...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GGTGGCTTTTTGGGCACTGGACAACCATTAACACCTCCTAAAACAGTCTTCTCTAGCTTCCCAAGTAGCTaGGACTGTAAATGCGCATCA +
Preference number: 4 (lower is better)
Translates to: GGFLGTGQPLTPPKTVFSSFPSS*DCKCAS
Trigger: TGATGCGCATTTACAGTCCCAGCTACTTGGGAAGCT...AGAGAAGACTGTTTTAGGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCACC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATCCTGGACTAAACTCTTaGGCTCAAGTGACCCTATCG +
Preference number: 4 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNPGLNS*AQVTLS
Trigger: CGATAGGGTCACTTGAGCCCAAGAGTTTAGTCCAGG...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTCCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNAVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATGACACAGACAGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: QVSDVLLLLEIQQGMTQTVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTCAATATCCACTTTTCGTGTATATGTCTGCCCTGTGATGATGAAAGCTCTCTTGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: FNIHFSCICLPCDDESSLVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...AAGAGAGCTTTCATCATCACAGGGCAGACATATACACGAAAAGTGGATATTGAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTATCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp GCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: AWDSAYMASHLSQSAVFQAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...TTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GTCAAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTGGCGAAATAAAAGGTATCTaGCCATTGACTCAATCACTG +
Preference number: 4 (lower is better)
Translates to: VKLLYLMVISLKELQETGEIKGI*PLTQSL
Trigger: CAGTGATTGAGTCAATGGTCAGATACCTTTTATTTC...GCCAGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAGAAGGACTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLEGLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGTCCTTC...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAAAGATCTTCTCCCACTATCTaGCTCGCCAGTTACACAAAG +
Preference number: 4 (lower is better)
Translates to: PSKKTVLLPLSDSPVTQRSSPTI*LASYTK
Trigger: CTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGA...TCTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR TCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGCTTCCAGCTTCTGCCTaGCCTGGGGGATTGAGTGTA +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAELPASA*PGGLSV
Trigger: TACACTCAATCCCCCAGGTCAGGCAGAAGCTGGAAG...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAACTGGTCAGAGTCCCATaGCTTAATTTCCTTGTGTCA +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQLVRVP*LNFLVS
Trigger: TGACACAAGGAAATTAAGTCATGGGACTCTGACCAG...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAATATATGTTTTCCAGTaGACACGCAGACCACCCATC +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQIYVFQ*TRRPPI
Trigger: GATGGGTGGTCTGCGTGTTCACTGGAAAACATATAT...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000679723.1
CDS-3UTR GCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR GCA 90 bp TTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAAAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: FWRLALQFISIPQTGYPKNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...TTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAA
46% GC, longest homopolymer 6 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp ATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: MGFRLYGIALEPICCFSKNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...CTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000680444.1
CDS-3UTR GCA 90 bp CGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGCAGCACCATCTTGTCAAGCTaGTCTACCTTATGGTCATCT +
Preference number: 4 (lower is better)
Translates to: RRSITLGYTTNPSEMFCSTILSS*STLWSS
Trigger: AGATGACCATAAGGTAGAGCAGCTTGACAAGATGGT...GCTGCAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTGTCAAGCTGCTCTACCTTATGGTCATCTCCCTCAAAGAGCTGCAGGAAACTACCATCTTGTCAAGCTaGTCTACCTTATGGTCATCT +
Preference number: 4 (lower is better)
Translates to: LVKLLYLMVISLKELQETTILSS*STLWSS
Trigger: AGATGACCATAAGGTAGAGCAGCTTGACAAGATGGT...AGTTTCCTGCAGCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCTTGACAAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp TCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 4 (lower is better)
Translates to: SERMGFRLYGIALEPICCFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...ACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTTCTGAACGCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 4 (lower is better)
Translates to: VLNAWDSAYMASHLSQSAFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...AGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGCGTTCAGAAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TGCGGTAAGAAATGCCTCGGCCAAACAGATCCGTCGGTTGGCACTATCATCCAGCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 4 (lower is better)
Translates to: CGKKCLGQTDPSVGTIIQPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...CTGGATGATAGTGCCAACCGACGGATCTGTTTGGCCGAGGCATTTCTTACCGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: FCSVFNIVSAVRNASAKQMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...CTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTTCAGCTATAAATCCATaGAACAAGGAAGTCGGGCGC +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTSAINP*NKEVGR
Trigger: GCGCCCGACTTCCTTGTTGCATGGATTTATAGCTGA...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATACTGATAGTAGTTGCTaGCTCCAAGTTGCCCATAGC +
Preference number: 4 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNTDSSC*LQVAHS
Trigger: GCTATGGGCAACTTGGAGGCAGCAACTACTATCAGT...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTAGCACATCTCCGGGCTaGCATAGCGGGAGGCAAGAG +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTSTSPG*HSGRQE
Trigger: CTCTTGCCTCCCGCTATGCCAGCCCGGAGATGTGCT...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAAAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: FWRLALQFISIPQTGYPKSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...TTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNATRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTTTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTTLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGGTGCCACTGACCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEVPLTG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGGTCAGTGGCAC...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000625194.4
CDS-3UTR CCA 90 bp GGTGGCTTTTTGGGCACTGGACAACCATTAACACCTCCTAAAACAGTCTTCTCTAACGTTCTTGTCCAATaGCACTTGCTTACACTGCTG +
Preference number: 4 (lower is better)
Translates to: GGFLGTGQPLTPPKTVFSNVLVQ*HLLTLL
Trigger: CAGCAGTGTAAGCAAGTGCCATTGGACAAGAACGTT...AGAGAAGACTGTTTTAGGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCACC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000624027.1
CDS-3UTR CCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTCACTCTTCCTGCACCTaGCAATATTTGAAGTGCCGA +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKIHSSCT*QYLKCR
Trigger: TCGGCACTTCAAATATTGCCAGGTGCAGGAAGAGTG...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTCAATATCCACTTTTCGTGTATATGTCTGCCCTGTGATGATGAAAGCTCTCTTCCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: FNIHFSCICLPCDDESSLPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...AAGAGAGCTTTCATCATCACAGGGCAGACATATACACGAAAAGTGGATATTGAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAAAGAGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: PSKKTVLLPLSDSPVTQREVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...TCTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR TCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKISMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: QLYRHNSAFTFITLSYGFCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...AAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGCAGGAAACTGGCCTaGGTGCCAGTGGTACCCTTT +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALCRKLA*VPVVPF
Trigger: AAAGGGTACCACTGGCACTCAGGCCAGTTTCCTGCA...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR TCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: LFQLYRHNSAFTFITLSYTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...ATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTCAATATCCACTTTTCGTGTATATGTCTGCCCTGTGATGATGAAAGCTCTCTTACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: FNIHFSCICLPCDDESSLTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...AAGAGAGCTTTCATCATCACAGGGCAGACATATACACGAAAAGTGGATATTGAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCATCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCTGTAGCGGGTCCATaGCAAGGGTCATCAGGTGGC +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTSVAGP*QGSSGG
Trigger: GCCACCTGATGACCCTTGTCATGGACCCGCTACAGA...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAECSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: RHNSAFTFITLSYGFNRGCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...TCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: RLILFQLYRHNSAFTFITGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTATGTCCCTGTGCCACTaGCCGGTTGGCACTATCATC +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALMSLCH*PVGTII
Trigger: GATGATAGTGCCAACCGGTCAGTGGCACAGGGACAT...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000480775.3
ENST00000625194.4
CDS-3UTR GCA 90 bp TATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAAAGGGTTCCTCCATCTCCAGTTCTGGAGATCCATaGAAAGATCCTGAATCCAAA +
Preference number: 4 (lower is better)
Translates to: YGIALEPICCFSKGSSISSSGDP*KDPESK
Trigger: TTTGGATTCAGGATCTTTGCATGGATCTCCAGAACT...GGAGATGGAGGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGAGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTGGTGGCGGGCAAGACTaGAGCAACGTTCTGAACGCA +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTGGGQD*SNVLNA
Trigger: TGCGTTCAGAACGTTGCTGCAGTCTTGCCCGCCACC...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTACACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: SPSSRFHMVLTGDTPPLLHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...TAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGACACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AACAGATCCGTCGGTTGGCACTATCATCCAGTGTGCGTTCAAACCACTGGACAGCCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 4 (lower is better)
Translates to: NRSVGWHYHPVCVQTTGQPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTGCCAACCGACGGATCTGTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGATCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCESSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTAACTGTGGTCAGCTGTaGAGGCAGTATTGTCTCCAA +
Preference number: 4 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLNCGQL*RQYCLQ
Trigger: TTGGAGACAATACTGCCTGCACAGCTGACCACAGTT...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR GCA 90 bp TCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCCTCCCAAAGAGCTCCTaGAGAGTATCTTACTCCGAC +
Preference number: 4 (lower is better)
Translates to: SSRFHMVLTGDTPPLLRILPKSS*RVSYSD
Trigger: GTCGGAGTAAGATACTCTGCAGGAGCTCTTTGGGAG...GATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGCTCCCAAAGAGCTCCTaGAGAGTATCTTACTCCGAC +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCELPKSS*RVSYSD
Trigger: GTCGGAGTAAGATACTCTGCAGGAGCTCTTTGGGAG...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAGATTAACTTATGGCACTTGCTTACACTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: PKTVFSQFWCILSLRLTYGTCLH*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGTGTAAGCAAGTGCC...ATAAGTTAATCTTAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000624027.1
CDS-3UTR CCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAENVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp TTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAAGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: FWRLALQFISIPQTGYPKAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...TTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAATTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGTLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGCCGAGAGATCACTCTaGCAAGCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTAERSL*QALAKA
Trigger: TGCTTTTGCCAAAGCTTGCCAGAGTGATCTCTCGGC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTAAGAATCTCTGCACCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNAKNLCT*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGTGCAGAGATTCTT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000342312.9
CDS-3UTR CCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTACCACAAGATCTTTTTaGAGGTTGGCTCTCCAGTTC +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKITTRSF*RLALQF
Trigger: GAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR CCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAATAATCCCAGAACTTTaGGAGGCTGAGATGGGCGGA +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLIIPEL*EAEMGG
Trigger: TCCGCCCATCTCAGCCTCCCAAAGTTCTGGGATTAT...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACCTGGACTAAACTCTTaGGCTCAAGTGACCCTATCG +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRPGLNS*AQVTLS
Trigger: CGATAGGGTCACTTGAGCCCAAGAGTTTAGTCCAGG...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTTGGAAGTTGAGCAAATaGCTCTATGCTATCCCTGCT +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTWKLSK*LYAIPA
Trigger: AGCAGGGATAGCATAGAGCCATTTGCTCAACTTCCA...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR CAA 72 bp CAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATaGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCT +
Preference number: 4 (lower is better)
Translates to: QFISIPQTGYPK*NVMPRVRSSKP
Trigger: AGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGACCTCAGCTGCCATCTTaGAGTCGATGTTCTCCAGGT +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRPQLPS*SRCSPG
Trigger: ACCTGGAGAACATCGACTTCAAGATGGCAGCTGAGG...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGCAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCACCATCTTGTCAAGCTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: VMMKALLNPAFSVTILSSSMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...GCTTGACAAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR TCA 90 bp CGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCATCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: RFHMVLTGDTPPLLRISASMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...TGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTGCAAATCTTGTGCACTaGTGCCCCCAAGCTAGCCAG +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTANLVH*CPQASQ
Trigger: CTGGCTAGCTTGGGGGCATCAGTGCACAAGATTTGC...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR TCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTGTTCCTCCATCTCCTTaGGGTTTGCCAGGAGGCGTA +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTVPPSP*GLPGGV
Trigger: TACGCCTCCTGGCAAACCTCAAGGAGATGGAGGAAC...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGATGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTGGGAGTGAATGGGACTaGAGTAGGCATCAACCTGGA +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALGSEWD*SRHQPG
Trigger: TCCAGGTTGATGCCTACTTCAGTCCCATTCACTCCC...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTTCCGTTTGGTGTATGTaGTGTCCCTGTGCCACTGAC +
Preference number: 4 (lower is better)
Translates to: QLYRHNSAFTFITLSYGFSVWCM*CPCATD
Trigger: GTCAGTGGCACAGGGACATCACATACACCAAACGGA...AAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000480775.3
CDS-3UTR TCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACCTGGTCAGAGTCCCATaGCTTAATTTCCTTGTGTCA +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHLVRVP*LNFLVS
Trigger: TGACACAAGGAAATTAAGTCATGGGACTCTGACCAG...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAATCAACTTGGTGTATGTaGTGTCCCTGTGCCACTGAC +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKSTWCM*CPCATD
Trigger: GTCAGTGGCACAGGGACATCACATACACCAAGTTGA...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000625194.4
CDS-3UTR TCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCGCCCCTTGACAGAATaGGACTCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNARPLTE*DSLAKA
Trigger: TGCTTTTGCCAAAGAGTCTCATTCTGTCAAGGGGCG...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000680378.1
CDS-3UTR GCA 90 bp CCAAGTAAGAAGACTGTTCTTCTCCCACTATCTGACTCGCCAGTTACACAAAGATTTCTCTTCCTCAGCTaGCATCTTGAAGTCGATGTT +
Preference number: 4 (lower is better)
Translates to: PSKKTVLLPLSDSPVTQRFLFLS*HLEVDV
Trigger: AACATCGACTTCAAGATGGCAGCTGAGGAAGAGAAA...TCTTTGTGTAACTGGCGAGTCAGATAGTGGGAGAAGAACAGTCTTCTTACTTGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000624503.1
CDS-3UTR GCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTTTTCTCTTCCTCAGCTaGCATCTTGAAGTCGATGTT +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTFLFLS*HLEVDV
Trigger: AACATCGACTTCAAGATGGCAGCTGAGGAAGAGAAA...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp CCACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGAAGTTCTGGAGATCCATaGAAAGATCCTGAATCCAAA +
Preference number: 4 (lower is better)
Translates to: PPQDLFGGWLSSSSLFLRSSGDP*KDPESK
Trigger: TTTGGATTCAGGATCTTTGCATGGATCTCCAGAACT...TCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGTGG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGAGTTCTGGAGATCCATaGAAAGATCCTGAATCCAAA +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLSSGDP*KDPESK
Trigger: TTTGGATTCAGGATCTTTGCATGGATCTCCAGAACT...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAGGAAACTGGCCTGAGTaGCAGTGGTACCCTTTACTC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLGNWPE*QWYPLL
Trigger: GAGTAAAGGGTACCACTGGCACTCAGGCCAGTTTCC...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACTCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAATCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTTCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCCATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 4 (lower is better)
Translates to: LSPSSRFHMVLTGDTPPLALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...AAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp ATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCAGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: ILFQLYRHNSAFTFITLSAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...TGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTCTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTLNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAAAGAATCTCTGCACCTaGTGGGAGGCACGACCAGTG +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESKNLCT*WEARPV
Trigger: CACTGGTCGTGCCTCCCAGCAGGTGCAGAGATTCTT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: RLILFQLYRHNSAFTFITSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAATCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGCCAAGTATCTGATGTaGTCTTGCTATTGGAAATAC +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLAKYLM*SCYWKY
Trigger: GTATTTCCAATAGCAAGAGCACATCAGATACTTGGC...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTGCCAAGTATCTGATGTaGTCTTGCTATTGGAAATAC +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFAKYLM*SCYWKY
Trigger: GTATTTCCAATAGCAAGAGCACATCAGATACTTGGC...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTACAGAAGCTGGAAGACTaGCTAGTTGCCAAGTATCTG +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLQKLED*LVAKYL
Trigger: CAGATACTTGGCAACTAGGCAGTCTTCCAGCTTCTG...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTTTCCCGAAGGACTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFFPKDL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGTCCTTCGGGAA...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAACTGATAGTAGTTGCTaGCTCCAAGTTGCCCATAGC +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRTDSSC*LQVAHS
Trigger: GCTATGGGCAACTTGGAGGCAGCAACTACTATCAGT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAATCACTCTGGCAAGTTaGGAGACTGAGACAGGAGAG +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKITLAS*ETETGE
Trigger: CTCTCCTGTCTCAGTCTCCCAACTTGCCAGAGTGAT...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000680378.1
CDS-3UTR CCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: ILLSPSSRFHMVLTGDTPSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...AGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACAAGGGTCATCAGGTaGCGGGCAAGACTGCAGCAA +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESTRVIR*RARLQQ
Trigger: TTGCTGCAGTCTTGCCCGCCACCTGATGACCCTTGT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNAVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: RLILFQLYRHNSAFTFITVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: FTFITLSYGFNRGYTSSSAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...AGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGATTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTTTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCTTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGTTCTCATGGCAATCCTaGCGGCTACCTCCAGCTTTG +
Preference number: 4 (lower is better)
Translates to: YRHNSAFTFITLSYGFNRFSWQS*RLPPAL
Trigger: CAAAGCTGGAGGTAGCCGCCAGGATTGCCATGAGAA...CCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: SSRFHMVLTGDTPPLLRITLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...GATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTTLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCACTCTGGCAAGCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQHSGKL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTG...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAACACTCTGGCAAGCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKHSGKL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTG...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000680444.1
CDS-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTGCCGAGAGATCACTCTaGCAAGCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNAAERSL*QALAKA
Trigger: TGCTTTTGCCAAAGCTTGCCAGAGTGATCTCTCGGC...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGCCGAGAGATCACTCTaGCAAGCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNAERSL*QALAKA
Trigger: TGCTTTTGCCAAAGCTTGCCAGAGTGATCTCTCGGC...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKINRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TTCTGCAGCGTATTCAATATAGTATCTGCGGTAAGAAATGCCTCGGCCAAACAGAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: FCSVFNIVSAVRNASAKQNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...CTGTTTGGCCGAGGCATTTCTTACCGCAGATACTATATTGAATACGCTGCAGAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTAACGTTCTTGTCCAATaGCACTTGCTTACACTTCAT +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFNVLVQ*HLLTLH
Trigger: ATGAAGTGTAAGCAAGTGCCATTGGACAAGAACGTT...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000423176.6
CDS-3UTR CCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTCTTCTCTCAGTTCTaGTGCATACTGAGTTTAAGA +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLVFSQF*CILSLR
Trigger: TCTTAAACTCAGTATGCACCAGAACTGAGAGAAGAC...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR CCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAAAAATTAGCCAGGCATaGCGGCAGGCGCCTGTAATC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLKISQA*RQAPVI
Trigger: GATTACAGGCGCCTGCCGCCATGCCTGGCTAATTTT...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAAGCTTCCCAAGTAGCTaGGACTGTAAATGCGCATCA +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRSFPSS*DCKCAS
Trigger: TGATGCGCATTTACAGTCCCAGCTACTTGGGAAGCT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACTGGAAGTTGAGCAAATaGCTCTATGCTATCCCTGCT +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHWKLSK*LYAIPA
Trigger: AGCAGGGATAGCATAGAGCCATTTGCTCAACTTCCA...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR CAA 72 bp CTGCCTAGTTGCCAAGTATCTGATGTGCTCTTGCTATaGGAAATACAACAAGGAATGACACAGACAACGTTC +
Preference number: 4 (lower is better)
Translates to: LPSCQVSDVLLL*EIQQGMTQTTF
Trigger: GAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTGGCAACTAGGCAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
3UTR CAA 72 bp GGAAGACTGCCTAGTTGCCAAGTATCTGATGTGCTCTaGCTATTGGAAATACAACAAGGAATGACACAGACA +
Preference number: 4 (lower is better)
Translates to: GRLPSCQVSDVL*LLEIQQGMTQT
Trigger: TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTGGCAACTAGGCAGTCTTCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTCCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGCAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTATCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLSMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCESMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTSMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTGCAGCAACGTTCTaGACGCATGGGATTCCGCTT +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESTAATF*THGIPL
Trigger: AAGCGGAATCCCATGCGTTCAGAACGTTGCTGCAGT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTGTTCTCTGTGGCCATaGAAGGCAGCTCTTGCCGAA +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTCSLWP*KAALAE
Trigger: TTCGGCAAGAGCTGCCTTTCATGGCCACAGAGAACA...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTCCTGGATACGCTCTATaGGGTCATTGTCACCCCCTT +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTPGYAL*GHCHPL
Trigger: AAGGGGGTGACAATGACCTCATAGAGCGTATCCAGG...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp CCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAGATTAACTTATGGGAGGCACGACCAGTaGAAGAAGAAGGATCCAGTA +
Preference number: 4 (lower is better)
Translates to: PKTVFSQFWCILSLRLTYGRHDQ*KKKDPV
Trigger: TACTGGATCCTTCTTCTTTCACTGGTCGTGCCTCCC...ATAAGTTAATCTTAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp CTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAACTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 4 (lower is better)
Translates to: LFGGWLSSSSLFLRLGIQLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...TTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGAAATACAACAAGGAATaGCACAGACAACGTTCTTGT +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLKYNKE*HRQRSC
Trigger: ACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTT...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTTATACTCTGTGGCAGTaGGTAGACGGAGGTATCAGA +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSYTLWQ*VDGGIR
Trigger: TCTGATACCTCCGTCTACTCACTGCCACAGAGTATA...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR TCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTTATCAGAAGGAAACCTaGGGGCAAGATCCATGTCTT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTYQKET*GQDPCL
Trigger: AAGACATGGATCTTGCCCTCAGGTTTCCTTCTGATA...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp AATGCGCCGTTCAATTACTTTGGGGTACACGACCAATCCTTCAGAAATGTTCTGTTTCGTGTATATGTCTaGCCTGTGATGATGAAAGCT +
Preference number: 4 (lower is better)
Translates to: NAPFNYFGVHDQSFRNVLFRVYV*PVMMKA
Trigger: AGCTTTCATCATCACAGGGCAGACATATACACGAAA...CAGAACATTTCTGAAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGCGCATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTATCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCACATCTCCTTGAGGTTTaGCAGGAGGCGTATGTCGGT +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESHLLEV*QEAYVG
Trigger: ACCGACATACGCCTCCTGGCAAACCTCAAGGAGATG...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp TCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 4 (lower is better)
Translates to: SSRFHMVLTGDTPPLLRIALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...GATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR GCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGCAGCTCTTGCCGAATaGGCCGTTCAATTACTTTGG +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFAALAE*AVQLLW
Trigger: CCAAAGTAATTGAACGGCGCATTCGGCAAGAGCTGC...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATGACACAGACACTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: QVSDVLLLLEIQQGMTQTLNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKLNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTCTTCTAAGAATCTCTaGACCTGCTGGGAGGCACGA +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALSSKNL*TCWEAR
Trigger: TCGTGCCTCCCAGCAGGTGCAGAGATTCTTAGAAGA...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATGACACAGACACAGAAGCTGGAAGACTaGCTAGTTGCCAAGTATCTG +
Preference number: 4 (lower is better)
Translates to: QVSDVLLLLEIQQGMTQTQKLED*LVAKYL
Trigger: CAGATACTTGGCAACTAGGCAGTCTTCCAGCTTCTG...TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACCAGAAGCTGGAAGACTaGCTAGTTGCCAAGTATCTG +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNQKLED*LVAKYL
Trigger: CAGATACTTGGCAACTAGGCAGTCTTCCAGCTTCTG...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp CAAGTATCTGATGTGCTCTTGCTATTGGAAATACAACAAGGAATGACACAGACATCAGCTATAAATCCATaGAACAAGGAAGTCGGGCGC +
Preference number: 4 (lower is better)
Translates to: QVSDVLLLLEIQQGMTQTSAINP*NKEVGR
Trigger: GCGCCCGACTTCCTTGTTGCATGGATTTATAGCTGA...TGTCTGTGTCATTCCTTGTTGTATTTCCAATAGCAAGAGCACATCAGATACTTG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACTCCCAAAGAGCTCCTaGAGAGTATCTTACTCCGAC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLLPKSS*RVSYSD
Trigger: GTCGGAGTAAGATACTCTGCAGGAGCTCTTTGGGAG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000480775.3
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAGCCGAGAGATCACTCTaGCAAGTTGGGAGACTGAGA +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESAERSL*QVGRLR
Trigger: TCTCAGTCTCCCAACTTGCCAGAGTGATCTCTCGGC...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000680378.1
CDS-3UTR CCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGGTCAGCTGTGCAGGCTaGAAATGTGTGAAACCTAAT +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEVSCAG*KCVKPN
Trigger: ATTAGGTTTCACACATTTCCAGCCTGCACAGCTGAC...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTCAGACTGTCAGCTGTGCAGGCTaGAAATGTGTGAAACCTAAT +
Preference number: 4 (lower is better)
Translates to: LRGIHESSFNRVEGRSQTVSCAG*KCVKPN
Trigger: ATTAGGTTTCACACATTTCCAGCCTGCACAGCTGAC...AGTCTGACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCTGGA +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESNVSQL*SAVQAG
Trigger: TCCAGCCTGCACAGCTGACCACAGTTGGGAAACGTT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCETRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRTRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAESCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTGTGCGTTCAAACCACTaGACAGATGCTGTCTGTAGC +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALVRSNH*TDAVCS
Trigger: GCTACAGACAGCATCTGTCCAGTGGTTTGAACGCAC...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAAACAGATCCGTCGGTTaGCACTATCATCCAGTGTGC +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRNRSVG*HYHPVC
Trigger: GCACACTGGATGATAGTGCCAACCGACGGATCTGTT...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTACTCTGATTTTCTCATaGCAATCCTGGCGGCTACCT +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNATLIFS*QSWRLP
Trigger: AGGTAGCCGCCAGGATTGCCATGAGAAAATCAGAGT...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACACTCTGGCAAGCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLHSGKL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGCTTGCCAGAGTG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTGCCGAGAGATCACTCTaGCAAGCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLAERSL*QALAKA
Trigger: TGCTTTTGCCAAAGCTTGCCAGAGTGATCTCTCGGC...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000680444.1
CDS-3UTR CCA 90 bp CGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCAAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: RFHMVLTGDTPPLLRISANRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...TGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp CCATTAACACCTCCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAACCACAAGATCTTTTTaGAGGTTGGCTCTCCAGTTC +
Preference number: 4 (lower is better)
Translates to: PLTPPKTVFSQFWCILSLTTRSF*RLALQF
Trigger: GAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT...TAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGGAGGTGTTAATGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR CCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAAAAATTAGCCAGGCATaGCGGCAGGCGCCTGTAATC +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESKISQA*RQAPVI
Trigger: GATTACAGGCGCCTGCCGCCATGCCTGGCTAATTTT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp GTAAATGCGCATCATCGCAACCTGATTTCCTGGCTACTTTTAAATAAAACTGGAGCTCAGTGTGTCTCTTaGGGCAACACACAATCAAGT +
Preference number: 4 (lower is better)
Translates to: VNAHHRNLISWLLLNKTGAQCVS*GNTQSS
Trigger: ACTTGATTGTGTGTTGCCCCAAGAGACACACTGAGC...TCCAGTTTTATTTAAAAGTAGCCAGGAAATCAGGTTGCGATGATGCGCATTTAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGCCGAGAGATCACTCTaGCAAGAGTATTGTCTCCAA +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNAERSL*QEYCLQ
Trigger: TTGGAGACAATACTCTTGCCAGAGTGATCTCTCGGC...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000679723.1
CDS-3UTR CCA 90 bp GAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGACAGAATGAGACTCTTTaGCAAAAGCAGGTCAAGTGC +
Preference number: 4 (lower is better)
Translates to: ESTSTLFVFALLRNVRLRQNETL*QKQVKC
Trigger: GCACTTGACCTGCTTTTGCCAAAGAGTCTCATTCTG...TCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000680378.1
CDS-3UTR TCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCACCAAATGTGTGCACGTaGGCCATCACATCATGTCGT +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESPNVCT*AITSCR
Trigger: ACGACATGATGTGATGGCTCACGTGCACACATTTGG...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNAEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: STSTLFVFALLRNVRLRNEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...GTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACAGGCTGGAAATGTGTaGAACCTAATGTGGGTAGAC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLQAGNV*NLMWVD
Trigger: GTCTACCCACATTAGGTTTCACACATTTCCAGCCTG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: EIKYELHLLCKSRVNFNASMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...AGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp GCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTCTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 4 (lower is better)
Translates to: AFTFITLSYGFNRGYTSSLENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...AGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATTCTGGAAAATATGCCTTaGAAGAACAGAGATCAAGTA +
Preference number: 4 (lower is better)
Translates to: LEVGSPVHLYSSDWVSKILENMP*KNRDQV
Trigger: TACTTGATCTCTGTTCTTTCAAGGCATATTTTCCAG...AATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 4 (lower is better)
Translates to: SPSSRFHMVLTGDTPPLLKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...TAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ACCACAAGATCTTTTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTAAATACAACAAGGAATaGCACAGACAACGTTCTTGT +
Preference number: 4 (lower is better)
Translates to: TTRSFWRLALQFISIPQTKYNKE*HRQRSC
Trigger: ACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTT...AGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAAAAGATCTTGTGGT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR TCA 90 bp TTTGGAGGTTGGCTCTCCAGTTCATCTCTATTCCTCAGACTGGGTATCCAAAATAAATACAACAAGGAATaGCACAGACAACGTTCTTGT +
Preference number: 4 (lower is better)
Translates to: FGGWLSSSSLFLRLGIQNKYNKE*HRQRSC
Trigger: ACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTT...ATTTTGGATACCCAGTCTGAGGAATAGAGATGAACTGGAGAGCCAACCTCCAAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp TCATCACGCTTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTTTCTCTTCCTCAGCTaGCATCTTGAAGTCGATGTT +
Preference number: 4 (lower is better)
Translates to: SSRFHMVLTGDTPPLLRIFLFLS*HLEVDV
Trigger: AACATCGACTTCAAGATGGCAGCTGAGGAAGAGAAA...GATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAAGCGTGATGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTAACTGTGGTCAGCTGTaGAGGCTGGAAATGTGTGAA +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLNCGQL*RLEMCE
Trigger: TTCACACATTTCCAGCCTGCACAGCTGACCACAGTT...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTTCATATGGTTTTAACAGGGGATACACCTCCTCTTCTAAGAATCTCTGCACCTACCATCTTGTCAAGCTaGTCTACCTTATGGTCATCT +
Preference number: 4 (lower is better)
Translates to: FHMVLTGDTPPLLRISAPTILSS*STLWSS
Trigger: AGATGACCATAAGGTAGAGCAGCTTGACAAGATGGT...AGGTGCAGAGATTCTTAGAAGAGGAGGTGTATCCCCTGTTAAAACCATATGAAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCTACTTTACAAGCAAATGAACACGTGAAAAGGACTAAACTTGAGGCAGCTGGAAGCTCTCTTAAATCCTaGCTTTTCTGTCACCATCTT +
Preference number: 4 (lower is better)
Translates to: ATLQANEHVKRTKLEAAGSSLKS*LFCHHL
Trigger: AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCT...TCCAGCTGCCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTTGTAAAGTAGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GTATATGTCTGCCCTGTGATGATGAAAGCTCTCTTAAATCCTGCCTTTTCTGTCAGCTCTCTTAAATCCTaGCTTTTCTGTCACCATCTT +
Preference number: 4 (lower is better)
Translates to: VYVCPVMMKALLNPAFSVSSLKS*LFCHHL
Trigger: AAGATGGTGACAGAAAAGGCAGGATTTAAGAGAGCT...GACAGAAAAGGCAGGATTTAAGAGAGCTTTCATCATCACAGGGCAGACATATAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000623287.4
ENST00000624474.1
ENST00000679609.1
CDS-3UTR GCA 90 bp AAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCGGTGCAAATCTTGTaGACTGATGCCCCCAAGCTA +
Preference number: 4 (lower is better)
Translates to: KEQRSSMNYIYYARAESTSVQIL*TDAPKL
Trigger: TAGCTTGGGGGCATCAGTGCACAAGATTTGCACCGA...AGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAGGAGGCGTATGTCGGTaGAAATCTTGTGCACTGATG +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESGGVCR*KSCALM
Trigger: CATCAGTGCACAAGATTTGCACCGACATACGCCTCC...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000342312.9
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679723.1
ENST00000680378.1
CDS-3UTR GCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGGCACTTGAGCCAATCTaGTGTTTTTCAAAGGGTTCC +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAEALEPI*CFSKGS
Trigger: GGAACCCTTTGAAAAACAGCAGATTGGCTCAAGTGC...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGACACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCCACTATCATCCAGTGTaGGTTCAAACCACTGGACAG +
Preference number: 4 (lower is better)
Translates to: LERTEIKYELHLLCKSRVHYHPV*VQTTGQ
Trigger: CTGTCCAGTGGTTTGAACGCACACTGGATGATAGTG...GACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAATCTGCGGTAAGAAATaGCTCGGCCAAACAGATCCG +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESICGKK*LGQTDP
Trigger: CGGATCTGTTTGGCCGAGGCATTTCTTACCGCAGAT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp GCATGGGATTCCGCTTATATGGCATCGCACTTGAGCCAATCTGCTGTTTTTCAACCTTCAGAAATGTTCTaGAGCGTATTCAATATAGTA +
Preference number: 4 (lower is better)
Translates to: AWDSAYMASHLSQSAVFQPSEMF*SVFNIV
Trigger: TACTATATTGAATACGCTGCAGAACATTTCTGAAGG...TTGAAAAACAGCAGATTGGCTCAAGTGCGATGCCATATAAGCGGAATCCCATGC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAATGAAAGGCAGCTCTTaGCGAATGCGCCGTTCAATT +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRMKGSS*RMRRSI
Trigger: AATTGAACGGCGCATTCGGCAAGAGCTGCCTTTCAT...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTACTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLLNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTCTTAACCACAGAAGCTaGCTGCTGAGAAAGCACTCT +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLLNHRS*LLRKHS
Trigger: AGAGTGCTTTCTCAGCAGGCAGCTTCTGTGGTTAAG...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR GCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTTATCTGATGTGCTCTTaGTATTGGAAATACAACAAG +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFYLMCS*YWKYNK
Trigger: CTTGTTGTATTTCCAATAGCAAGAGCACATCAGATA...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp ACTGGGTATCCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGTATCTGATGTGCTCTTaGTATTGGAAATACAACAAG +
Preference number: 4 (lower is better)
Translates to: TGYPKLNVMPRVRSSKPLYLMCS*YWKYNK
Trigger: CTTGTTGTATTTCCAATAGCAAGAGCACATCAGATA...CAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGGATACCCAGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000423176.6
ENST00000623063.3
ENST00000624027.1
ENST00000679723.1
CDS-3UTR GCA 90 bp CCAAAATTGAATGTAATGCCAAGAGTGCGGAGCAGTAAGCCTCTGGTGGCTTTTCAATTAGCATTTCCCTaGTGTATAAGCCTTATCAAA +
Preference number: 4 (lower is better)
Translates to: PKLNVMPRVRSSKPLVAFQLAFP*CISLIK
Trigger: TTTGATAAGGCTTATACAGCAGGGAAATGCTAATTG...AAAAGCCACCAGAGGCTTACTGCTCCGCACTCTTGGCATTACATTCAATTTTGG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp CGTTTAATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: RLILFQLYRHNSAFTFITTRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...CGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAATTAAACG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: NFNALCFCLVEKCETEKQTRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...CTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSTRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp TCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAACAGGAAAACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: STLFVFALLRNVRLRNRKTRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...TTTCCTGTTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGACACGCTTCAAGTTCTaGAGATCCATGCAAAGATCC +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAETRFKF*RSMQRS
Trigger: GGATCTTTGCATGGATCTCCAGAACTTGAAGCGTGT...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AATAACCGAAATAAAAGGTATCTGACCATTGACTCAATCACTGAGTCCAGGTTAAGCTGCTCTACCTTATaGTCATCTCCCTCAAAGAGC +
Preference number: 4 (lower is better)
Translates to: NNRNKRYLTIDSITESRLSCSTL*SSPSKS
Trigger: GCTCTTTGAGGGAGATGACCATAAGGTAGAGCAGCT...TAACCTGGACTCAGTGATTGAGTCAATGGTCAGATACCTTTTATTTCGGTTATT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp GCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: ALKEQRSSMNYIYYARAENVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...CTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp ATTCTCTTCCAACTCTACAGACATAATTCTGCTTTCACCTTCATCACGCTTTCAAACGTTCTGAACGCATaGGATTCCGCTTATATGGCA +
Preference number: 4 (lower is better)
Translates to: ILFQLYRHNSAFTFITLSNVLNA*DSAYMA
Trigger: TGCCATATAAGCGGAATCCCATGCGTTCAGAACGTT...TGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCTGTAGAGTTGGAAGAGAAT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AGACATAATTCTGCTTTCACCTTCATCACGCTTTCATATGGTTTTAACAGGGGAGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: RHNSAFTFITLSYGFNRGAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...TCCCCTGTTAAAACCATATGAAAGCGTGATGAAGGTGAAAGCAGAATTATGTCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000480775.3
ENST00000623287.4
ENST00000679609.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGACTGAGAAAGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: VNFNALCFCLVEKCETEKAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...TTTCTCAGTCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGAC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AAATCGTTGAGAGGAATTCATGAGAGTAGTTTCAACAGAGTTGAGGGTAGAAGTGCCGTTCAATTACTTTaGGGTACACGACCAATCCTT +
Preference number: 4 (lower is better)
Translates to: KSLRGIHESSFNRVEGRSAVQLL*GTRPIL
Trigger: AAGGATTGGTCGTGTACCCCAAAGTAATTGAACGGC...ACTTCTACCCTCAACTCTGTTGAAACTACTCTCATGAATTCCTCTCAACGATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000637669.1
CDS-3UTR CCA 90 bp CCTAAAACAGTCTTCTCTCAGTTCTGGTGCATACTGAGTTTAAGATTAACTTATGCCGAGAGATCACTCTaGCAAGCTTTGGCAAAAGCA +
Preference number: 4 (lower is better)
Translates to: PKTVFSQFWCILSLRLTYAERSL*QALAKA
Trigger: TGCTTTTGCCAAAGCTTGCCAGAGTGATCTCTCGGC...ATAAGTTAATCTTAAACTCAGTATGCACCAGAACTGAGAGAAGACTGTTTTAGG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000623063.3
CDS-3UTR CCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCENRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp AGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAAACAGGAAAGCACCATaGGAAGAAGAAAGTGCTGTA +
Preference number: 4 (lower is better)
Translates to: RAESTSTLFVFALLRNVRNRKAP*EEESAV
Trigger: TACAGCACTTTCTTCTTCCCATGGTGCTTTCCTGTT...TCTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR CCA 90 bp GCTATTGGAAATACAACAAGGAATGACACAGACAACGTTCTTGTCCAATGGCACGTCTTCTCTCAGTTCTaGTGCATACTGAGTTTAAGA +
Preference number: 4 (lower is better)
Translates to: AIGNTTRNDTDNVLVQWHVFSQF*CILSLR
Trigger: TCTTAAACTCAGTATGCACCAGAACTGAGAGAAGAC...GTGCCATTGGACAAGAACGTTGTCTGTGTCATTCCTTGTTGTATTTCCAATAGC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGGCTTTTTGGGCACTaGACAACCATTAACACCTCC +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALWLFGH*TTINTS
Trigger: GGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCA...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTTGGCTTTTTGGGCACTaGACAACCATTAACACCTCC +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFWLFGH*TTINTS
Trigger: GGAGGTGTTAATGGTTGTCCAGTGCCCAAAAAGCCA...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR CCA 90 bp TTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAAACGTTTCCCAACTGTaGTCAGCTGTGCAGGCAGTA +
Preference number: 4 (lower is better)
Translates to: LKEQRSSMNYIYYARAESNVSQL*SAVQAV
Trigger: TACTGCCTGCACAGCTGACCACAGTTGGGAAACGTT...TGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623287.4
ENST00000679609.1
CDS-3UTR CCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGCTCAGTGTGTCTCTTaGGGCAACACACAATCAAGT +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRAQCVS*GNTQSS
Trigger: ACTTGATTGTGTGTTGCCCCAAGAGACACACTGAGC...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000623063.3
ENST00000679723.1
CDS-3UTR TCA 90 bp TTGACTCAATCACTGAGTCCAGGTTATTTTGCTAGACCTAGATCAAATTCACTTGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: LTQSLSPGYFARPRSNSLEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...AAGTGAATTTGATCTAGGTCTAGCAAAATAACCTGGACTCAGTGATTGAGTCAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp ATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTGAAGTAGCACCAAGGTaGATAATGCCTGCAGCTTTT +
Preference number: 4 (lower is better)
Translates to: IKYELHLLCKSRVNFNALEVAPR*IMPAAF
Trigger: AAAAGCTGCAGGCATTATTCACCTTGGTGCTACTTC...AAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTTCCATGCAAAGATCCTaGATCCAAAGACAGCAACGT +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFSMQRS*IQRQQR
Trigger: ACGTTGCTGTCTTTGGATTCAGGATCTTTGCATGGA...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TGCCTTGAAAGAACAGAGATCAAGTATGAACTACATTTACTATGCAAGAGCAGAGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: CLERTEIKYELHLLCKSRAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...TCTGCTCTTGCATAGTAAATGTAGTTCATACTTGATCTCTGTTCTTTCAAGGCA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp TCAAGTATGAACTACATTTACTATGCAAGAGCAGAGTCAACTTCAACGCTCTTTGCTGAGAAAGCACTCTaGTTTTCTCATGGCAATCCT +
Preference number: 4 (lower is better)
Translates to: SSMNYIYYARAESTSTLFAEKAL*FSHGNP
Trigger: AGGATTGCCATGAGAAAATCAGAGTGCTTTCTCAGC...AAAGAGCGTTGAAGTTGACTCTGCTCTTGCATAGTAAATGTAGTTCATACTTGA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90 bp AAGAGCAGAGTCAACTTCAACGCTCTTTGTTTTTGCCTTGTTGAGAAATGTGAGAAGCAAATGAACACGTaGAAAGGACTAAACTTGAGG +
Preference number: 4 (lower is better)
Translates to: KSRVNFNALCFCLVEKCEKQMNT*KGLNLR
Trigger: CCTCAAGTTTAGTCCTTTTCACGTGTTCATTTGCTT...CTCACATTTCTCAACAAGGCAAAAACAAAGAGCGTTGAAGTTGACTCTGCTCTT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000342312.9
ENST00000480775.3
ENST00000623063.3
ENST00000623287.4
ENST00000625194.4
ENST00000679609.1
ENST00000679723.1
ENST00000680378.1
ENST00000680444.1
CDS-3UTR TCA 90