RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ADGRV1 (Homo sapiens)

Ensembl gene IDs: ENSG00000164199

Ensembl transcript IDs: ENST00000405460.9, ENST00000425867.3, ENST00000450321.2, ENST00000504142.2, ENST00000505845.2, ENST00000507314.2, ENST00000508842.5, ENST00000509621.1, ENST00000513828.1, ENST00000638316.1, ENST00000638510.1, ENST00000638585.1, ENST00000638638.1, ENST00000638975.1, ENST00000638990.1, ENST00000639212.1, ENST00000639431.1, ENST00000639473.1, ENST00000639530.1, ENST00000639676.1, ENST00000639707.1, ENST00000639821.1, ENST00000639884.1, ENST00000640012.1, ENST00000640061.1, ENST00000640083.1, ENST00000640109.1, ENST00000640256.1, ENST00000640281.1, ENST00000640374.1, ENST00000640403.1, ENST00000640407.1, ENST00000640464.1, ENST00000640729.1, ENST00000640779.1, ENST00000640815.1

Found 1894 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp CTCCTCCACAGTGATATGTGGAACGCTGCTTGCAGGCAGGGTCATTaGGTCCTTAGGCTGAGGAGGCAGCCCTGTGGAGAACTGCAGCAA +
Preference number: 1 (lower is better)
Translates to: LLHSDMWNAACRQGH*VLRLRRQPCGELQQ
Trigger: TTGCTGCAGTTCTCCACAGGGCTGCCTCCTCAGCCTAAGGACGCAATGACCCTGCCTGCAAGCAGCGTTCCACATATCACTGTGGAGGAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
3UTR CCA 90 bp CTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGATTCTaGGTGGACTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTC +
Preference number: 1 (lower is better)
Translates to: LSQSGGTSSIAPMRF*VDLLISPPAGGIPL
Trigger: GAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CCA 90 bp CGGCTATCAGTGACCCCTGGCCATATCCTCCAGAGGACGGGAACGTaGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTGAC +
Preference number: 1 (lower is better)
Translates to: RLSVTPGHILQRTGT*LHFVDLALNQGWPD
Trigger: GTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGCCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 90 bp AACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTaGCTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACC +
Preference number: 1 (lower is better)
Translates to: NVAPFCGLGFKSGLA*LPCWKDALSQSGGT
Trigger: GGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR GCA 90 bp GCCAGGGCAACTGTCCGTGTGGAGTCTGCACATTCTCCCCATATCTaGATGGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTCCAAAG +
Preference number: 1 (lower is better)
Translates to: ARATVRVESAHSPHI*MGLSKCSSLPHIPK
Trigger: CTTTGGAATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGATATGGGGAGAATGTGCAGACTCCACACGGACAGTTGCCCTGGC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR GCA 90 bp TGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTGACTaGCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCT +
Preference number: 1 (lower is better)
Translates to: WLHFVDLALNQGWPD*PVGRMLSPSQVAPP
Trigger: AGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CCA 90 bp ACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTG +
Preference number: 1 (lower is better)
Translates to: TGTWLHFVDLALNQG*PDCPVGRMLSPSQV
Trigger: CACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 90 bp CCTTCAGTAGCTGTTCCACCAACAACACGCCATTCGACTGCCACTTaGCCTAAGCTGCCCCCTGTCCTGTGTATCATCAGCTCCACCAAG +
Preference number: 1 (lower is better)
Translates to: PSVAVPPTTRHSTAT*PKLPPVLCIISSTK
Trigger: CTTGGTGGAGCTGATGATACACAGGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAACAGCTACTGAAGG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR TCA 90 bp CAGACATCATTAGTCCTGTCCCAGAATCTCTGGCCACCTGCAGACTaGTTAAAGTGGCCTTCTTGTGAGCCACTGCCAGCCGAGAACCCA +
Preference number: 1 (lower is better)
Translates to: QTSLVLSQNLWPPAD*LKWPSCEPLPAENP
Trigger: TGGGTTCTCGGCTGGCAGTGGCTCACAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTCTGGGACAGGACTAATGATGTCTG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 90 bp TGTGGTTCATCACTGGCTTCTACTGTGAGGACAGCTGCATATCCTTaGGCATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGTC +
Preference number: 1 (lower is better)
Translates to: CGSSLASTVRTAAYP*ASSRAIPAGGTPCV
Trigger: GACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTGATGAACCACA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 90 bp GGGCAACTGTCCGTGTGGAGTCTGCACATTCTCCCCATATCTGCATaGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTCCAAAGATGT +
Preference number: 1 (lower is better)
Translates to: GQLSVWSLHILPISA*VSPSVPVSPTFQRC
Trigger: ACATCTTTGGAATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGATATGGGGAGAATGTGCAGACTCCACACGGACAGTTGCCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR CCA 90 bp AAATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGA +
Preference number: 1 (lower is better)
Translates to: KSSNSWDSSSAISDP*PYPPEDGNVAPFCG
Trigger: TCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATTT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 90 bp AATATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGGGAG +
Preference number: 1 (lower is better)
Translates to: NMKVCSVEWLVRCYR*VSAMGILLSSTIWE
Trigger: CTCCCAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATATT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
3UTR TCA 90 bp GCTAAACTGGCAAAGATACAGGTAATGTGTGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGC +
Preference number: 1 (lower is better)
Translates to: AKLAKIQVMCDSSHS*TALLSELGTCVCRR
Trigger: GCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTCACACATTACCTGTATCTTTGCCAGTTTAGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 90 bp CATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATaGACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAG +
Preference number: 1 (lower is better)
Translates to: HHHMLSTVASPGRHG*TPRTPPRGTSKEQE
Trigger: CTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR TCA 90 bp CTGCAAGCCCCCAAATGGCCTGCGAATCTGCATCTGAGACAAGAGTaGTGTTGGCAGTCCCATACACTTTATCAATTCTGGCACCACCTT +
Preference number: 1 (lower is better)
Translates to: LQAPKWPANLHLRQE*CWQSHTLYQFWHHL
Trigger: AAGGTGGTGCCAGAATTGATAAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCAGGCCATTTGGGGGCTTGCAG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 90 bp CGCAGGTCGCCAGTAGCAAGCTGTCCATTAATGGTGGCAACCCACTaGACAGTAACATTGCCGAGTGTCCCAGAATTTCGAATTATTGGC +
Preference number: 1 (lower is better)
Translates to: RRSPVASCPLMVATH*TVTLPSVPEFRIIG
Trigger: GCCAATAATTCGAAATTCTGGGACACTCGGCAATGTTACTGTTCAGTGGGTTGCCACCATTAATGGACAGCTTGCTACTGGCGACCTGCG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR TCA 90 bp GACGCCAGAAACAGAATCTGTGTACCTAAGCTGGCTGCCATCATGTaGGTCAGAAGTTTAGCTGCAAACATGGAGTACCTGGCACAGAAG +
Preference number: 1 (lower is better)
Translates to: DARNRICVPKLAAIM*VRSLAANMEYLAQK
Trigger: CTTCTGTGCCAGGTACTCCATGTTTGCAGCTAAACTTCTGACTCACATGATGGCAGCCAGCTTAGGTACACAGATTCTGTTTCTGGCGTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR GCA 90 bp GAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTaGAGTGAACAAAGCAGCATAGACGTTTGGAATAAAACACAGGTC +
Preference number: 1 (lower is better)
Translates to: EHHEHHHEARQRNKS*SEQSSIDVWNKTQV
Trigger: GACCTGTGTTTTATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR CCA 90 bp AGCATTTGTCCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCACCAC +
Preference number: 1 (lower is better)
Translates to: SICPSSEDIIICFPL*LHLVGMDEHHEHHH
Trigger: GTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGCT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR TCA 90 bp GAGCAAAATTTAAAACTCCATGTGGTTCATCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTTGAGCATCAAGCAGGGCGATTCCGG +
Preference number: 1 (lower is better)
Translates to: EQNLKLHVVHHWLLL*GQLHILEHQAGRFR
Trigger: CCGGAATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTGATGAACCACATGGAGTTTTAAATTTTGCTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 90 bp GATCCTGTCTCTGGCGTTAGGATGACATCCAATACAGTGCTTCTCTaGCCAGGTTCAAAGACCAATGTGCCTTCAGTTATCACAAAATCC +
Preference number: 1 (lower is better)
Translates to: DPVSGVRMTSNTVLL*PGSKTNVPSVITKS
Trigger: GGATTTTGTGATAACTGAAGGCACATTGGTCTTTGAACCTGGCCAGAGAAGCACTGTATTGGATGTCATCCTAACGCCAGAGACAGGATC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR GCA 90 bp TCCATTCCCCTCATGCCAAAGGCTGTTTCAGATACTGTCTCCCACTaGACACTCACAGCCAAATCAATGCCATTAGTTCGAGATACATTT +
Preference number: 1 (lower is better)
Translates to: SIPLMPKAVSDTVSH*TLTAKSMPLVRDTF
Trigger: AAATGTATCTCGAACTAATGGCATTGATTTGGCTGTGAGTGTGCAGTGGGAGACAGTATCTGAAACAGCCTTTGGCATGAGGGGAATGGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR CCA 90 bp AAAGGCCACTCTTTCTGTGCATCTTATAAGCTCTTGAGTTTTCACTaGGCCCTTGAAGGCATAGATATGGGACTCAACATGCACAGCAAG +
Preference number: 1 (lower is better)
Translates to: KGHSFCASYKLLSFH*ALEGIDMGLNMHSK
Trigger: CTTGCTGTGCATGTTGAGTCCCATATCTATGCCTTCAAGGGCCCAGTGAAAACTCAAGAGCTTATAAGATGCACAGAAAGAGTGGCCTTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638990.1
3UTR GCA 90 bp ATCCATCTCTGGGAAATCATCAGGAAGAATAGACACTGTGAGATTTaGGAATTCATCACCTTCCTGCATTATGGCCCATTGCCTTGTCAC +
Preference number: 1 (lower is better)
Translates to: IHLWEIIRKNRHCEI*EFITFLHYGPLPCH
Trigger: GTGACAAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCGCAAATCTCACAGTGTCTATTCTTCCTGATGATTTCCCAGAGATGGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 90 bp TTCTGTCACAATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTaGAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGAC +
Preference number: 1 (lower is better)
Translates to: FCHNELNCHCSKQSL*RFPNNVQYCNTLLD
Trigger: GTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTGACAGAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTaGTTCTTCAGACTCAGCATTCCAGGAACCGTGGTATATGTGACA +
Preference number: 1 (lower is better)
Translates to: IGTKSTSGSARFPTV*FFRLSIPGTVVYVT
Trigger: TGTCACATATACCACGGTTCCTGGAATGCTGAGTCTGAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 90 bp ATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTaGCACATTGTCATTGGCCAAAATGTTCACTCTAACAGTGTCGGA +
Preference number: 1 (lower is better)
Translates to: MTYDRSGSCLKANNS*HIVIGQNVHSNSVG
Trigger: TCCGACACTGTTAGAGTGAACATTTTGGCCAATGACAATGTGGCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 90 bp AGCTATTGCAGTTATTGGCACAGCTTTAAACTTCACAGAGACATCTaGAAATGCTCCTCCTGTTCTAGTCACATTGATAATGGGTCCAAC +
Preference number: 1 (lower is better)
Translates to: SYCSYWHSFKLHRDI*KCSSCSSHIDNGSN
Trigger: GTTGGACCCATTATCAATGTGACTAGAACAGGAGGAGCATTTGCAGATGTCTCTGTGAAGTTTAAAGCTGTGCCAATAACTGCAATAGCT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR CCA 90 bp GACCAATGTGCCTTCAGTTATCACAAAATCCTTTCCAGAAATAGCTaGAGATATGATGGTACGACCAATTGTTTCAGCACTCCTCAACTC +
Preference number: 1 (lower is better)
Translates to: DQCAFSYHKILSRNS*RYDGTTNCFSTPQL
Trigger: GAGTTGAGGAGTGCTGAAACAATTGGTCGTACCATCATATCTCCAGCTATTTCTGGAAAGGATTTTGTGATAACTGAAGGCACATTGGTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR CCA 90 bp AGTCACTTCAGCAAAGTGACTGAATCCCCTAGTGTCCTTGCGCTTTaGGTTAATAAGAGAACAAAGAATCTCATAGAAAAGAGTTCGGCT +
Preference number: 1 (lower is better)
Translates to: SHFSKVTESPSVLAL*VNKRTKNLIEKSSA
Trigger: AGCCGAACTCTTTTCTATGAGATTCTTTGTTCTCTTATTAACCCAAAGCGCAAGGACACTAGGGGATTCAGTCACTTTGCTGAAGTGACT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR CCA 90 bp GCATACACAAATAAGGAAACATGGCCAAGAGGTTCTCTGCTCCTCTaGGCTACCAATGTTAAACTTCCATGGGTTTCATTTACTTCAAAC +
Preference number: 1 (lower is better)
Translates to: AYTNKETWPRGSLLL*ATNVKLPWVSFTSN
Trigger: GTTTGAAGTAAATGAAACCCATGGAAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTATTTGTGTATGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 90 bp AATTCTGAGCATACACAAATAAGGAAACATGGCCAAGAGGTTCTCTaGTCCTCTGGGCTACCAATGTTAAACTTCCATGGGTTTCATTTA +
Preference number: 1 (lower is better)
Translates to: NSEHTQIRKHGQEVL*SSGLPMLNFHGFHL
Trigger: TAAATGAAACCCATGGAAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTATTTGTGTATGCTCAGAATT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 90 bp CACATTGTCATTGGCCAAAATGTTCACTCTAACAGTGTCGGAGCTTaGCAAAATTCTACTTCCACCTTCAGTGTACACCAAACTAACTAT +
Preference number: 1 (lower is better)
Translates to: HIVIGQNVHSNSVGA*QNSTSTFSVHQTNY
Trigger: ATAGTTAGTTTGGTGTACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAACATTTTGGCCAATGACAATGTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 90 bp ACTTTATCAATTCTGGCACCACCTTTTGGGTCAAAAAGGACAATCTaGAAGCGTTTAGGAAATGAATTTAAAGATCCTGTCTCTGGCGTT +
Preference number: 1 (lower is better)
Translates to: TLSILAPPFGSKRTI*KRLGNEFKDPVSGV
Trigger: AACGCCAGAGACAGGATCTTTAAATTCATTTCCTAAACGCTTCCAGATTGTCCTTTTTGACCCAAAAGGTGGTGCCAGAATTGATAAAGT
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 90 bp GCCGAGTGTCCCAGAATTTCGAATTATTGGCAGGTTTACCTTCACTaGGTTAAACTCAGGTTCCTCTACAATAAGTTTAGTAATCTGAAA +
Preference number: 1 (lower is better)
Translates to: AECPRISNYWQVYLH*VKLRFLYNKFSNLK
Trigger: TTTCAGATTACTAAACTTATTGTAGAGGAACCTGAGTTTAACTCAGTGAAGGTAAACCTGCCAATAATTCGAAATTCTGGGACACTCGGC
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR TCA 90 bp GTTTGGAATAAAACACAGGTCACCATGAATGAGTCCATAGATCTGTaGCATGCTCTGATGATAGATTCCTTTCAAAATAACTATGAGGAG +
Preference number: 1 (lower is better)
Translates to: VWNKTQVTMNESIDL*HALMIDSFQNNYEE
Trigger: CTCCTCATAGTTATTTTGAAAGGAATCTATCATCAGAGCATGTCACAGATCTATGGACTCATTCATGGTGACCTGTGTTTTATTCCAAAC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR GCA 90 bp AACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCTAGTTaGAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATG +
Preference number: 1 (lower is better)
Translates to: NRQTILQFSELKSSS*SEVLNLDHLDSCKM
Trigger: CATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR-3UTR TCA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCC +
Preference number: 2 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLLIGYQ*PLAISS
Trigger: GGAGGATATGGCCAGGGGTCACTGATAGCCGATGAG...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CAA 90 bp TCAGGTGGCACCTCCTCCATAGCACCGATGAGATTCTGGGTGGACTaGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGGGCGTG +
Preference number: 2 (lower is better)
Translates to: SGGTSSIAPMRFWVD*LISPPAGGIPLPGV
Trigger: CACGCCCGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGTGCCACCTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTGCAAGCCCCCAAATaGCCTGCGAATCTGCATCTG +
Preference number: 2 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLLQAPK*PANLHL
Trigger: CAGATGCAGATTCGCAGGCCATTTGGGGGCTTGCAG...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 2 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDERWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAG +
Preference number: 2 (lower is better)
Translates to: PLWLHLVGMDEHHEHHHEDSSHS*TALLSE
Trigger: CTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTC...CTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGG
58% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR GCA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCGAATCTCTGGCCACCTaGAGACTGATTAAAGTGGCC +
Preference number: 2 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLESLAT*RLIKVA
Trigger: GGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTC...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp CCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCATTTTCACTGGGCCCTTaGAGGCATAGATATGGGACT +
Preference number: 2 (lower is better)
Translates to: PPAGGIPLPGVKKAVLGPFSLGP*RHRYGT
Trigger: AGTCCCATATCTATGCCTTCAAGGGCCCAGTGAAAA...TGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000638990.1
3UTR-3UTR TCA 90 bp CCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGCTGGCTGCCATCATGTaGGTCAGAAGTTTAGCTGCA +
Preference number: 2 (lower is better)
Translates to: PCWKDALSQSGGTSSIAPLAAIM*VRSLAA
Trigger: TGCAGCTAAACTTCTGACTCACATGATGGCAGCCAG...CGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CCCCTCCTGGCTGCCTTGACCAGATTCATTATCACTGACACTGAGACCAGCACCTCTGGGTGGACTTGCTaGTTTCCCCTCCAGCAGGAG +
Preference number: 2 (lower is better)
Translates to: PLLAALTRFIITDTETSTSGWTC*FPLQQE
Trigger: CTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGA...GGTGCTGGTCTCAGTGTCAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CAA 90 bp GGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTaGGCTTTAAATCAGGGCTGGCCTGACTGCCCTGTTGGAAGGATG +
Preference number: 2 (lower is better)
Translates to: GHILQRTGTWLHFVD*ALNQGWPDCPVGRM
Trigger: CATCCTTCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp CCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGA +
Preference number: 2 (lower is better)
Translates to: PGHILQRTGTWLHFVDLAALNQG*PDCPVG
Trigger: TCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGC...AGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp GAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 2 (lower is better)
Translates to: EHHHEARQRNKSCSEQSSPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...GCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTAAAGTGGCCTTCTTGTaGGCCACTGCCAGCCGAGAA +
Preference number: 2 (lower is better)
Translates to: LLSELGTCVCRRQKQNLCKVAFL*ATASRE
Trigger: TTCTCGGCTGGCAGTGGCTCACAAGAAGGCCACTTT...ACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGTGGCCACCTGCAGACTaGTTAAAGTGGCCTTCTTGT +
Preference number: 2 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDEWPPAD*LKWPSC
Trigger: ACAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCA...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR GCA 90 bp AGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTCTTCTTGTGAGCCACTaGCAGCCGAGAACCCACAGA +
Preference number: 2 (lower is better)
Translates to: RTGTWLHFVDLALNQGWPLLVSH*QPRTHR
Trigger: TCTGTGGGTTCTCGGCTGGCAGTGGCTCACAAGAAG...AGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CCA 90 bp AGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 2 (lower is better)
Translates to: RTGTWLHFVDLALNQGWPLSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...AGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp AGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTCAGCTTGCAGCAGCCTaGTTCCAAAGGAGACACAGA +
Preference number: 2 (lower is better)
Translates to: RTGTWLHFVDLALNQGWPQLAAA*FQRRHR
Trigger: TCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTG...AGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR GCA 90 bp TCTGCATGGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTCCAAAGATGTGCAAGTGTGACTGTGCCCTaGGATGGGATGGAGTCCTGT +
Preference number: 2 (lower is better)
Translates to: SAWVSPSVPVSPTFQRCASVTVP*DGMESC
Trigger: ACAGGACTCCATCCCATCGCAGGGCACAGTCACACT...TGCACATCTTTGGAATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR-3UTR GCA 90 bp GGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCCAAAGTGGGTCAGGCACCAGAGACATCTGCAAATaGTCCTCCTGTTCTAGTCAC +
Preference number: 2 (lower is better)
Translates to: GSPTAETFIQVLQSGSGTRDICK*SSCSSH
Trigger: GTGACTAGAACAGGAGGAGCATTTGCAGATGTCTCT...GGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR CAA 90 bp CACTGTGAGATTTGCGAATTCATCACCTTCCTGCATTATGGCCCATaGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGACC +
Preference number: 2 (lower is better)
Translates to: HCEICEFITFLHYGP*PCHRLIVTPSHSLT
Trigger: GGTCAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCGCAAATCTCACAGTG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CAA 90 bp ATGTGGTTCATCACTGGCTTCTACTGTGAGGACAGCTGCATATCCTaGAGCATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGT +
Preference number: 2 (lower is better)
Translates to: MWFITGFYCEDSCIS*SIKQGDSGWWNSLC
Trigger: ACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTGATGAACCACAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp GTCCCCAACTCAGAAGGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 2 (lower is better)
Translates to: VPNSEGKTADIASLCAHHRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...ATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCCTTCTGAGTTGGGGAC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCACCACGAGACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 2 (lower is better)
Translates to: PLWLHLVGMDEHHEHHHETGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...CTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGG
52% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp GTCAGGTGGCACCTCCTCCATAGCACCGATGAGATTCTGGGTGGACTTGCTGATTCTCTGGCGTTAGGATaGCATCCAATACAGTGCTTC +
Preference number: 2 (lower is better)
Translates to: VRWHLLHSTDEILGGLADSLALG*HPIQCF
Trigger: GAAGCACTGTATTGGATGTCATCCTAACGCCAGAGA...ATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGTGCCACCTGAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp CTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTGTCACTTCAGCAAAGTaGCTGAATCCCCTAGTGTCC +
Preference number: 2 (lower is better)
Translates to: LLSELGTCVCRRQKQNLCVTSAK*LNPLVS
Trigger: GGACACTAGGGGATTCAGTCACTTTGCTGAAGTGAC...ACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR GCA 90 bp AATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCATATCGTGCTGGGTCCAGGATaGCCATTCATTTCCACAGTG +
Preference number: 2 (lower is better)
Translates to: NHQTPGTPHRLSVTPGHIVLGPG*PFISTV
Trigger: CACTGTGGAAATGAATGGGCATCCTGGACCCAGCAC...GATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp CCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCACTTATAAACCACTGTTaGCTGCTATACTCTGTAAAC +
Preference number: 2 (lower is better)
Translates to: PPAGGIPLPGVKKAVLGPLINHC*LLYSVN
Trigger: GTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAG...TGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGAGGCGATTCCGGCTGGTaGAACTCCTTGTGTCCTGAC +
Preference number: 2 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRGDSGW*NSLCPD
Trigger: GTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCC...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp AATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTGCACTTGGATAACCTaGGACAACTCGCAGGTCGCC +
Preference number: 2 (lower is better)
Translates to: NPCAGSRTMYNTATLSWTCTWIT*DNSQVA
Trigger: GGCGACCTGCGAGTTGTCTCAGGTTATCCAAGTGCA...CGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR CCA 90 bp CCAACATCCAGAAGTGTCTGTAGGCCATGTGTAGTCCTCCCCAAAGCCATGTCAGCACCGATGAGATTCTaGGTGGACTTGCTGATTTCC +
Preference number: 2 (lower is better)
Translates to: PTSRSVCRPCVVLPKAMSAPMRF*VDLLIS
Trigger: GGAAATCAGCAAGTCCACCCAGAATCTCATCGGTGC...TGACATGGCTTTGGGGAGGACTACACATGGCCTACAGACACTTCTGGATGTTGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp CCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCATCAAAAAGGACAATCTaGAAGCGTTTAGGAAATGAA +
Preference number: 2 (lower is better)
Translates to: PPAGGIPLPGVKKAVLGPSKRTI*KRLGNE
Trigger: TTCATTTCCTAAACGCTTCCAGATTGTCCTTTTTGA...TGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR CAA 90 bp AGCCCCCAAATGGCCTGCGAATCTGCATCTGAGACAAGAGTGATGTaGGCAGTCCCATACACTTTATCAATTCTGGCACCACCTTTTGGG +
Preference number: 2 (lower is better)
Translates to: SPQMACESASETRVM*AVPYTLSILAPPFG
Trigger: CCCAAAAGGTGGTGCCAGAATTGATAAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCAGGCCATTTGGGGGCT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp CCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCACCACGAGTATGGAGCACTCTGTTaGGAATATCATCATTCACAG +
Preference number: 2 (lower is better)
Translates to: PLWLHLVGMDEHHEHHHEYGALC*EYHHSQ
Trigger: CTGTGAATGATGATATTCTCAACAGAGTGCTCCATA...CTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGG
50% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp ATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGTCCTGACATCATACAGCAGGTTTACCTTCACTaGGTTAAACTCAGGTTCCTC +
Preference number: 2 (lower is better)
Translates to: IKQGDSGWWNSLCPDIIQQVYLH*VKLRFL
Trigger: GAGGAACCTGAGTTTAACTCAGTGAAGGTAAACCTG...CTGTATGATGTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR GCA 90 bp TGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACAGCCGACCAAAGTaGCCTCCGCTTCGCCTGACA +
Preference number: 2 (lower is better)
Translates to: CHCSKQSLCRFPNNVQYCNSRPK*PPLRLT
Trigger: TGTCAGGCGAAGCGGAGGGCACTTTGGTCGGCTGTT...GCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCAACAGCCGACCAAAGTaGCCTCCGCTTCGCCTGACA +
Preference number: 2 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCNSRPK*PPLRLT
Trigger: TGTCAGGCGAAGCGGAGGGCACTTTGGTCGGCTGTT...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp CCCAAATGCTCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGACAGACTGAGAAAGACTaGTGGGCTGTCTGCTTGAGC +
Preference number: 2 (lower is better)
Translates to: PKCSSLHGVDLGVPKGFRQTEKD*WAVCLS
Trigger: GCTCAAGCAGACAGCCCAGCAGTCTTTCTCAGTCTG...TCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGAGCATTTGGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR CCA 90 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCGTGTGCTCAGTCGAATaGTTAGTGAGGTGCTACAGG +
Preference number: 2 (lower is better)
Translates to: PSSEDIIICFPLWLHLVGVCSVE*LVRCYR
Trigger: CCTGTAGCACCTCACTAACCATTCGACTGAGCACAC...GCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp GAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCAGCAGCATAGACGTTTaGAATAAAACACAGGTCACC +
Preference number: 2 (lower is better)
Translates to: EDGNVAPFCGLGFKSGLASSIDV*NKTQVT
Trigger: GGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCT...GGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 2 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDEKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTATACACAGACATGTGTaGACAGGCACATTCCACATA +
Preference number: 2 (lower is better)
Translates to: LLSELGTCVCRRQKQNLCIHRHV*TGTFHI
Trigger: TATGTGGAATGTGCCTGTTCACACATGTCTGTGTAT...ACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp AATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGGTAGGTCCAGAAGTCTaGATTGTTGACAGCTGGGCT +
Preference number: 2 (lower is better)
Translates to: NPCAGSRTMYNTATLSWTVGPEV*IVDSWA
Trigger: AGCCCAGCTGTCAACAATTCAGACTTCTGGACCTAC...CGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp AACATCCATTCCCCTCATGCCAAAGGCTGTTTCAGATACTGTCTCCCACTGCACGTTTGGGGCTGCTCCTaGACTTCAACAAATAAGCCA +
Preference number: 2 (lower is better)
Translates to: NIHSPHAKGCFRYCLPLHVWGCS*TSTNKP
Trigger: TGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAAC...GTGCAGTGGGAGACAGTATCTGAAACAGCCTTTGGCATGAGGGGAATGGATGTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR-3UTR CCA 90 bp ATTAAATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCAATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATG +
Preference number: 2 (lower is better)
Translates to: IKSSNSWDSSSAISDPWPICFPL*LHLVGM
Trigger: CATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT...TGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATTTAAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGACCAAGTTCTCCAAAGTaGGTCAGGCACCCCTTGAAT +
Preference number: 2 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRPSSPK*VRHPLN
Trigger: ATTCAAGGGGTGCCTGACCCACTTTGGAGAACTTGG...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CAA 90 bp TCCATGAAAGCAGCACCCAAATGCTCAAGCCTTCATGGAGTTGATTaGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCTTCACCATTCCT +
Preference number: 2 (lower is better)
Translates to: SMKAAPKCSSLHGVD*GVPKGFRIPLFTIP
Trigger: AGGAATGGTGAAGAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGAGCATTTGGGTGCTGCTTTCATGGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR TCA 90 bp CCAACATCCAGAAGTGTCTGTAGGCCATGTGTAGTCCTCCCCAAAGCCATGTCAATTAGTCAGGAGTTGTaGACTCTGACCTTTCACACT +
Preference number: 2 (lower is better)
Translates to: PTSRSVCRPCVVLPKAMSISQEL*TLTFHT
Trigger: AGTGTGAAAGGTCAGAGTTCACAACTCCTGACTAAT...TGACATGGCTTTGGGGAGGACTACACATGGCCTACAGACACTTCTGGATGTTGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGGAAGGCTTCATTGTATaGAGACAAGTTGTCAGTCCG +
Preference number: 2 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQEGFIV*RQVVSP
Trigger: CGGACTGACAACTTGTCTTCATACAATGAAGCCTTC...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
48% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTAGCCAAGCAAAGACCTaGGATACATATAAATCCAGA +
Preference number: 2 (lower is better)
Translates to: LLSELGTCVCRRQKQNLCSQAKT*DTYKSR
Trigger: TCTGGATTTATATGTATCTCAGGTCTTTGCTTGGCT...ACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp CCAGCACCTATAAAATCTAAACCTTCAGTAGCTGTTCCACCAACAACACGCCATCTCCCAGCCACAGCCTaGCCACTAAAAAGAGATGCT +
Preference number: 2 (lower is better)
Translates to: PAPIKSKPSVAVPPTTRHLPATA*PLKRDA
Trigger: AGCATCTCTTTTTAGTGGTCAGGCTGTGGCTGGGAG...ATGGCGTGTTGTTGGTGGAACAGCTACTGAAGGTTTAGATTTTATAGGTGCTGG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp ATGTCTATGGAGGTGGCTCTATTTTCAACTGCAGAGATACTGAATAGCCCCAAAGGCCAAGAGGTTCTCTaGTCCTCTGGGCTACCAATG +
Preference number: 2 (lower is better)
Translates to: MSMEVALFSTAEILNSPKGQEVL*SSGLPM
Trigger: CATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCC...TTTGGGGCTATTCAGTATCTCTGCAGTTGAAAATAGAGCCACCTCCATAGACAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR-3UTR GCA 90 bp AAAGCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGGCCACAGGACATCCATaGATTCTGATCACCCACCCC +
Preference number: 2 (lower is better)
Translates to: KAAVSKNLWTLTEDILYRATGHP*ILITHP
Trigger: GGGGTGGGTGATCAGAATGCATGGATGTCCTGTGGC...CCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGCTTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR CCA 90 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCGCACAGCAAGGTAGATaGTTCACATCTAAGACAACC +
Preference number: 2 (lower is better)
Translates to: PSSEDIIICFPLWLHLVGAQQGR*FTSKTT
Trigger: GGTTGTCTTAGATGTGAACCATCTACCTTGCTGTGC...GCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638990.1
3UTR-3UTR CCA 90 bp GACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTAAGCTGGCTGCCAATTATTTCTGCATCCTaGACATCCAGTAGCCTCTCT +
Preference number: 2 (lower is better)
Translates to: DLRMQTPETESVYLSWLPIISAS*TSSSLS
Trigger: AGAGAGGCTACTGGATGTCCAGGATGCAGAAATAAT...TGGCAGCCAGCTTAGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGCTGGCACAGAAGATATaGGAAAGAACAGCCAAGCAA +
Preference number: 2 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQLAQKI*ERTAKQ
Trigger: TTGCTTGGCTGTTCTTTCCCATATCTTCTGTGCCAG...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp AGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 2 (lower is better)
Translates to: RTGTWLHFVDLALNQGWPKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...AGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp TCATCCAAAAGGACCAGATTTTACAGCGTTATATCTGTAGATAGATCTAGCAGAATTGCGTCCTTAGGCTaGGGAGGCAGCCCTGTGGAG +
Preference number: 2 (lower is better)
Translates to: SSKRTRFYSVISVDRSSRIASLG*GGSPVE
Trigger: CTCCACAGGGCTGCCTCCTCAGCCTAAGGACGCAAT...TCTGCTAGATCTATCTACAGATATAACGCTGTAAAATCTGGTCCTTTTGGATGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000450321.2
3UTR-3UTR TCA 90 bp AATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCATATCGTGAAGAGCCAATATTaGCAAATATGGGCAACTATC +
Preference number: 2 (lower is better)
Translates to: NHQTPGTPHRLSVTPGHIVKSQY*QIWATI
Trigger: GATAGTTGCCCATATTTGTCAATATTGGCTCTTCAC...GATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp TCTCTTAGGAAAAAGTGCTCACTGTTGTTAAATGATAGAACTCCAGGGCCGTCACTCCCAGCCACAGCCTaGCCACTAAAAAGAGATGCT +
Preference number: 2 (lower is better)
Translates to: SLRKKCSLLLNDRTPGPSLPATA*PLKRDA
Trigger: AGCATCTCTTTTTAGTGGTCAGGCTGTGGCTGGGAG...TGACGGCCCTGGAGTTCTATCATTTAACAACAGTGAGCACTTTTTCCTAAGAGA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp CTCCTCAGGAATGTTGTCATCCAACAAATGCACAAACAATGTTGTATTCAACGACATTCGACTGCCACTTaGCCTAAGCTGCCCCCTGTC +
Preference number: 2 (lower is better)
Translates to: LLRNVVIQQMHKQCCIQRHSTAT*PKLPPV
Trigger: GACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATG...TCGTTGAATACAACATTGTTTGTGCATTTGTTGGATGACAACATTCCTGAGGAG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp GAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCTATCAAGGATGGTTTTaGTTCAGACATTGTTCTAGG +
Preference number: 2 (lower is better)
Translates to: EHHHEARQRNKSCSEQSSYQGWF*FRHCSR
Trigger: CCTAGAACAATGTCTGAAGCAAAACCATCCTTGATA...GCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638990.1
3UTR-3UTR GCA 90 bp GCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACGTTTGGAATTATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 2 (lower is better)
Translates to: ARQRNKSCSEQSSIDVWNYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...ATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR GCA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGATTGACCTTCCTCCATTaGCAGAGCCACTACATCAAT +
Preference number: 2 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRLTFLH*QSHYIN
Trigger: ATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAA...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCCCACTTGACCTAAGCTaGCCCCTGTCCTGTGTATCA +
Preference number: 2 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFPLDLS*PLSCVS
Trigger: TGATACACAGGACAGGGGGCAGCTTAGGTCAAGTGG...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp ATCCACTTCTCTTTTTCCATTTTTGTACTGTTTAGCCTTGAGAGCTGTCGGATAGGGCAACTGTCCGTGTaGAGTCTGCACATTCTCCCC +
Preference number: 2 (lower is better)
Translates to: IHFSFSIFVLFSLESCRIGQLSV*SLHILP
Trigger: GGGGAGAATGTGCAGACTCCACACGGACAGTTGCCC...TATCCGACAGCTCTCAAGGCTAAACAGTACAAAAATGGAAAAAGAGAAGTGGAT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR-3UTR CCA 90 bp AATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTTAAAGCCCCTAGTCTaGCTCCTCCTGTTGTTTCAT +
Preference number: 2 (lower is better)
Translates to: NPCAGSRTMYNTATLSWTLKPLV*LLLLFH
Trigger: ATGAAACAACAGGAGGAGCCAGACTAGGGGCTTTAA...CGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR TCA 90 bp GCCATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAGACACAGAGATGTCTaGGGAATAATTCTAGGCTCA +
Preference number: 2 (lower is better)
Translates to: AMCSPPQSHVTEIRAKRYRHRDV*GIILGS
Trigger: TGAGCCTAGAATTATTCCTCAGACATCTCTGTGTCT...ATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACATGGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp GAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATAAGCTGGGCTGATCCATaGTGTCATCCAGAAACACTG +
Preference number: 2 (lower is better)
Translates to: ELSLFQTILVQVPEQCTISWADP*CHPETL
Trigger: CAGTGTTTCTGGATGACATCATGGATCAGCCCAGCT...TATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp TGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCGTTTGGGGCTGCTCCTaGACTTCAACAAATAAGCCA +
Preference number: 2 (lower is better)
Translates to: CHCSKQSLCRFPNNVQYCVWGCS*TSTNKP
Trigger: TGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAAC...GCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp TGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCCTCCTTCATGACCTATaGCAGATCTGGAAGCTGTCT +
Preference number: 2 (lower is better)
Translates to: CHCSKQSLCRFPNNVQYCLLHDL*QIWKLS
Trigger: AGACAGCTTCCAGATCTGTCATAGGTCATGAAGGAG...GCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATTTCTGTGGTTCAGACTaGGAAAGACTGCTGGGCTGT +
Preference number: 2 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNFCGSD*ERLLGC
Trigger: ACAGCCCAGCAGTCTTTCTCAGTCTGAACCACAGAA...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR GCA 90 bp AACATCCATTCCCCTCATGCCAAAGGCTGTTTCAGATACTGTCTCCCACTGCACAAAGCTAACAATTCCTaGCACATTGTCATTGGCCAA +
Preference number: 2 (lower is better)
Translates to: NIHSPHAKGCFRYCLPLHKANNS*HIVIGQ
Trigger: TTGGCCAATGACAATGTGGCAGGAATTGTTAGCTTT...GTGCAGTGGGAGACAGTATCTGAAACAGCCTTTGGCATGAGGGGAATGGATGTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR-3UTR CCA 90 bp GTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGTTCCTATTACACAGGTaGATGTACTTAGAGAGTTTT +
Preference number: 2 (lower is better)
Translates to: VGMDEHHEHHHEARQRNKFLLHR*MYLESF
Trigger: AAAACTCTCTAAGTACATCCACCTGTGTAATAGGAA...CTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGA +
Preference number: 2 (lower is better)
Translates to: IIQYNSQVPITQVDVLREALNQG*PDCPVG
Trigger: TCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp CACAATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACGGTTCTCTGCTCCTCTaGGCTACCAATGTTAAACTT +
Preference number: 2 (lower is better)
Translates to: HNELNCHCSKQSLCRFPNGSLLL*ATNVKL
Trigger: AAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACC...GTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp CACAATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACCGATGTCTATGGAGGTaGCTCTATTTTCAACTGCAG +
Preference number: 2 (lower is better)
Translates to: HNELNCHCSKQSLCRFPNRCLWR*LYFQLQ
Trigger: CTGCAGTTGAAAATAGAGCCACCTCCATAGACATCG...GTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR CAA 90 bp AGACATTCATCCAAGTTCTCCAAAGTGGGTCAGGCACCCCTTGAATaGGAGATTCATAGTAGGACAGTAAATCTTGACCTTCCTCCATTG +
Preference number: 2 (lower is better)
Translates to: RHSSKFSKVGQAPLE*EIHSRTVNLDLPPL
Trigger: CAATGGAGGAAGGTCAAGATTTACTGTCCTACTATGAATCTCCAATTCAAGGGGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CAA 90 bp CACTTCTGTCACAATGAACTGAACTGTCACTGTTCCAAACAATCCTaGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTG +
Preference number: 2 (lower is better)
Translates to: HFCHNELNCHCSKQS*CRFPNNVQYCNTLL
Trigger: CAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTGACAGAAGTG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp CCATTTTTGTACTGTTTAGCCTTGAGAGCTGTCGGATACAGGAAATGCAGGTTATCAATGATTCCAGTCTaGGTGAGTGTGGGTGTGAGT +
Preference number: 2 (lower is better)
Translates to: PFLYCLALRAVGYRKCRLSMIPV*VSVGVS
Trigger: ACTCACACCCACACTCACTCAGACTGGAATCATTGA...TAACCTGCATTTCCTGTATCCGACAGCTCTCAAGGCTAAACAGTACAAAAATGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR-3UTR TCA 90 bp GCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACGTTTGGAATATTAGTCAGGAGTTGTaGACTCTGACCTTTCACACT +
Preference number: 2 (lower is better)
Translates to: ARQRNKSCSEQSSIDVWNISQEL*TLTFHT
Trigger: AGTGTGAAAGGTCAGAGTTCACAACTCCTGACTAAT...ATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp GCCATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAGCCAAGCAAAGACCTaGGATACATATAAATCCAGA +
Preference number: 2 (lower is better)
Translates to: AMCSPPQSHVTEIRAKRYSQAKT*DTYKSR
Trigger: TCTGGATTTATATGTATCTCAGGTCTTTGCTTGGCT...ATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACATGGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp ATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAAACATCTGAGACAAGAGTaGTGTTGGCAGTCCCATACA +
Preference number: 2 (lower is better)
Translates to: MCSPPQSHVTEIRAKRYKHLRQE*CWQSHT
Trigger: TGTATGGGACTGCCAACATCACTCTTGTCTCAGATG...TTTATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp CACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACATTGGTGCTGAGAGCTaGAGAGTTCCAAATGCATCA +
Preference number: 2 (lower is better)
Translates to: HCSKQSLCRFPNNVQYCNIGAES*RVPNAS
Trigger: TGATGCATTTGGAACTCTTCAGCTCTCAGCACCAAT...GTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR TCA 90 bp TCTACTTCCACCTTCAGTGTACACCAAACTAACTATGATACTTTCGTCATCCTCATGGTGGCAACCCACTaGACAGTAACATTGCCGAGT +
Preference number: 2 (lower is better)
Translates to: STSTFSVHQTNYDTFVILMVATH*TVTLPS
Trigger: ACTCGGCAATGTTACTGTTCAGTGGGTTGCCACCAT...GAGGATGACGAAAGTATCATAGTTAGTTTGGTGTACACTGAAGGTGGAAGTAGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR TCA 90 bp CCAGGGCCGTCATCATTAGCAAGGACAATAATTAAGGCTATTGTATTTTTCCCTAGCTGGGCTGATCCATaGTGTCATCCAGAAACACTG +
Preference number: 2 (lower is better)
Translates to: PGPSSLARTIIKAIVFFPSWADP*CHPETL
Trigger: CAGTGTTTCTGGATGACATCATGGATCAGCCCAGCT...AGGGAAAAATACAATAGCCTTAATTATTGTCCTTGCTAATGATGACGGCCCTGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATAAGCCTTCATGGAGTTaGTTTGGGTGTTCCCAAAGG +
Preference number: 2 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNKPSWS*FGCSQR
Trigger: CCTTTGGGAACACCCAAATCAACTCCATGAAGGCTT...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR GCA 90 bp AAAGCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGACATGTCCATGGGTGTaGAGGTGTATATGCACACCA +
Preference number: 2 (lower is better)
Translates to: KAAVSKNLWTLTEDILYRTCPWV*RCICTP
Trigger: TGGTGTGCATATACACCTGCACACCCATGGACATGT...CCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGCTTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR CCA 90 bp GTCAGTTTCCCAAGGAACTACAACAGGTCTTCAAATCACACAGTTTCACTCAATCTCCCCATATCTGCATaGGTCTCTCCAAGTGTTCCA +
Preference number: 2 (lower is better)
Translates to: VSFPRNYNRSSNHTVSLNLPISA*VSPSVP
Trigger: TGGAACACTTGGAGAGACCCATGCAGATATGGGGAG...ATTGAGTGAAACTGTGTGATTTGAAGACCTGTTGTAGTTCCTTGGGAAACTGAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGCACCGATGAGATTCTaGGTGGACTTGCTGATTTCC +
Preference number: 2 (lower is better)
Translates to: IIQYNSQVPITQVDVLREAPMRF*VDLLIS
Trigger: GGAAATCAGCAAGTCCACCCAGAATCTCATCGGTGC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp ATCCAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGGTCATCCAGAAACACTaGGGACCCTCAGAAGCACTG +
Preference number: 2 (lower is better)
Translates to: IQQMHKQCCIQRPLRKEKVIQKH*GPSEAL
Trigger: CAGTGCTTCTGAGGGTCCCCAGTGTTTCTGGATGAC...CTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTGGAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp AATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGCTTCTTCGATGTCTATaGAGGTGGCTCTATTTTCAA +
Preference number: 2 (lower is better)
Translates to: NPCAGSRTMYNTATLSWTLLRCL*RWLYFQ
Trigger: TTGAAAATAGAGCCACCTCCATAGACATCGAAGAAG...CGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR-3UTR TCA 90 bp CTGTTGTTAAATGATAGAACTCCAGGGCCGTCATCATTAGCAAGGACAATAATTCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTT +
Preference number: 2 (lower is better)
Translates to: LLLNDRTPGPSSLARTIIHWLLL*GQLHIL
Trigger: AAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTG...AATTATTGTCCTTGCTAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp TTCACCAGGAAATATTCTTCTAGCTCTGGTACATCATCCTCAAGAATGGTAATGCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTT +
Preference number: 2 (lower is better)
Translates to: FTRKYSSSSGTSSSRMVMHWLLL*GQLHIL
Trigger: AAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTG...CATTACCATTCTTGAGGATGATGTACCAGAGCTAGAAGAATATTTCCTGGTGAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR TCA 90 bp GTACAGGAATGTAGGAATAGCTATGAAACCCATGTCTCACTAAGAAGACCCCATCAGAGCAGCCTGCTATaGTTTCTCCTCATTACCATT +
Preference number: 2 (lower is better)
Translates to: VQECRNSYETHVSLRRPHQSSLL*FLLITI
Trigger: AATGGTAATGAGGAGAAATCATAGCAGGCTGCTCTG...ATGGGGTCTTCTTAGTGAGACATGGGTTTCATAGCTATTCCTACATTCCTGTAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR TCA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATAATAACACACCTCCATaGAAGCAGCACCCAAATGCT +
Preference number: 2 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNNNTPP*KQHPNA
Trigger: AGCATTTGGGTGCTGCTTTCATGGAGGTGTGTTATT...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR GCA 90 bp GTACAGGAATGTAGGAATAGCTATGAAACCCATGTCTCACTAAGAAGACCCCATCTTGGCAGAGCAGCCTaGTATGATTTCTCCTCATTA +
Preference number: 2 (lower is better)
Translates to: VQECRNSYETHVSLRRPHLGRAA*YDFSSL
Trigger: TAATGAGGAGAAATCATAGCAGGCTGCTCTGCCAAG...ATGGGGTCTTCTTAGTGAGACATGGGTTTCATAGCTATTCCTACATTCCTGTAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR GCA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATTCCAGTGGCAATGAATaGCATAATGCATGCACAGAG +
Preference number: 2 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNSSGNE*HNACTE
Trigger: CTCTGTGCATGCATTATGGCATTCATTGCCACTGGA...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR CCA 90 bp CCAGCACCTATAAAATCTAAACCTTCAGTAGCTGTTCCACCAACAACACGCCATAAAGAGATGCTACCCTaGTCATGTTTTTCCTGTAGG +
Preference number: 2 (lower is better)
Translates to: PAPIKSKPSVAVPPTTRHKEMLP*SCFSCR
Trigger: CCTACAGGAAAAACATGACCAGGGTAGCATCTCTTT...ATGGCGTGTTGTTGGTGGAACAGCTACTGAAGGTTTAGATTTTATAGGTGCTGG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp ATAATTAATCCCAATGCCATAATGCATCCAGTGGCAATGAATGCCATAATGCATACTGAGAAAGACTGCTaGGCTGTCTGCTTGAGCCAC +
Preference number: 2 (lower is better)
Translates to: IINPNAIMHPVAMNAIMHTEKDC*AVCLSH
Trigger: GTGGCTCAAGCAGACAGCCCAGCAGTCTTTCTCAGT...ATGCATTATGGCATTCATTGCCACTGGATGCATTATGGCATTGGGATTAATTAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR CAA 90 bp GAATTGGAGATTCATAGTAGGACAGTAAATCTTGACCTTCCTCCATaGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACA +
Preference number: 2 (lower is better)
Translates to: ELEIHSRTVNLDLPP*PEPLHQCRKYCRTT
Trigger: TGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATTTACTGTCCTACTATGAATCTCCAATTC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp ATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAAAGAAGACATCATCATATaGTTTCCACTGTGGCTTCAC +
Preference number: 2 (lower is better)
Translates to: MCSPPQSHVTEIRAKRYKEDIII*FPLWLH
Trigger: GTGAAGCCACAGTGGAAAGCATATGATGATGTCTTC...TTTATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR GCA 90 bp TTTGCTGAGGATACCAGTGAAGAGCCAATATTGACAAATATGGGCAACTATCAAGGCACTGTTGTTTATTaGTGCTCCAGCAGTAGCTTC +
Preference number: 2 (lower is better)
Translates to: FAEDTSEEPILTNMGNYQGTVVY*CSSSSF
Trigger: GAAGCTACTGCTGGAGCAGCAATAAACAACAGTGCC...TTGATAGTTGCCCATATTTGTCAATATTGGCTCTTCACTGGTATCCTCAGCAAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR GCA 90 bp TCTACTTCCACCTTCAGTGTACACCAAACTAACTATGATACTTTCGTCATCCTCTCCAACATGATTTTCTaGCACTCGGACAATTGGTGC +
Preference number: 2 (lower is better)
Translates to: STSTFSVHQTNYDTFVILSNMIF*HSDNWC
Trigger: GCACCAATTGTCCGAGTGGCAGAAAATCATGTTGGA...GAGGATGACGAAAGTATCATAGTTAGTTTGGTGTACACTGAAGGTGGAAGTAGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR GCA 90 bp GAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATAAGACACTGTGAGATTTaGGAATTCATCACCTTCCTG +
Preference number: 2 (lower is better)
Translates to: ELSLFQTILVQVPEQCTIRHCEI*EFITFL
Trigger: CAGGAAGGTGATGAATTCGCAAATCTCACAGTGTCT...TATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp CTTTTTGGTTTCACCTTCAGCAAAGGTCAGAATCTCTCCAGCACCTATAAAATCAGGCACCCCTTGAATTaGAGATTCATAGTAGGACAG +
Preference number: 2 (lower is better)
Translates to: LFGFTFSKGQNLSSTYKIRHPLN*RFIVGQ
Trigger: CTGTCCTACTATGAATCTCCAATTCAAGGGGTGCCT...GATTTTATAGGTGCTGGAGAGATTCTGACCTTTGCTGAAGGTGAAACCAAAAAG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp ATTAAGCAACTACAAAAGGCTCGAGTACACAACACATCAAAAGGTAGCACTGTAGCATACACATGTCCATaGGTGTGCAGGTGTATATGC +
Preference number: 2 (lower is better)
Translates to: IKQLQKARVHNTSKGSTVAYTCP*VCRCIC
Trigger: GCATATACACCTGCACACCCATGGACATGTGTATGC...TACAGTGCTACCTTTTGATGTGTTGTGTACTCGAGCCTTTTGTAGTTGCTTAAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR TCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 2 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGATTAACTGATACAAACTaGCTCCACCTTTCTTATAGC +
Preference number: 2 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRLTDTN*LHLSYS
Trigger: GCTATAAGAAAGGTGGAGTCAGTTTGTATCAGTTAA...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR-3UTR TCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGATAATGGGTCCAACATaGTTTTCTGCCACTCGGACA +
Preference number: 2 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLIMGPT*FSATRT
Trigger: TGTCCGAGTGGCAGAAAATCATGTTGGACCCATTAT...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR TCA 90 bp GAATGTAGGAATAGCTATGAAACCCATGTCTCACTAAGAAGACCCCATTTGTTTAAGCATGGGCACTCCTaGAAGGGTTTTATTGGAATG +
Preference number: 2 (lower is better)
Translates to: ECRNSYETHVSLRRPHLFKHGHS*KGFIGM
Trigger: CATTCCAATAAAACCCTTTCAGGAGTGCCCATGCTT...AAACAAATGGGGTCTTCTTAGTGAGACATGGGTTTCATAGCTATTCCTACATTC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR GCA 90 bp AAATATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCACAAATATGAAAGTGTaGTCAGTCGAATGGTTAGTG +
Preference number: 2 (lower is better)
Translates to: KYESVLSRMVSEVLQVSVTNMKV*SVEWLV
Trigger: CACTAACCATTCGACTGAGCACACTTTCATATTTGT...GACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATATTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR GCA 90 bp CTCCTCAGGAATGTTGTCATCCAACAAATGCACAAACAATGTTGTATTCAACGATTGACCTTCCTCCATTaGCAGAGCCACTACATCAAT +
Preference number: 2 (lower is better)
Translates to: LLRNVVIQQMHKQCCIQRLTFLH*QSHYIN
Trigger: ATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAA...TCGTTGAATACAACATTGTTTGTGCATTTGTTGGATGACAACATTCCTGAGGAG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCACCACTAAAAAGAGATaGTACCCTGGTCATGTTTTT +
Preference number: 2 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCTTKKR*YPGHVF
Trigger: AAAAACATGACCAGGGTAGCATCTCTTTTTAGTGGT...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp GTTCACTCTAACAGTGTCGGAGCTTGGCAAAATTCTACTTCCACCTTCAGTGTAAGCTATTGCAGTTATTaGCACAGCTTTAAACTTCAC +
Preference number: 2 (lower is better)
Translates to: VHSNSVGAWQNSTSTFSVSYCSY*HSFKLH
Trigger: GTGAAGTTTAAAGCTGTGCCAATAACTGCAATAGCT...TACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR CCA 90 bp TCATCCTCTGGTTCAGAGTCATCCAAGATGGTTAAAATGACTGTCTTTTTGGTTAGGCACCCCTTGAATTaGAGATTCATAGTAGGACAG +
Preference number: 2 (lower is better)
Translates to: SSSGSESSKMVKMTVFLVRHPLN*RFIVGQ
Trigger: CTGTCCTACTATGAATCTCCAATTCAAGGGGTGCCT...AACCAAAAAGACAGTCATTTTAACCATCTTGGATGACTCTGAACCAGAGGATGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CCA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATCTCAATCACTTTCTGTaGTTCAGACTGAGAAAGACT +
Preference number: 2 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNLNHFL*FRLRKT
Trigger: AGTCTTTCTCAGTCTGAACCACAGAAAGTGATTGAG...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR CAA 90 bp ATTTTACAGTTTTCAGAATTAAAGTCTTCTAGTTGCAGTGAAGTCTaGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCT +
Preference number: 2 (lower is better)
Translates to: ILQFSELKSSSCSEV*NLDHLDSCKMAQGA
Trigger: AGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTTTAATTCTGAAAACTGTAAAAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGAACATCCTATTAACTaGTACAAACTGACTCCACCT +
Preference number: 2 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESEHPIN*YKLTPP
Trigger: AGGTGGAGTCAGTTTGTATCAGTTAATAGGATGTTC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
3UTR-3UTR TCA 90 bp ATTTCTGCAGCATTTGTCCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGTGAAGAGCCAATATTaGCAAATATGGGCAACTATC +
Preference number: 2 (lower is better)
Translates to: ISAAFVLPLKTSSYAFHCVKSQY*QIWATI
Trigger: GATAGTTGCCCATATTTGTCAATATTGGCTCTTCAC...ACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGCTGCAGAAAT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR TCA 90 bp GAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGTTGATGAAAAGCTaGATTGTTATGTTAGCCTCT +
Preference number: 2 (lower is better)
Translates to: ELSLFQTILVQVPEQCTILLMKS*IVMLAS
Trigger: AGAGGCTAACATAACAATTCAGCTTTTCATCAACAG...TATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp GGAAGATTGTTTCCACTTATAAACCACTGTTGGCTGCTATACTCTGTAAACTGGACTGTTGTTTATTGCTaGTCCAGCAGTAGCTTCATA +
Preference number: 2 (lower is better)
Translates to: GRLFPLINHCWLLYSVNWTVVYC*SSSSFI
Trigger: TATGAAGCTACTGCTGGAGCAGCAATAAACAACAGT...CCAGTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGTGGAAACAATCTTCC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTAGTGTCCTTGCGCTTTaGGTTAATAAGAGAACAAAG +
Preference number: 2 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESSVLAL*VNKRTK
Trigger: CTTTGTTCTCTTATTAACCCAAAGCGCAAGGACACT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CCA 90 bp CTTTTTGGTTTCACCTTCAGCAAAGGTCAGAATCTCTCCAGCACCTATAAAATCAACTGTAGAAATATTTaGCTGTCCTATGGTTGGCTG +
Preference number: 2 (lower is better)
Translates to: LFGFTFSKGQNLSSTYKINCRNI*LSYGWL
Trigger: CAGCCAACCATAGGACAGCCAAATATTTCTACAGTT...GATTTTATAGGTGCTGGAGAGATTCTGACCTTTGCTGAAGGTGAAACCAAAAAG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CAA 90 bp AAATCAATGCCATTAGTTCGAGATACATTTAAATACACGGTCCTATaGGCTTCTTCGATGTCTATGGAGGTGGCTCTATTTTCAACTGCA +
Preference number: 2 (lower is better)
Translates to: KSMPLVRDTFKYTVL*ASSMSMEVALFSTA
Trigger: TGCAGTTGAAAATAGAGCCACCTCCATAGACATCGAAGAAGCCAATAGGACCGTGTATTTAAATGTATCTCGAACTAATGGCATTGATTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR-3UTR GCA 90 bp ATCCAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGATCTTCACCAGCTATTaGAGTTATTGGCACAGCTTT +
Preference number: 2 (lower is better)
Translates to: IQQMHKQCCIQRPLRKEKIFTSY*SYWHSF
Trigger: AAAGCTGTGCCAATAACTGCAATAGCTGGTGAAGAT...CTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTGGAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTTATAAACCACTGTTaGCTGCTATACTCTGTAAAC +
Preference number: 2 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELINHC*LLYSVN
Trigger: GTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CAA 90 bp GATTCATCACTTTCTAAGATTTTAATCTGTGCGAATCTGGCACTGTaGTTTATTGCTGCTCCAGCAGTAGCTTCATATAGTTCCACAAAA +
Preference number: 2 (lower is better)
Translates to: DSSLSKILICANLAL*FIAAPAVASYSSTK
Trigger: TTTTGTGGAACTATATGAAGCTACTGCTGGAGCAGCAATAAACAACAGTGCCAGATTCGCACAGATTAAAATCTTAGAAAGTGATGAATC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 2 (lower is better)
Translates to: STIHRFLLHRWMYLESFSKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
3UTR-3UTR TCA 90 bp CTGTTGTTAAATGATAGAACTCCAGGGCCGTCATCATTAGCAAGGACAATAATTATTTTTCAAACTGGCTaGAATGTTCATGAGGTGAAC +
Preference number: 2 (lower is better)
Translates to: LLLNDRTPGPSSLARTIIIFQTG*NVHEVN
Trigger: GTTCACCTCATGAACATTTCAGCCAGTTTGAAAAAT...AATTATTGTCCTTGCTAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAG
38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp CATGAAAACATAAAGTCCCTGCAGACTGTTGAAAATGACAAAGAGAACCAACATTTTCCTCAACCACTTTaGAAAACTGACTGTCAGACA +
Preference number: 2 (lower is better)
Translates to: HENIKSLQTVENDKENQHFPQPL*KTDCQT
Trigger: TGTCTGACAGTCAGTTTTGCAAAGTGGTTGAGGAAA...ATGTTGGTTCTCTTTGTCATTTTCAACAGTCTGCAGGGACTTTATGTTTTCATG
38% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp GGAAGATTGTTTCCACTTATAAACCACTGTTGGCTGCTATACTCTGTAAACTGGTTCCTATTACACAGGTaGATGTACTTAGAGAGTTTT +
Preference number: 2 (lower is better)
Translates to: GRLFPLINHCWLLYSVNWFLLHR*MYLESF
Trigger: AAAACTCTCTAAGTACATCCACCTGTGTAATAGGAA...CCAGTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGTGGAAACAATCTTCC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CCA 90 bp TTCACCAGGAAATATTCTTCTAGCTCTGGTACATCATCCTCAAGAATGGTAATGTATTTGGCTGTCCTATaGTTGGCTGATTTTTCAAAC +
Preference number: 2 (lower is better)
Translates to: FTRKYSSSSGTSSSRMVMYLAVL*LADFSN
Trigger: GTTTGAAAAATCAGCCAACCATAGGACAGCCAAATA...CATTACCATTCTTGAGGATGATGTACCAGAGCTAGAAGAATATTTCCTGGTGAA
38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAACAAATATGAAAGTGTaGTCAGTCGAATGGTTAGTG +
Preference number: 2 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRTNMKV*SVEWLV
Trigger: CACTAACCATTCGACTGAGCACACTTTCATATTTGT...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
37% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
3UTR-3UTR GCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAACAAATATGAAAGTGTaGTCAGTCGAATGGTTAGTG +
Preference number: 2 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKTNMKV*SVEWLV
Trigger: CACTAACCATTCGACTGAGCACACTTTCATATTTGT...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
37% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
3UTR-3UTR CCA 90 bp CTGTTGTTAAATGATAGAACTCCAGGGCCGTCATCATTAGCAAGGACAATAATTATTAATGACATATATTaGCACGGCTTTACTGGTTTC +
Preference number: 2 (lower is better)
Translates to: LLLNDRTPGPSSLARTIIINDIY*HGFTGF
Trigger: GAAACCAGTAAAGCCGTGCCAATATATGTCATTAAT...AATTATTGTCCTTGCTAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAG
37% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR CCA 90 bp ATAATTAATCCCAATGCCATAATGCATCCAGTGGCAATGAATGCCATAATGCATGTATATGCACACCACTaGAAACATTTCCTAGAACTT +
Preference number: 2 (lower is better)
Translates to: IINPNAIMHPVAMNAIMHVYAHH*KHFLEL
Trigger: AAGTTCTAGGAAATGTTTCCAGTGGTGTGCATATAC...ATGCATTATGGCATTCATTGCCACTGGATGCATTATGGCATTGGGATTAATTAT
37% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR TCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 2 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
36% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
3UTR-3UTR GCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTTAAAGTCTTCTAGTTaGAGTGAAGTCTTGAATCTG +
Preference number: 2 (lower is better)
Translates to: LQSTFMCRIINRQTILQFLKSSS*SEVLNL
Trigger: CAGATTCAAGACTTCACTGCAACTAGAAGACTTTAA...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
36% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR-3UTR CAA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCAGCGAGTTGGGGACTaGCGTATGCAGACGCCAGAA +
Preference number: 3 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLQRVGD*RMQTPE
Trigger: TTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTG...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp TTTCCCCTCCAGCAGGAGGCATTCCACTCCCGGGCGTaGAAAAGGCTGTGCTGGGTCCAGGATGCCCATTCA +
Preference number: 3 (lower is better)
Translates to: FPLQQEAFHSRA*KRLCWVQDAHS
Trigger: TGAATGGGCATCCTGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGGGGAAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CCA 72 bp AACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGACGGGAACGTGGCTCCA +
Preference number: 3 (lower is better)
Translates to: NSWDSSSAISDP*PYPPEDGNVAP
Trigger: TGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp GTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATCCTCCTGAGCTCCACG +
Preference number: 3 (lower is better)
Translates to: VCSVEWLVRCYR*VSAMGILLSST
Trigger: CGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACAC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCAGTCCCTGCAGACTGTaGAAAATGACAAAGAGAACC +
Preference number: 3 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLSPCRL*KMTKRT
Trigger: GGTTCTCTTTGTCATTTTCAACAGTCTGCAGGGACT...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCAATCCCCTAGTGTCCTaGCGCTTTGGGTTAATAAGA +
Preference number: 3 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLNPLVS*RFGLIR
Trigger: TCTTATTAACCCAAAGCGCAAGGACACTAGGGGATT...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CAA 90 bp CATTATGGCCCATTGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGCTGCCACTCGGACAATaGGTGCTGAGAGCTGAAGAG +
Preference number: 3 (lower is better)
Translates to: HYGPLPCHRLIVTPSHSLLPLGQ*VLRAEE
Trigger: CTCTTCAGCTCTCAGCACCAATTGTCCGAGTGGCAG...CAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR TCA 72 bp ATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCCAGAGGACGGGAACGT +
Preference number: 3 (lower is better)
Translates to: IIKLLGLLIGYQ*PLAISSRGRER
Trigger: ACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp GCTGTTCCACCAACAACACGCCATTCGACTGCCACTTaGCCTAAGCTGCCCCCTGTCCTGTGTATCATCAGC +
Preference number: 3 (lower is better)
Translates to: AVPPTTRHSTAT*PKLPPVLCIIS
Trigger: GCTGATGATACACAGGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAACAGC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp ATCTTCCTCCTCCACAGTGATATGTGGAACGCTGCTTaGAGGCAGGGTCATTGCGTCCTTAGGCTGAGGAGG +
Preference number: 3 (lower is better)
Translates to: IFLLHSDMWNAA*RQGHCVLRLRR
Trigger: CCTCCTCAGCCTAAGGACGCAATGACCCTGCCTGCAAGCAGCGTTCCACATATCACTGTGGAGGAGGAAGAT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
3UTR GCA 72 bp ACTGTCCGTGTGGAGTCTGCACATTCTCCCCATATCTaGATGGGTCTCTCCAAGTGTTCCAGTCTCCCCCAC +
Preference number: 3 (lower is better)
Translates to: TVRVESAHSPHI*MGLSKCSSLPH
Trigger: GTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGATATGGGGAGAATGTGCAGACTCCACACGGACAGT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR CCA 72 bp GTGACCCCTGGCCATATCCTCCAGAGGACGGGAACGTaGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGC +
Preference number: 3 (lower is better)
Translates to: VTPGHILQRTGT*LHFVDLALNQG
Trigger: GCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCAC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp ATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATaGACACCACGAACACCACCACGAGGCACGTCAAAG +
Preference number: 3 (lower is better)
Translates to: MLSTVASPGRHG*TPRTPPRGTSK
Trigger: CTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCAT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR TCA 72 bp TCACTGGCTTCTACTGTGAGGACAGCTGCATATCCTTaGGCATCAAGCAGGGCGATTCCGGCTGGTGGAACT +
Preference number: 3 (lower is better)
Translates to: SLASTVRTAAYP*ASSRAIPAGGT
Trigger: AGTTCCACCAGCCGGAATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp TCAATTGCCAGCCAGGGCAACTGTCCGTGTGGAGTCTaGACATTCTCCCCATATCTGCATGGGTCTCTCCAA +
Preference number: 3 (lower is better)
Translates to: SIASQGNCPCGV*TFSPYLHGSLQ
Trigger: TTGGAGAGACCCATGCAGATATGGGGAGAATGTGCAGACTCCACACGGACAGTTGCCCTGGCTGGCAATTGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR CCA 72 bp TCCGTGTGGAGTCTGCACATTCTCCCCATATCTGCATaGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTC +
Preference number: 3 (lower is better)
Translates to: SVWSLHILPISA*VSPSVPVSPTF
Trigger: GAATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGATATGGGGAGAATGTGCAGACTCCACACGGA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR CCA 72 bp ACAGCAGCCATAGCTGAACAGCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGACGCCAGAAACAGAATC +
Preference number: 3 (lower is better)
Translates to: TAAIAEQLSSAS*GLAYADARNRI
Trigger: GATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CCA 72 bp TGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCC +
Preference number: 3 (lower is better)
Translates to: WLHFVDLALNQG*PDCPVGRMLSP
Trigger: GGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp GTGGCACAGGTATACAGGGGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCCAGGCACCCCTTGAATaGGAGATTCATAGTAGGACA +
Preference number: 3 (lower is better)
Translates to: VAQVYRGSPTAETFIQVLQAPLE*EIHSRT
Trigger: TGTCCTACTATGAATCTCCAATTCAAGGGGTGCCTG...GAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCCCCTGTATACCTGTGCCAC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR TCA 72 bp TGGTTCAGACTGAGAAAGACTGCTGGGCTGTCTGCTTaGGCCACAGGACATCCATGCATTCTGATCACCCAC +
Preference number: 3 (lower is better)
Translates to: WFRLRKTAGLSA*ATGHPCILITH
Trigger: GTGGGTGATCAGAATGCATGGATGTCCTGTGGCTCAAGCAGACAGCCCAGCAGTCTTTCTCAGTCTGAACCA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR CAA 90 bp GCCATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATGCTCTCCTCAGCGAGTaGGGGACTTGCGTATGCAGA +
Preference number: 3 (lower is better)
Translates to: AMCSPPQSHVTEIRAKRYALLSE*GTCVCR
Trigger: TCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAGC...ATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACATGGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp GTCAGGTGGCACCTCCTCCATAGCACCGATGAGATTCTGGGTGGACTTGCTGATCTCCATTTTGTGGACTaGGCTTTAAATCAGGGCTGG +
Preference number: 3 (lower is better)
Translates to: VRWHLLHSTDEILGGLADLHFVD*ALNQGW
Trigger: CCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAG...ATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGTGCCACCTGAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp CATTATGGCCCATTGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGTGGGTCAGGCACCCCTaGAATTGGAGATTCATAGTA +
Preference number: 3 (lower is better)
Translates to: HYGPLPCHRLIVTPSHSLWVRHP*NWRFIV
Trigger: TACTATGAATCTCCAATTCAAGGGGTGCCTGACCCA...CAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp GAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCCTCCATTTTGTGGACTaGGCTTTAAATCAGGGCTGG +
Preference number: 3 (lower is better)
Translates to: EHHHEARQRNKSCSEQSSLHFVD*ALNQGW
Trigger: CCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAG...GCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp GCAAAGATACAGGTAATGTGTGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAGTTGGGGACTTGCGTA +
Preference number: 3 (lower is better)
Translates to: AKIQVMCDSSHS*TALLSELGTCV
Trigger: TACGCAAGTCCCCAACTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTCACACATTACCTGTATCTTTGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp ATCTGCAAGCCCCCAAATGGCCTGCGAATCTGCATCTaGGACAAGAGTGATGTTGGCAGTCCCATACACTTT +
Preference number: 3 (lower is better)
Translates to: ICKPPNGLRICI*DKSDVGSPIHF
Trigger: AAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCAGGCCATTTGGGGGCTTGCAGAT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR GCA 72 bp GTCACTCCCAGCCACAGCCTGACCACTAAAAAGAGATaGTACCCTGGTCATGTTTTTCCTGTAGGTCCAGAA +
Preference number: 3 (lower is better)
Translates to: VTPSHSLTTKKR*YPGHVFPVGPE
Trigger: TTCTGGACCTACAGGAAAAACATGACCAGGGTAGCATCTCTTTTTAGTGGTCAGGCTGTGGCTGGGAGTGAC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp CAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTaGAACACTCTCCTGGACGTAGAGAGCTGTTGGCTC +
Preference number: 3 (lower is better)
Translates to: QSLCRFPNNVQY*NTLLDVESCWL
Trigger: GAGCCAACAGCTCTCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 72 bp CCCCACGGCAGAGACATTCATCCAAGTTCTCCAAAGTaGGTCAGGCACCCCTTGAATTGGAGATTCATAGTA +
Preference number: 3 (lower is better)
Translates to: PHGRDIHPSSPK*VRHPLNWRFIV
Trigger: TACTATGAATCTCCAATTCAAGGGGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCTCTGCCGTGGGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp TCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCAGGATGCCCATTCATTTCAGTGAAGAGCCAATATaGACAAATATGGGCAACTAT +
Preference number: 3 (lower is better)
Translates to: STPGREKGCAGSRMPIHFSEEPI*TNMGNY
Trigger: ATAGTTGCCCATATTTGTCAATATTGGCTCTTCACT...GAAATGAATGGGCATCCTGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp AATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCATATCTTCTGGCACCACCTTTaGGGTCAAAAAGGACAATCT +
Preference number: 3 (lower is better)
Translates to: NHQTPGTPHRLSVTPGHIFWHHL*GQKGQS
Trigger: AGATTGTCCTTTTTGACCCAAAAGGTGGTGCCAGAA...GATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 72 bp CCAGTAGCAAGCTGTCCATTAATGGTGGCAACCCACTaGACAGTAACATTGCCGAGTGTCCCAGAATTTCGA +
Preference number: 3 (lower is better)
Translates to: PVASCPLMVATH*TVTLPSVPEFR
Trigger: TCGAAATTCTGGGACACTCGGCAATGTTACTGTTCAGTGGGTTGCCACCATTAATGGACAGCTTGCTACTGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR CCA 72 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATGGATGAACACCACGAA +
Preference number: 3 (lower is better)
Translates to: PSSEDIIICFPL*LHLVGMDEHHE
Trigger: TTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGACAGGCACCCCTTGAATaGGAGATTCATAGTAGGACA +
Preference number: 3 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRQAPLE*EIHSRT
Trigger: TGTCCTACTATGAATCTCCAATTCAAGGGGTGCCTG...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGCATCATGGCACTGAGTaGTTCATCTGTGTTTTCTGT +
Preference number: 3 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQHHGTE*FICVFC
Trigger: ACAGAAAACACAGATGAACAACTCAGTGCCATGATG...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CAA 90 bp CACTCTCCTGGACGTAGAGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTAATGCACAAACAATGTaGTATTCAACGACCCCTCAG +
Preference number: 3 (lower is better)
Translates to: HSPGRRELLALLGKSAHCNAQTM*YSTTPQ
Trigger: CTGAGGGGTCGTTGAATACAACATTGTTTGTGCATT...ACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCTCTACGTCCAGGAGAGTG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR TCA 72 bp CCCAAATGGCCTGCGAATCTGCATCTGAGACAAGAGTaGTGTTGGCAGTCCCATACACTTTATCAATTCTGG +
Preference number: 3 (lower is better)
Translates to: PKWPANLHLRQE*CWQSHTLYQFW
Trigger: CCAGAATTGATAAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCAGGCCATTTGGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 72 bp CCTCCTGTTCTAGTCACATTGATAATGGGTCCAACATaGTTTTCTGCCACTCGGACAATTGGTGCTGAGAGC +
Preference number: 3 (lower is better)
Translates to: PPVLVTLIMGPT*FSATRTIGAES
Trigger: GCTCTCAGCACCAATTGTCCGAGTGGCAGAAAATCATGTTGGACCCATTATCAATGTGACTAGAACAGGAGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR TCA 72 bp TTAAAACTCCATGTGGTTCATCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTTGAGCATCAAGCAGGG +
Preference number: 3 (lower is better)
Translates to: LKLHVVHHWLLL*GQLHILEHQAG
Trigger: CCCTGCTTGATGCTCAAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTGATGAACCACATGGAGTTTTAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp TGTGCCAGCAACATTCTGGTAATCCTCAGGACTGAATaGTGTCAAGGACACTGTTCTAAATTCCGCAGTCAC +
Preference number: 3 (lower is better)
Translates to: CASNILVILRTE*CQGHCSKFRSH
Trigger: GTGACTGCGGAATTTAGAACAGTGTCCTTGACAGCATTCAGTCCTGAGGATTACCAGAATGTTGCTGGCACA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
3UTR GCA 72 bp GAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTaGAGTGAACAAAGCAGCATAGACGTTTGGAATAAA +
Preference number: 3 (lower is better)
Translates to: EHHHEARQRNKS*SEQSSIDVWNK
Trigger: TTTATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR GCA 72 bp CTCATGCCAAAGGCTGTTTCAGATACTGTCTCCCACTaGACACTCACAGCCAAATCAATGCCATTAGTTCGA +
Preference number: 3 (lower is better)
Translates to: LMPKAVSDTVSH*TLTAKSMPLVR
Trigger: TCGAACTAATGGCATTGATTTGGCTGTGAGTGTGCAGTGGGAGACAGTATCTGAAACAGCCTTTGGCATGAG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
3UTR CCA 72 bp TCTGGCGTTAGGATGACATCCAATACAGTGCTTCTCTaGCCAGGTTCAAAGACCAATGTGCCTTCAGTTATC +
Preference number: 3 (lower is better)
Translates to: SGVRMTSNTVLL*PGSKTNVPSVI
Trigger: GATAACTGAAGGCACATTGGTCTTTGAACCTGGCCAGAGAAGCACTGTATTGGATGTCATCCTAACGCCAGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CAA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTAGTGAAGAGCCAATATaGACAAATATGGGCAACTAT +
Preference number: 3 (lower is better)
Translates to: SASWGLAYADARNRICVPSEEPI*TNMGNY
Trigger: ATAGTTGCCCATATTTGTCAATATTGGCTCTTCACT...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp TGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCTGGGTCAGGCACCCCTaGAATTGGAGATTCATAGTA +
Preference number: 3 (lower is better)
Translates to: CHCSKQSLCRFPNNVQYCWVRHP*NWRFIV
Trigger: TACTATGAATCTCCAATTCAAGGGGTGCCTGACCCA...GCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp TCACCCACCCCAGATCTTGGCAGAGCAGCCTGCTATGATTTCTCCTCATTACCAATAAATTTCTCCCCTTaGACAAGTATCAGTGTGTGT +
Preference number: 3 (lower is better)
Translates to: SPTPDLGRAACYDFSSLPINFSP*TSISVC
Trigger: ACACACACTGATACTTGTCAAAGGGGAGAAATTTAT...TGGTAATGAGGAGAAATCATAGCAGGCTGCTCTGCCAAGATCTGGGGTGGGTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR TCA 72 bp TGTATCATCAGCTCCACCAAGGTTTGGGGCTGCTCCTaGACTTCAACAAATAAGCCATCTTCGGAAGTATTG +
Preference number: 3 (lower is better)
Translates to: CIISSTKVWGCS*TSTNKPSSEVL
Trigger: CAATACTTCCGAAGATGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAACCTTGGTGGAGCTGATGATACA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp CATACACAAATAAGGAAACATGGCCAAGAGGTTCTCTaGTCCTCTGGGCTACCAATGTTAAACTTCCATGGG +
Preference number: 3 (lower is better)
Translates to: HTQIRKHGQEVL*SSGLPMLNFHG
Trigger: CCCATGGAAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTATTTGTGTATG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp TCATCCAAAAGGACCAGATTTTACAGCGTTATATCTGTAGATAGATCTAGCAGATATGTGGAACGCTGCTaGCAGGCAGGGTCATTGCGT +
Preference number: 3 (lower is better)
Translates to: SSKRTRFYSVISVDRSSRYVERC*QAGSLR
Trigger: ACGCAATGACCCTGCCTGCAAGCAGCGTTCCACATA...TCTGCTAGATCTATCTACAGATATAACGCTGTAAAATCTGGTCCTTTTGGATGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000450321.2
3UTR-3UTR CAA 90 bp ACAACCAGCTTGCAGCAGCCTGATTCCAAAGGAGACACAGAGATGTCTGAGGAATTTAGGGTAGGAAGATaGTTTCCACTTATAAACCAC +
Preference number: 3 (lower is better)
Translates to: TTSLQQPDSKGDTEMSEEFRVGR*FPLINH
Trigger: GTGGTTTATAAGTGGAAACAATCTTCCTACCCTAAA...TTCCTCAGACATCTCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTGGTTGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp GTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTCCGCTAAAGTTAGCAAAATTATGGCCCATTGCCTaGTCACAGGCTCATAGTCAC +
Preference number: 3 (lower is better)
Translates to: VVFNDPSGKKSCPLKLAKLWPIA*SQAHSH
Trigger: GTGACTATGAGCCTGTGACAAGGCAATGGGCCATAA...TTTTGCTAACTTTAGCGGACAACTTTTCTTTCCTGAGGGGTCGTTGAATACAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp ATAAGGAAACATGGCCAAGAGGTTCTCTGCTCCTCTGGGCTACCAATGTTAAACACAATTCCTGCCACATaGTCATTGGCCAAAATGTTC +
Preference number: 3 (lower is better)
Translates to: IRKHGQEVLCSSGLPMLNTIPAT*SLAKMF
Trigger: GAACATTTTGGCCAATGACAATGTGGCAGGAATTGT...GTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATCTTCATGGAGTTGATTaGGGTGTTCCCAAAGGCTTC +
Preference number: 3 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNLHGVD*GVPKGF
Trigger: GAAGCCTTTGGGAACACCCAAATCAACTCCATGAAG...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR GCA 72 bp CATAATGCATCCAGTGGCAATGAATGCCATAATGCATaGACAGAGGATGATATGACATGTACCATCCTTGGG +
Preference number: 3 (lower is better)
Translates to: HNASSGNECHNA*TEDDMTCTILG
Trigger: CCCAAGGATGGTACATGTCATATCATCCTCTGTGCATGCATTATGGCATTCATTGCCACTGGATGCATTATG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR-3UTR CAA 90 bp GTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTCCGCTAAAGTTAGCAAAAGTCTGGCTCCTCCTGTaGTTTCATTCATCAGTTGCA +
Preference number: 3 (lower is better)
Translates to: VVFNDPSGKKSCPLKLAKVWLLL*FHSSVA
Trigger: TGCAACTGATGAATGAAACAACAGGAGGAGCCAGAC...TTTTGCTAACTTTAGCGGACAACTTTTCTTTCCTGAGGGGTCGTTGAATACAAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR CAA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGCTGCATTATGGCCCATaGCCTTGTCACAGGCTCATA +
Preference number: 3 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLLHYGP*PCHRLI
Trigger: TATGAGCCTGTGACAAGGCAATGGGCCATAATGCAG...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp GACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTaGCACATTGTCATTGGCCAAAATGTTCACTCTAAC +
Preference number: 3 (lower is better)
Translates to: DRSGSCLKANNS*HIVIGQNVHSN
Trigger: GTTAGAGTGAACATTTTGGCCAATGACAATGTGGCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 72 bp TCTTTCTGTGCATCTTATAAGCTCTTGAGTTTTCACTaGGCCCTTGAAGGCATAGATATGGGACTCAACATG +
Preference number: 3 (lower is better)
Translates to: SFCASYKLLSFH*ALEGIDMGLNM
Trigger: CATGTTGAGTCCCATATCTATGCCTTCAAGGGCCCAGTGAAAACTCAAGAGCTTATAAGATGCACAGAAAGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638990.1
3UTR CCA 72 bp AATAAGGAAACATGGCCAAGAGGTTCTCTGCTCCTCTaGGCTACCAATGTTAAACTTCCATGGGTTTCATTT +
Preference number: 3 (lower is better)
Translates to: NKETWPRGSLLL*ATNVKLPWVSF
Trigger: AAATGAAACCCATGGAAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTATT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGATGGCACAGGGTGCTaGTCATCATCTACATATAGA +
Preference number: 3 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESDGTGC*SSSTYR
Trigger: TCTATATGTAGATGATGACAAGCACCCTGTGCCATC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR TCA 72 bp AAATCAGTGGAATTTCTGCAGCATTTGTCCTTCCTCTaGAGACATCATCATATGCTTTCCACTGTGGCTTCA +
Preference number: 3 (lower is better)
Translates to: KSVEFLQHLSFL*RHHHMLSTVAS
Trigger: TGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGCTGCAGAAATTCCACTGATTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR TCA 72 bp GCCAGCCGAGAACCCACAGAAAAATACACAAGGCTTTaGGATTCATCACTTTCTAAGATTTTAATCTGTGCG +
Preference number: 3 (lower is better)
Translates to: ASREPTEKYTRL*DSSLSKILICA
Trigger: CGCACAGATTAAAATCTTAGAAAGTGATGAATCTCAAAGCCTTGTGTATTTTTCTGTGGGTTCTCGGCTGGC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 72 bp TGGCTGTCCTATGGTTGGCTGATTTTTCAAACTGGCTaGAATGTTCATGAGGTGAACTTCAAGGAGAGAAAT +
Preference number: 3 (lower is better)
Translates to: WLSYGWLIFQTG*NVHEVNFKERN
Trigger: ATTTCTCTCCTTGAAGTTCACCTCATGAACATTTCAGCCAGTTTGAAAAATCAGCCAACCATAGGACAGCCA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR TCA 72 bp CATCCTCTGGTTCAGAGTCATCCAAGATGGTTAAAATaGCTGTCTTTTTGGTTTCACCTTCAGCAAAGGTCA +
Preference number: 3 (lower is better)
Translates to: HPLVQSHPRWLK*LSFWFHLQQRS
Trigger: TGACCTTTGCTGAAGGTGAAACCAAAAAGACAGTCATTTTAACCATCTTGGATGACTCTGAACCAGAGGATG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR GCA 72 bp AATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTaGAGGTTCCCGAACAATGTACAATACTGCAACACT +
Preference number: 3 (lower is better)
Translates to: NELNCHCSKQSL*RFPNNVQYCNT
Trigger: AGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CCA 72 bp AGTCCCATACACTTTATCAATTCTGGCACCACCTTTTaGGTCAAAAAGGACAATCTGGAAGCGTTTAGGAAA +
Preference number: 3 (lower is better)
Translates to: SPIHFINSGTTF*VKKDNLEAFRK
Trigger: TTTCCTAAACGCTTCCAGATTGTCCTTTTTGACCCAAAAGGTGGTGCCAGAATTGATAAAGTGTATGGGACT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR-3UTR CAA 90 bp GAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACAGAATTTCGAATTATaGGCAGGTTTACCTTCACTG +
Preference number: 3 (lower is better)
Translates to: ELSLFQTILVQVPEQCTIQNFEL*AGLPSL
Trigger: CAGTGAAGGTAAACCTGCCAATAATTCGAAATTCTG...TATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR-3UTR CAA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTCTTTCCAGAGGCTCTaGAACACGATAAACCATCTG +
Preference number: 3 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLSFQRL*NTINHL
Trigger: CAGATGGTTTATCGTGTTCAAGAGCCTCTGGAAAGA...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR-3UTR CAA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAAGTTGCAGTGAAGTCTaGAATCTGGATCACCTGGAT +
Preference number: 3 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRSCSEV*NLDHLD
Trigger: ATCCAGGTGATCCAGATTCAAGACTTCACTGCAACT...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
3UTR-3UTR CAA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGACTTATAAACCACTGTaGGCTGCTATACTCTGTAAA +
Preference number: 3 (lower is better)
Translates to: IIQYNSQVPITQVDVLRETYKPL*AAILCK
Trigger: TTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGT...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR-3UTR CAA 90 bp ATCATCAGGAAGAATAGACACTGTGAGATTTGCGAATTCATCACCTTCCTGCATCCAAATGCATCATCATaGGCAATGATAATTAGTTGC +
Preference number: 3 (lower is better)
Translates to: IIRKNRHCEICEFITFLHPNASS*AMIISC
Trigger: GCAACTAATTATCATTGCCAATGATGATGCATTTGG...ATGCAGGAAGGTGATGAATTCGCAAATCTCACAGTGTCTATTCTTCCTGATGAT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR TCA 72 bp ACATATAAATCCAGAAGTGAAGAAGGCTTCATTGTATaGAGACAAGTTGTCAGTCCGAGCATAGACAGCATA +
Preference number: 3 (lower is better)
Translates to: TYKSRSEEGFIV*RQVVSPSIDSI
Trigger: TATGCTGTCTATGCTCGGACTGACAACTTGTCTTCATACAATGAAGCCTTCTTCACTTCTGGATTTATATGT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CCA 72 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTaGATGTACTTAGAGAGTTTTAGCACAAAAGCTGAT +
Preference number: 3 (lower is better)
Translates to: SSSTIHRFLLHR*MYLESFSTKAD
Trigger: ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
3UTR-3UTR CAA 90 bp CATGAAAACATAAAGTCCCTGCAGACTGTTGAAAATGACAAAGAGAACCAACATGTATGGAGCACTCTGTaGAGAATATCATCATTCACA +
Preference number: 3 (lower is better)
Translates to: HENIKSLQTVENDKENQHVWSTL*RISSFT
Trigger: TGTGAATGATGATATTCTCAACAGAGTGCTCCATAC...ATGTTGGTTCTCTTTGTCATTTTCAACAGTCTGCAGGGACTTTATGTTTTCATG
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR TCA 72 bp AAAACACAGGTCACCATGAATGAGTCCATAGATCTGTaGCATGCTCTGATGATAGATTCCTTTCAAAATAAC +
Preference number: 3 (lower is better)
Translates to: KTQVTMNESIDL*HALMIDSFQNN
Trigger: GTTATTTTGAAAGGAATCTATCATCAGAGCATGTCACAGATCTATGGACTCATTCATGGTGACCTGTGTTTT
38% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
3UTR TCA 72 bp CCCAGAATTTCGAATTATTGGCAGGTTTACCTTCACTaGGTTAAACTCAGGTTCCTCTACAATAAGTTTAGT +
Preference number: 3 (lower is better)
Translates to: PRISNYWQVYLH*VKLRFLYNKFS
Trigger: ACTAAACTTATTGTAGAGGAACCTGAGTTTAACTCAGTGAAGGTAAACCTGCCAATAATTCGAAATTCTGGG
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR CCA 72 bp AGCTATACTATAATCTTCACCAGCTATTGCAGTTATTaGCACAGCTTTAAACTTCACAGAGACATCTGCAAA +
Preference number: 3 (lower is better)
Translates to: SYTIIFTSYCSY*HSFKLHRDICK
Trigger: TTTGCAGATGTCTCTGTGAAGTTTAAAGCTGTGCCAATAACTGCAATAGCTGGTGAAGATTATAGTATAGCT
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR CCA 72 bp ATCATTTCACTTAAAGCTGCAGTTTCCAAGAACCTGTaGACATTAACTGAGGACATATTGTACAGGAATGTA +
Preference number: 3 (lower is better)
Translates to: IISLKAAVSKNL*TLTEDILYRNV
Trigger: TACATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGCTTTAAGTGAAATGAT
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR GCA 72 bp ACCATTTTACAGTTTTCAGAATTAAAGTCTTCTAGTTaGAGTGAAGTCTTGAATCTGGATCACCTGGATTCA +
Preference number: 3 (lower is better)
Translates to: TILQFSELKSSS*SEVLNLDHLDS
Trigger: TGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTTTAATTCTGAAAACTGTAAAATGGT
36% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTCCACCAACAACACGCCATTCGACTGCCACTTGACCTAAGCTGCCCCCTGTCCCATTCGACTGCCACTTaGCCTAAGCTGCCCCCTGTC +
Preference number: 4 (lower is better)
Translates to: FHQQHAIRLPLDLSCPLSHSTAT*PKLPPV
Trigger: GACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATG...GGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCAAAGTGGCCTTCTTGTaGGCCACTGCCAGCCGAGAA +
Preference number: 4 (lower is better)
Translates to: LADFPSSRRHSTPGREKGKVAFL*ATASRE
Trigger: TTCTCGGCTGGCAGTGGCTCACAAGAAGGCCACTTT...GCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAG +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDDSSHS*TALLSE
Trigger: CTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTC...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: EVLQVSVGDGYPPELHDLPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...CAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATC +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDVRCYR*VSAMGI
Trigger: GATACCCATCGCCGACACTCACCTGTAGCACCTCAC...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTGGGAGTCAGTCAAGGTaGCCCCCTCCTGGCTGCCTT +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPGSQSR*PPPGCL
Trigger: AAGGCAGCCAGGAGGGGGGCACCTTGACTGACTCCC...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGGGAGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGAC +
Preference number: 4 (lower is better)
Translates to: VLQVSVGDGYPPELHDLGAISDP*PYPPED
Trigger: GTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGC...TCCCAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCAC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGAGCTCCACGATCTaGGAGTCAGTCAAGGTGCCC +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDLSSTI*ESVKVP
Trigger: GGGCACCTTGACTGACTCCCAGATCGTGGAGCTCAG...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCGTGTGCTCAGTCGAATaGTTAGTGAGGTGCTACAGG +
Preference number: 4 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLVCSVE*LVRCYR
Trigger: CCTGTAGCACCTCACTAACCATTCGACTGAGCACAC...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCGTCTCCCAGTTCACCTaGATCTCTCCCAAGAGTCCT +
Preference number: 4 (lower is better)
Translates to: LADFPSSRRHSTPGREKGVSQFT*ISPKSP
Trigger: AGGACTCTTGGGAGAGATTCAGGTGAACTGGGAGAC...GCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGACAGGTTGTGGTCCCTaGCACAGACTGAAGTTCCTC +
Preference number: 4 (lower is better)
Translates to: EVLQVSVGDGYPPELHDLTGCGP*HRLKFL
Trigger: GAGGAACTTCAGTCTGTGTCAGGGACCACAACCTGT...CAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCAGAACAAGAGCTGCAGTaGACAAAGCAGCATAGACGT +
Preference number: 4 (lower is better)
Translates to: PPAGGIPLPGVKKAVLGPEQELQ*TKQHRR
Trigger: ACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTC...TGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDEPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGCCCTCCTGGCTGCCTTaGCCAGATTCATTATCACTG +
Preference number: 4 (lower is better)
Translates to: EVLQVSVGDGYPPELHDLPSWLP*PDSLSL
Trigger: CAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGG...CAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 4 (lower is better)
Translates to: SVLSRMVSEVLQVSVGDGRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...CCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATC +
Preference number: 4 (lower is better)
Translates to: RMVSEVLQVSVGDGYPPEVRCYR*VSAMGI
Trigger: GATACCCATCGCCGACACTCACCTGTAGCACCTCAC...CTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp TTCCTCCTCCACAGTGATATGTGGAACGCTGCTTGCAGGCAGGGTCATTGCGTCTGCAGGCAGGGTCATTaGGTCCTTAGGCTGAGGAGG +
Preference number: 4 (lower is better)
Translates to: FLLHSDMWNAACRQGHCVCRQGH*VLRLRR
Trigger: CCTCCTCAGCCTAAGGACGCAATGACCCTGCCTGCA...GACGCAATGACCCTGCCTGCAAGCAGCGTTCCACATATCACTGTGGAGGAGGAA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR GCA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTGGGAGTCAGTCAAGGTaGCCCCCTCCTGGCTGCCTT +
Preference number: 4 (lower is better)
Translates to: SASWGLAYADARNRICVPGSQSR*PPPGCL
Trigger: AAGGCAGCCAGGAGGGGGGCACCTTGACTGACTCCC...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ATGTGGAACGCTGCTTGCAGGCAGGGTCATTGCGTCCTTAGGCTGAGGAGGCAGCTCCACAGTGATATGTaGAACGCTGCTTGCAGGCAG +
Preference number: 4 (lower is better)
Translates to: MWNAACRQGHCVLRLRRQLHSDM*NAACRQ
Trigger: CTGCCTGCAAGCAGCGTTCCACATATCACTGTGGAG...CTGCCTCCTCAGCCTAAGGACGCAATGACCCTGCCTGCAAGCAGCGTTCCACAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR CCA 90 bp CATTATGGCCCATTGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGCAGGGCGATTCCGGCTaGTGGAACTCCTTGTGTCCT +
Preference number: 4 (lower is better)
Translates to: HYGPLPCHRLIVTPSHSLQGDSG*WNSLCP
Trigger: AGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTG...CAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDLSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGGCACCGATGAGATTCTaGGTGGACTTGCTGATTTCC +
Preference number: 4 (lower is better)
Translates to: PCWKDALSQSGGTSSIAPAPMRF*VDLLIS
Trigger: GGAAATCAGCAAGTCCACCCAGAATCTCATCGGTGC...CGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGATTCTGGGTGGACTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGTTCACCGTGGGAAAATaGAAGGCTCCCCAGTGTTGG +
Preference number: 4 (lower is better)
Translates to: RFWVDLLISPPAGGIPLPFTVGK*KAPQCW
Trigger: CCAACACTGGGGAGCCTTTCATTTTCCCACGGTGAA...CGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGAATCT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: LVGMDEHHEHHHEARQRNPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...GTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: MVSEVLQVSVGDGYPPELPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...GAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCAT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGTCTGGGTGGACTTGCTaGTTTCCCCTCCAGCAGGAG +
Preference number: 4 (lower is better)
Translates to: VGMDEHHEHHHEARQRNKSGWTC*FPLQQE
Trigger: CTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGA...CTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTAC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCC +
Preference number: 4 (lower is better)
Translates to: AWMNTTNTTTRHVKGTRALIGYQ*PLAISS
Trigger: GGAGGATATGGCCAGGGGTCACTGATAGCCGATGAG...AGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 4 (lower is better)
Translates to: SRMVSEVLQVSVGDGYPPRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...AGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp TTCCACCAACAACACGCCATTCGACTGCCACTTGACCTAAGCTGCCCCCTGTCCCCACTTGACCTAAGCTaGCCCCTGTCCTGTGTATCA +
Preference number: 4 (lower is better)
Translates to: FHQQHAIRLPLDLSCPLSPLDLS*PLSCVS
Trigger: TGATACACAGGACAGGGGGCAGCTTAGGTCAAGTGG...GGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTGTGCTGGGTCCAGGATaGCCATTCATTTCCACAGTG +
Preference number: 4 (lower is better)
Translates to: PGHILQRTGTWLHFVDLAVLGPG*PFISTV
Trigger: CACTGTGGAAATGAATGGGCATCCTGGACCCAGCAC...AGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp AGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGCCCTGTTGGAAGGATaGTCTCTCCCAGTCAGGTGG +
Preference number: 4 (lower is better)
Translates to: SRMVSEVLQVSVGDGYPPALLEG*SLPVRW
Trigger: CCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGC...AGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 4 (lower is better)
Translates to: SVLSRMVSEVLQVSVGDGLSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...CCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
3UTR CAA 72 bp ACCTCCTCCATAGCACCGATGAGATTCTGGGTGGACTaGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTC +
Preference number: 4 (lower is better)
Translates to: TSSIAPMRFWVD*LISPPAGGIPL
Trigger: GAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CAA 72 bp CTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTaGGCTTTAAATCAGGGCTGGCCTGACTGCCCTGTT +
Preference number: 4 (lower is better)
Translates to: LQRTGTWLHFVD*ALNQGWPDCPV
Trigger: AACAGGGCAGTCAGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGGATTCAAATCCGACCTaGGAATTGGCAGCTTTCTCA +
Preference number: 4 (lower is better)
Translates to: PCWKDALSQSGGTSSIAPDSNPT*ELAAFS
Trigger: TGAGAAAGCTGCCAATTCTCAGGTCGGATTTGAATC...CGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGTCACTTCAGCAAAGTaGCTGAATCCCCTAGTGTCC +
Preference number: 4 (lower is better)
Translates to: VSEVLQVSVGDGYPPELHVTSAK*LNPLVS
Trigger: GGACACTAGGGGATTCAGTCACTTTGCTGAAGTGAC...GTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGATTCTGGGTGGACTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGGTCACTTCAGCAAAGTaGCTGAATCCCCTAGTGTCC +
Preference number: 4 (lower is better)
Translates to: RFWVDLLISPPAGGIPLPVTSAK*LNPLVS
Trigger: GGACACTAGGGGATTCAGTCACTTTGCTGAAGTGAC...CGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGAATCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAG +
Preference number: 4 (lower is better)
Translates to: HHEARQRNKSCSEQSSIDDSSHS*TALLSE
Trigger: CTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTC...GTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACTTCCACTCCCGGGCGTaGAAAAGGCTGTGCTGGGTC +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHFHSRA*KRLCWV
Trigger: GACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAA...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp CACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACCTCCGCCAGGAGCACTaGTCTGCACTCCTGATAGGT +
Preference number: 4 (lower is better)
Translates to: HHEARQRNKSCSEQSSIDLRQEH*SALLIG
Trigger: ACCTATCAGGAGTGCAGAGCAGTGCTCCTGGCGGAG...GTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATGAATCTCTGGCCACCTaGAGACTGATTAAAGTGGCC +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDESLAT*RLIKVA
Trigger: GGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTC...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGAGCGAGTTGGGGACTTaGGTATGCAGACGCCAGAAA +
Preference number: 4 (lower is better)
Translates to: RMVSEVLQVSVGDGYPPESELGT*VCRRQK
Trigger: TTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCT...CTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp GAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGTATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 4 (lower is better)
Translates to: EVLQVSVGDGYPPELHDLYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...CAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACGGCAACCACGTTGGTTaGCTGCAGAATGGTAGTCGT +
Preference number: 4 (lower is better)
Translates to: LVGMDEHHEHHHEARQRNGNHVG*LQNGSR
Trigger: ACGACTACCATTCTGCAGCCAACCAACGTGGTTGCC...GTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp GCTGGCCTGACTGCCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCAAAGGGCAATGCATTTaGTTCCATCTGAGCACATCT +
Preference number: 4 (lower is better)
Translates to: AGLTALLEGCSLPVRWHLKGQCI*FHLSTS
Trigger: AGATGTGCTCAGATGGAACCAAATGCATTGCCCTTT...GAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGCAGTCAGGCCAGC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp CACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCCTGCAAGCCCCCAAATaGCCTGCGAATCTGCATCTG +
Preference number: 4 (lower is better)
Translates to: HEHHHEARQRNKSCSEQSLQAPK*PANLHL
Trigger: CAGATGCAGATTCGCAGGCCATTTGGGGGCTTGCAG...GCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp GTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGGGATCTGTGTACCTAAGCTaGCTGCCATCATGTGAGTCA +
Preference number: 4 (lower is better)
Translates to: VLQVSVGDGYPPELHDLGSVYLS*LPSCES
Trigger: TGACTCACATGATGGCAGCCAGCTTAGGTACACAGA...TCCCAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp AATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCATATCTCTCTCCCAGTCAGGTaGCACCTCCTCCATAGCACC +
Preference number: 4 (lower is better)
Translates to: NHQTPGTPHRLSVTPGHISLPVR*HLLHST
Trigger: GGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGA...GATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATCTGAGCTCCACGATCTaGGAGTCAGTCAAGGTGCCC +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDLSSTI*ESVKVP
Trigger: GGGCACCTTGACTGACTCCCAGATCGTGGAGCTCAG...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGTGTGCTCAGTCGAATaGTTAGTGAGGTGCTACAGG +
Preference number: 4 (lower is better)
Translates to: VSEVLQVSVGDGYPPELHVCSVE*LVRCYR
Trigger: CCTGTAGCACCTCACTAACCATTCGACTGAGCACAC...GTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAAC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp TTCCAGTCTCCCCCACATTCCAAAGATGTGCACGTGAGGCTGAATCAGCATGTGGGGCAACTGTCCGTGTaGAGTCTGCACATTCTCCCC +
Preference number: 4 (lower is better)
Translates to: FQSPPHSKDVHVRLNQHVGQLSV*SLHILP
Trigger: GGGGAGAATGTGCAGACTCCACACGGACAGTTGCCC...CACATGCTGATTCAGCCTCACGTGCACATCTTTGGAATGTGGGGGAGACTGGAA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR TCA 90 bp CTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACGGTAATCCTCAGGACTaGATGCTGTCAAGGACACTG +
Preference number: 4 (lower is better)
Translates to: LVGMDEHHEHHHEARQRNGNPQD*MLSRTL
Trigger: CAGTGTCCTTGACAGCATTCAGTCCTGAGGATTACC...GTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000639431.1
CDS-3UTR TCA 90 bp TTCCACCAACAACACGCCATTCGACTGCCACTTGACCTAAGCTGCCCCCTGTCCCTCCTTCATGACCTATaGCAGATCTGGAAGCTGTCT +
Preference number: 4 (lower is better)
Translates to: FHQQHAIRLPLDLSCPLSLLHDL*QIWKLS
Trigger: AGACAGCTTCCAGATCTGTCATAGGTCATGAAGGAG...GGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGACGCTGGCCACCACCGTaGTGTTGGCAGTGCTGCTGG +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRRWPPP*CWQCCW
Trigger: CCAGCAGCACTGCCAACATCACGGTGGTGGCCAGCG...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGGCAGTAAGGCTTCTTaGGAGTTGGGTCCTACTGTC +
Preference number: 4 (lower is better)
Translates to: AWMNTTNTTTRHVKGTRAGSKAS*ELGPTV
Trigger: GACAGTAGGACCCAACTCTCAAGAAGCCTTACTGCC...AGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACAAACCTGATCGGAGTTaGGCTCCGCCAGGAGCACTG +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHKPDRS*APPGAL
Trigger: CAGTGCTCCTGGCGGAGCTCAACTCCGATCAGGTTT...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GTCAGGTGGCACCTCCTCCATAGCACCGATGAGATTCTGGGTGGACTTGCTGATACAGCAGGTGTGCCATaGAGGGTGACAAGTTTCTCA +
Preference number: 4 (lower is better)
Translates to: VRWHLLHSTDEILGGLADTAGVP*RVTSFS
Trigger: TGAGAAACTTGTCACCCTTCATGGCACACCTGCTGT...ATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGTGCCACCTGAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCCTCGCCAAAAGACCTTaGCATCTTCAAAGGCCCTGT +
Preference number: 4 (lower is better)
Translates to: EDGNVAPFCGLGFKSGLALAKRP*HLQRPC
Trigger: ACAGGGCCTTTGAAGATGTCAAGGTCTTTTGGCGAG...GGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGTCTCTGGCGTTAGGATaGCATCCAATACAGTGCTTC +
Preference number: 4 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDESLALG*HPIQCF
Trigger: GAAGCACTGTATTGGATGTCATCCTAACGCCAGAGA...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTGGCCACTTTCATGCTaGTGGTATGGAGCACTCTGT +
Preference number: 4 (lower is better)
Translates to: SVLSRMVSEVLQVSVGDGWPLSC*WYGALC
Trigger: ACAGAGTGCTCCATACCATCAGCATGAAAGTGGCCA...CCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCCAGCTTGCAGCAGCCTaGTTCCAAAGGAGACACAGA +
Preference number: 4 (lower is better)
Translates to: EHHHEARQRNKSCSEQSSQLAAA*FQRRHR
Trigger: TCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTG...GCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACTTCCACTCCCGGGCGTaGAAAAGGCTGTGCTGGGTC +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYFHSRA*KRLCWV
Trigger: GACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAA...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATC +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHVRCYR*VSAMGI
Trigger: GATACCCATCGCCGACACTCACCTGTAGCACCTCAC...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCGCTGGGCTGTCTGCTTaGGCCACAGGACATCCATGC +
Preference number: 4 (lower is better)
Translates to: SSLHGVDLGVPKGFRIPLAGLSA*ATGHPC
Trigger: GCATGGATGTCCTGTGGCTCAAGCAGACAGCCCAGC...GAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp GGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCCAAAGTGGGTCAGGCACCATCCAGCCCCACTTGTaGTTCCAAATTCTGAGCATA +
Preference number: 4 (lower is better)
Translates to: GSPTAETFIQVLQSGSGTIQPHL*FQILSI
Trigger: TATGCTCAGAATTTGGAAGCACAAGTGGGGCTGGAT...GGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp GCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTAGCCCCCAAATGGCCTaGGAATCTGCATCTGAGACA +
Preference number: 4 (lower is better)
Translates to: AWMNTTNTTTRHVKGTRASPQMA*ESASET
Trigger: TGTCTCAGATGCAGATTCGCAGGCCATTTGGGGGCT...AGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp GTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACTTGGGGACTTGCGTATaGAGACGCCAGAAACAGAAT +
Preference number: 4 (lower is better)
Translates to: VSEVLQVSVGDGYPPELHLGTCV*RRQKQN
Trigger: ATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAA...GTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp CATTCTCCCCATATCTGCATGGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTAGTGTGACTGTGCCCTaGGATGGGATGGAGTCCTGT +
Preference number: 4 (lower is better)
Translates to: HSPHICMGLSKCSSLPHISVTVP*DGMESC
Trigger: ACAGGACTCCATCCCATCGCAGGGCACAGTCACACT...AATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGATATGGGGAGAATG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR CCA 90 bp CGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGAGGCTTCTTGAGAGTTaGGTCCTACTGTCTCCCAGT +
Preference number: 4 (lower is better)
Translates to: RMVSEVLQVSVGDGYPPERLLES*VLLSPS
Trigger: ACTGGGAGACAGTAGGACCCAACTCTCAAGAAGCCT...CTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTAATCTTCCAGTGGCTTaGCGCTTCCTGCAGTGGTCT +
Preference number: 4 (lower is better)
Translates to: SRMVSEVLQVSVGDGYPPNLPVA*RFLQWS
Trigger: AGACCACTGCAGGAAGCGCCAAGCCACTGGAAGATT...AGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTCCTGTCCCAGAATCTCTGGCCACCTGCAGACTGATTAAAGTGGCCTTCTTGCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 4 (lower is better)
Translates to: SPVPESLATCRLIKVAFLLSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...CAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTCTGGGACAGGACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTGACCCCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGAATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATG +
Preference number: 4 (lower is better)
Translates to: SDPWPYPPEDGNVAPFCGICFPL*LHLVGM
Trigger: CATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT...TCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCACT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCCTGAGCTCCACGATCTaGGAGTCAGTCAAGGTGCCC +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGLSSTI*ESVKVP
Trigger: GGGCACCTTGACTGACTCCCAGATCGTGGAGCTCAG...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GTGTTCCAGTCTCCCCCACATTCCAAAGATGTGCACGTGAGGCTGAATCAGCATAGCCCTGAGCTACCATaGAAGGCTCTGGCAACCTAC +
Preference number: 4 (lower is better)
Translates to: VFQSPPHSKDVHVRLNQHSPELP*KALATY
Trigger: GTAGGTTGCCAGAGCCTTCCATGGTAGCTCAGGGCT...ATGCTGATTCAGCCTCACGTGCACATCTTTGGAATGTGGGGGAGACTGGAACAC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000507314.2
3UTR CAA 72 bp CGAATTCATCACCTTCCTGCATTATGGCCCATTGCCTaGTCACAGGCTCATAGTCACTCCCAGCCACAGCCT +
Preference number: 4 (lower is better)
Translates to: RIHHLPALWPIA*SQAHSHSQPQP
Trigger: AGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACTCCGTTCCACTGTGGTaGCGCCGCATGTGCTGTTGT +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYSVPLW*RRMCCC
Trigger: ACAACAGCACATGCGGCGTCACCACAGTGGAACGGA...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGTCCTGACATCATACAGCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTT +
Preference number: 4 (lower is better)
Translates to: IKQGDSGWWNSLCPDIIQHWLLL*GQLHIL
Trigger: AAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTG...CTGTATGATGTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCCAAAGTGGGTCAGGCACCTCTGTCACAATGAACTaGACTGTCACTGTTCCAAAC +
Preference number: 4 (lower is better)
Translates to: GSPTAETFIQVLQSGSGTSVTMN*TVTVPN
Trigger: GTTTGGAACAGTGACAGTTCAGTTCATTGTGACAGA...GGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp AGTGACCCCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGAGTTTCAGGAGCAAACTaGACAACTCCATTTGGGTCA +
Preference number: 4 (lower is better)
Translates to: SDPWPYPPEDGNVAPFCGVSGAN*TTPFGS
Trigger: TGACCCAAATGGAGTTGTTCAGTTTGCTCCTGAAAC...TCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGGGGTCACT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTGTGTGCCATGAAGGGTaGCAAGTTTCTCAGGGATGG +
Preference number: 4 (lower is better)
Translates to: SASWGLAYADARNRICVPVCHEG*QVSQGW
Trigger: CCATCCCTGAGAAACTTGTCACCCTTCATGGCACAC...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTGCATTTGGTTCCATCTaGGCACATCTTTCACCGAAA +
Preference number: 4 (lower is better)
Translates to: PGHILQRTGTWLHFVDLAAFGSI*AHLSPK
Trigger: TTTCGGTGAAAGATGTGCTCAGATGGAACCAAATGC...AGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTCTGGCTGCCATCATGTaGGTCAGAAGTTTAGCTGCA +
Preference number: 4 (lower is better)
Translates to: AWMNTTNTTTRHVKGTRALAAIM*VRSLAA
Trigger: TGCAGCTAAACTTCTGACTCACATGATGGCAGCCAG...AGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAG +
Preference number: 4 (lower is better)
Translates to: GKTADIASLCAHHSSPARDSSHS*TALLSE
Trigger: CTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTC...ACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACGAACAAGAGCTGCAGTaGACAAAGCAGCATAGACGT +
Preference number: 4 (lower is better)
Translates to: LVGMDEHHEHHHEARQRNEQELQ*TKQHRR
Trigger: ACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTC...GTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACGTTTGGAATTTCCACTCCCGGGCGTaGAAAAGGCTGTGCTGGGTC +
Preference number: 4 (lower is better)
Translates to: ARQRNKSCSEQSSIDVWNFHSRA*KRLCWV
Trigger: GACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAA...ATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAATCTGGGTGGACTTGCTaGTTTCCCCTCCAGCAGGAG +
Preference number: 4 (lower is better)
Translates to: IICFPLWLHLVGMDEHHESGWTC*FPLQQE
Trigger: CTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGA...TTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCC +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGLIGYQ*PLAISS
Trigger: GGAGGATATGGCCAGGGGTCACTGATAGCCGATGAG...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGTTTTCACTGGGCCCTTGAAGGCATAGATATGGGACTCAACATGCACAGCAAGCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCC +
Preference number: 4 (lower is better)
Translates to: SFHWALEGIDMGLNMHSKLIGYQ*PLAISS
Trigger: GGAGGATATGGCCAGGGGTCACTGATAGCCGATGAG...CTTGCTGTGCATGTTGAGTCCCATATCTATGCCTTCAAGGGCCCAGTGAAAACT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638990.1
CDS-3UTR TCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATCCCTCCTGGCTGCCTTaGCCAGATTCATTATCACTG +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDPSWLP*PDSLSL
Trigger: CAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGG...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATGTGGAACGCTGCTTGCAGGCAGGGTCATTGCGTCCTTAGGCTGAGGAGGCAGTTCAATCAAAAGCTCTaGTCTCTGCCAAGGAAGGAA +
Preference number: 4 (lower is better)
Translates to: MWNAACRQGHCVLRLRRQFNQKL*SLPRKE
Trigger: TTCCTTCCTTGGCAGAGATCAGAGCTTTTGATTGAA...CTGCCTCCTCAGCCTAAGGACGCAATGACCCTGCCTGCAAGCAGCGTTCCACAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR GCA 90 bp GACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTAAGCTGGCTGCCACCCGCTCACTGGGTCTaGAATGTCTCTATTCTGTGG +
Preference number: 4 (lower is better)
Translates to: DLRMQTPETESVYLSWLPPAHWV*NVSILW
Trigger: CCACAGAATAGAGACATTGCAGACCCAGTGAGCGGG...TGGCAGCCAGCTTAGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCACCAGCTGCCTCTCTaGATTTTCGGTAACAATCGG +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPHQLPL*IFGNNR
Trigger: CCGATTGTTACCGAAAATGCAGAGAGGCAGCTGGTG...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CCCTGTTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGAAGGACAGCAGATTTTaGTTCCTGAAGAATTGTTGG +
Preference number: 4 (lower is better)
Translates to: PCWKDALSQSGGTSSIAPKDSRF*FLKNCW
Trigger: CCAACAATTCTTCAGGAAGCAAAATCTGCTGTCCTT...CGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAACAGGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACCTCCTCCACAATCTGTaGTCCCCCTTGAGGGTTTGT +
Preference number: 4 (lower is better)
Translates to: HHEARQRNKSCSEQSSIDLLHNL*SPLRVC
Trigger: ACAAACCCTCAAGGGGGAGCACAGATTGTGGAGGAG...GTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGCTTCTTGTGAGCCACTaGCAGCCGAGAACCCACAGA +
Preference number: 4 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQLLVSH*QPRTHR
Trigger: TCTGTGGGTTCTCGGCTGGCAGTGGCTCACAAGAAG...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp TCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCAGGATGCCCATTCATTTCAGTCAGAAGTTTAGCTaGAAACATGGAGTACCTGGC +
Preference number: 4 (lower is better)
Translates to: STPGREKGCAGSRMPIHFSQKFS*KHGVPG
Trigger: GCCAGGTACTCCATGTTTGCAGCTAAACTTCTGACT...GAAATGAATGGGCATCCTGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp GAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 4 (lower is better)
Translates to: EDGNVAPFCGLGFKSGLAYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...GGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GTGGCACAGGTATACAGGGGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCAGGCACCCCTTGAATTaGAGATTCATAGTAGGACAG +
Preference number: 4 (lower is better)
Translates to: VAQVYRGSPTAETFIQVLRHPLN*RFIVGQ
Trigger: CTGTCCTACTATGAATCTCCAATTCAAGGGGTGCCT...GAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCCCCTGTATACCTGTGCCAC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGGGCGATTCCGGCTGGTaGAACTCCTTGTGTCCTGAC +
Preference number: 4 (lower is better)
Translates to: NPCAGSRTMYNTATLSWTGDSGW*NSLCPD
Trigger: GTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCC...CGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACCAGGGCGATTCCGGCTaGTGGAACTCCTTGTGTCCT +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYQGDSG*WNSLCP
Trigger: AGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTG...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GTCAGGTGGCACCTCCTCCATAGCACCGATGAGATTCTGGGTGGACTTGCTGATGAACAACCCGCTCACTaGGTCTGCAATGTCTCTATT +
Preference number: 4 (lower is better)
Translates to: VRWHLLHSTDEILGGLADEQPAH*VCNVSI
Trigger: AATAGAGACATTGCAGACCCAGTGAGCGGGTTGTTC...ATCAGCAAGTCCACCCAGAATCTCATCGGTGCTATGGAGGAGGTGCCACCTGAC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp CCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTAGCTTTCTCAGAGACTaGAAGGACAGCAGATTTTGC +
Preference number: 4 (lower is better)
Translates to: PGHILQRTGTWLHFVDLASFLRD*KDSRFC
Trigger: GCAAAATCTGCTGTCCTTCCAGTCTCTGAGAAAGCT...AGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp CCCCTCCTGGCTGCCTTGACCAGATTCATTATCACTGACACTGAGACCAGCACCCAAGTTTCTCAGGGATaGCAGATACACCAGTTGCCT +
Preference number: 4 (lower is better)
Translates to: PLLAALTRFIITDTETSTQVSQG*QIHQLP
Trigger: AGGCAACTGGTGTATCTGCCATCCCTGAGAAACTTG...GGTGCTGGTCTCAGTGTCAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp CCCCTCCTGGCTGCCTTGACCAGATTCATTATCACTGACACTGAGACCAGCACCTTTACCCCATCCTTCTaGAGCACGACGACTGTTTTG +
Preference number: 4 (lower is better)
Translates to: PLLAALTRFIITDTETSTFTPSF*STTTVL
Trigger: CAAAACAGTCGTCGTGCTCCAGAAGGATGGGGTAAA...GGTGCTGGTCTCAGTGTCAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGGG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp GAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGAATACAGTGCTTCTCTaGCCAGGTTCAAAGACCAAT +
Preference number: 4 (lower is better)
Translates to: EVLQVSVGDGYPPELHDLNTVLL*PGSKTN
Trigger: ATTGGTCTTTGAACCTGGCCAGAGAAGCACTGTATT...CAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp GTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACTCTGGCACCACCTTTTaGGTCAAAAAGGACAATCTG +
Preference number: 4 (lower is better)
Translates to: VSEVLQVSVGDGYPPELHSGTTF*VKKDNL
Trigger: CAGATTGTCCTTTTTGACCCAAAAGGTGGTGCCAGA...GTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAAC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp TCACCCACCCCAGATCTTGGCAGAGCAGCCTGCTATGATTTCTCCTCATTACCAACTGAGAAAGACTGCTaGGCTGTCTGCTTGAGCCAC +
Preference number: 4 (lower is better)
Translates to: SPTPDLGRAACYDFSSLPTEKDC*AVCLSH
Trigger: GTGGCTCAAGCAGACAGCCCAGCAGTCTTTCTCAGT...TGGTAATGAGGAGAAATCATAGCAGGCTGCTCTGCCAAGATCTGGGGTGGGTGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTAACAAGGGACCCCCTTaGTCGGATGATGTGGAGCTC +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSNKGPP*SDDVEL
Trigger: GAGCTCCACATCATCCGATCAAGGGGGTCCCTTGTT...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GGAGAACTGCAGCAAGCCATATGGATGATCACTAGCTTTGATGGTGATATCAGTATTGCGTCCTTAGGCTaGGGAGGCAGCCCTGTGGAG +
Preference number: 4 (lower is better)
Translates to: GELQQAIWMITSFDGDISIASLG*GGSPVE
Trigger: CTCCACAGGGCTGCCTCCTCAGCCTAAGGACGCAAT...ACTGATATCACCATCAAAGCTAGTGATCATCCATATGGCTTGCTGCAGTTCTCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR TCA 90 bp ATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGTCCTGACATCATACAGGGAAACACTGAGGACTaGCACAGAGAATGCCTTATC +
Preference number: 4 (lower is better)
Translates to: IKQGDSGWWNSLCPDIIQGNTED*HRECLI
Trigger: GATAAGGCATTCTCTGTGTCAGTCCTCAGTGTTTCC...CTGTATGATGTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGAT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp CCACCAAGGTTTGGGGCTGCTCCTGAACTTCAACAAATAAGCCATCTTCGGAAGCTCCCAGCCACAGCCTaGCCACTAAAAAGAGATGCT +
Preference number: 4 (lower is better)
Translates to: PPRFGAAPELQQISHLRKLPATA*PLKRDA
Trigger: AGCATCTCTTTTTAGTGGTCAGGCTGTGGCTGGGAG...CTTCCGAAGATGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAACCTTGGTGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TTCCACCAACAACACGCCATTCGACTGCCACTTGACCTAAGCTGCCCCCTGTCCTCTCCATCAGCAAAATaGAGAATCATTGGGGTGAAG +
Preference number: 4 (lower is better)
Translates to: FHQQHAIRLPLDLSCPLSSPSAK*RIIGVK
Trigger: CTTCACCCCAATGATTCTTCATTTTGCTGATGGAGA...GGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCCAAAGTGGGTCAGGCACCATATTTGTAGGGCCTTaGATCGAACACCTTCTTCTA +
Preference number: 4 (lower is better)
Translates to: GSPTAETFIQVLQSGSGTIFVGP*IEHLLL
Trigger: TAGAAGAAGGTGTTCGATTCAAGGCCCTACAAATAT...GGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCATCTGTGCTCCCCCTTaGGGGTTTGTGAGAAACACG +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGICAPP*GFVRNT
Trigger: CGTGTTTCTCACAAACCCTCAAGGGGGAGCACAGAT...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACCCTATGATGCCATTGTaGAGGTCACTCCCTGTAATA +
Preference number: 4 (lower is better)
Translates to: LVGMDEHHEHHHEARQRNPMMPL*RSLPVI
Trigger: TATTACAGGGAGTGACCTTCACAATGGCATCATAGG...GTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGGTCCCTGACACAGACTaGAGTTCCTCCACCAGGTTT +
Preference number: 4 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQVPDTD*SSSTRF
Trigger: AAACCTGGTGGAGGAACTTCAGTCTGTGTCAGGGAC...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCACCACGAGTTCGGCTGGCAACACTaGAAGCTTGAATTTTTCCTT +
Preference number: 4 (lower is better)
Translates to: PLWLHLVGMDEHHEHHHEFGWQH*KLEFFL
Trigger: AAGGAAAAATTCAAGCTTTCAGTGTTGCCAGCCGAA...CTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACAGGAGTTGTGAACTCTaGCCTTTCACACTCAAAGAT +
Preference number: 4 (lower is better)
Translates to: VSEVLQVSVGDGYPPELHRSCEL*PFTLKD
Trigger: ATCTTTGAGTGTGAAAGGTCAGAGTTCACAACTCCT...GTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGAGACACAGAGATGTCTaGGGAATAATTCTAGGCTCA +
Preference number: 4 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDERHRDV*GIILGS
Trigger: TGAGCCTAGAATTATTCCTCAGACATCTCTGTGTCT...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTATACACAGACATGTGTaGACAGGCACATTCCACATA +
Preference number: 4 (lower is better)
Translates to: PGHILQRTGTWLHFVDLAIHRHV*TGTFHI
Trigger: TATGTGGAATGTGCCTGTTCACACATGTCTGTGTAT...AGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCAGAAATTCACAGACTaGATGAGCATCCAGCTAAAC +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDQKFTD*MSIQLN
Trigger: GTTTAGCTGGATGCTCATTCAGTCTGTGAATTTCTG...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 4 (lower is better)
Translates to: LVGMDEHHEHHHEARQRNTGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...GTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 4 (lower is better)
Translates to: MVSEVLQVSVGDGYPPELTGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...GAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCAT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTGAACAAGAGCTGCAGTaGACAAAGCAGCATAGACGT +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPEQELQ*TKQHRR
Trigger: ACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTC...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCCCCTCCTGGCTGCCTTaGCCAGATTCATTATCACTG +
Preference number: 4 (lower is better)
Translates to: PSSEDIIICFPLWLHLVGPSWLP*PDSLSL
Trigger: CAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGG...GCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATC +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHVRCYR*VSAMGI
Trigger: GATACCCATCGCCGACACTCACCTGTAGCACCTCAC...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTGGAAGGATGCTCTCTCCCAGTCAGGTGGCACCTCCTCCATAGCACCGATGAGATTTTAACATGCTGGTaGTTTTTCACCAGGAGAGCC +
Preference number: 4 (lower is better)
Translates to: LEGCSLPVRWHLLHSTDEILTCW*FFTRRA
Trigger: GGCTCTCCTGGTGAAAAATCACCAGCATGTTAAAAT...CTCATCGGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGAGCATCCTTCCAA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000638990.1
CDS-3UTR GCA 90 bp TTCCTCCTCCACAGTGATATGTGGAACGCTGCTTGCAGGCAGGGTCATTGCGTCATCCTCAGGACTGAATaGTGTCAAGGACACTGTTCT +
Preference number: 4 (lower is better)
Translates to: FLLHSDMWNAACRQGHCVILRTE*CQGHCS
Trigger: AGAACAGTGTCCTTGACAGCATTCAGTCCTGAGGAT...GACGCAATGACCCTGCCTGCAAGCAGCGTTCCACATATCACTGTGGAGGAGGAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR GCA 90 bp CATTATGGCCCATTGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGTCCAACATGATTTTCTaGCACTCGGACAATTGGTGC +
Preference number: 4 (lower is better)
Translates to: HYGPLPCHRLIVTPSHSLSNMIF*HSDNWC
Trigger: GCACCAATTGTCCGAGTGGCAGAAAATCATGTTGGA...CAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp GTGGCACAGGTATACAGGGGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCAGACACTGTGAGATTTaGGAATTCATCACCTTCCTG +
Preference number: 4 (lower is better)
Translates to: VAQVYRGSPTAETFIQVLRHCEI*EFITFL
Trigger: CAGGAAGGTGATGAATTCGCAAATCTCACAGTGTCT...GAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCCCCTGTATACCTGTGCCAC
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTACCACGTTGGTTGGCTaGAGAATGGTAGTCGTCTTG +
Preference number: 4 (lower is better)
Translates to: SASWGLAYADARNRICVPTTLVG*RMVVVL
Trigger: CAAGACGACTACCATTCTGCAGCCAACCAACGTGGT...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp GCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTACCACGAAAGGGCAATaGATTTGGTTCCATCTGAGC +
Preference number: 4 (lower is better)
Translates to: AWMNTTNTTTRHVKGTRATTKGQ*IWFHLS
Trigger: GCTCAGATGGAACCAAATGCATTGCCCTTTCGTGGT...AGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp GAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCTGACTGTTGTTTATTGCTaGTCCAGCAGTAGCTTCATA +
Preference number: 4 (lower is better)
Translates to: EVLQVSVGDGYPPELHDLTVVYC*SSSSFI
Trigger: TATGAAGCTACTGCTGGAGCAGCAATAAACAACAGT...CAGATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CCAACATCCAGAAGTGTCTGTAGGCCATGTGTAGTCCTCCCCAAAGCCATGTCAGTCAGACAACCAGCTTaGAGCAGCCTGATTCCAAAG +
Preference number: 4 (lower is better)
Translates to: PTSRSVCRPCVVLPKAMSVRQPA*SSLIPK
Trigger: CTTTGGAATCAGGCTGCTGCAAGCTGGTTGTCTGAC...TGACATGGCTTTGGGGAGGACTACACATGGCCTACAGACACTTCTGGATGTTGG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp AGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGAGTCAGAAGTTTAGCTaGAAACATGGAGTACCTGGC +
Preference number: 4 (lower is better)
Translates to: SVLSRMVSEVLQVSVGDGSQKFS*KHGVPG
Trigger: GCCAGGTACTCCATGTTTGCAGCTAAACTTCTGACT...CCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp GTAGGCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGTTGGGGACTTGCGTATaGAGACGCCAGAAACAGAAT +
Preference number: 4 (lower is better)
Translates to: VGMDEHHEHHHEARQRNKLGTCV*RRQKQN
Trigger: ATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAA...CTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp TCCACTCCCGGGCGTGAAAAAGGCTGTGCTGGGTCCAGGATGCCCATTCATTTCGAAGACATCATCATATaGTTTCCACTGTGGCTTCAC +
Preference number: 4 (lower is better)
Translates to: STPGREKGCAGSRMPIHFEDIII*FPLWLH
Trigger: GTGAAGCCACAGTGGAAAGCATATGATGATGTCTTC...GAAATGAATGGGCATCCTGGACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAAAGGGAGTCAGTCAAGGTaGCCCCCTCCTGGCTGCCTT +
Preference number: 4 (lower is better)
Translates to: MCSPPQSHVTEIRAKRYKGSQSR*PPPGCL
Trigger: AAGGCAGCCAGGAGGGGGGCACCTTGACTGACTCCC...TTTATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACAT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CACTCTCCTGGACGTAGAGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTGTCATCCAGAAACACTaGGGACCCTCAGAAGCACTG +
Preference number: 4 (lower is better)
Translates to: HSPGRRELLALLGKSAHCVIQKH*GPSEAL
Trigger: CAGTGCTTCTGAGGGTCCCCAGTGTTTCTGGATGAC...ACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCTCTACGTCCAGGAGAGTG
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TTCCACCAACAACACGCCATTCGACTGCCACTTGACCTAAGCTGCCCCCTGTCCACTTTCGTCATCCTCTaGTTCAGAGTCATCCAAGAT +
Preference number: 4 (lower is better)
Translates to: FHQQHAIRLPLDLSCPLSTFVIL*FRVIQD
Trigger: ATCTTGGATGACTCTGAACCAGAGGATGACGAAAGT...GGACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATGGCGTGTTGTTGGTGGAA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACAACAGGCGATTCCGGCTGGTaGAACTCCTTGTGTCCTGAC +
Preference number: 4 (lower is better)
Translates to: PPLPEPLHQCRKYCRTTTGDSGW*NSLCPD
Trigger: GTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCC...TGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGG
51% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTCTGCAAGCCCCCAAATaGCCTGCGAATCTGCATCTG +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGLQAPK*PANLHL
Trigger: CAGATGCAGATTCGCAGGCCATTTGGGGGCTTGCAG...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATG +
Preference number: 4 (lower is better)
Translates to: VLSRMVSEVLQVSVGDGYICFPL*LHLVGM
Trigger: CATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT...ATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ATTAAATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCAGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGA +
Preference number: 4 (lower is better)
Translates to: IKSSNSWDSSSAISDPWPALNQG*PDCPVG
Trigger: TCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGC...TGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATTTAAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGA +
Preference number: 4 (lower is better)
Translates to: PSSEDIIICFPLWLHLVGALNQG*PDCPVG
Trigger: TCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGC...GCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGAC +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYAISDP*PYPPED
Trigger: GTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGC...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCTGCATGGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTCCAAAGATGTGCACTCCCCATATCTGCATaGGTCTCTCCAAGTGTTCCA +
Preference number: 4 (lower is better)
Translates to: SAWVSPSVPVSPTFQRCALPISA*VSPSVP
Trigger: TGGAACACTTGGAGAGACCCATGCAGATATGGGGAG...TGCACATCTTTGGAATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGA
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR CCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGCCAGAAACAGAATCTaGAAAATCGGGCCACTCCCA +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDARNRI*KIGPLP
Trigger: TGGGAGTGGCCCGATTTTCCAGATTCTGTTTCTGGC...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000639821.1
CDS-3UTR TCA 90 bp CACTCTCCTGGACGTAGAGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTAATTCAAATACGCCATaGGCGTGGTCAGAGGCTGCA +
Preference number: 4 (lower is better)
Translates to: HSPGRRELLALLGKSAHCNSNTP*AWSEAA
Trigger: TGCAGCCTCTGACCACGCTCATGGCGTATTTGAATT...ACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCTCTACGTCCAGGAGAGTG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CATTATGGCCCATTGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGTCCACTGACAAAGAGTaGCTCAGGGCTAAATTCAAA +
Preference number: 4 (lower is better)
Translates to: HYGPLPCHRLIVTPSHSLSTDKE*LRAKFK
Trigger: TTTGAATTTAGCCCTGAGTCACTCTTTGTCAGTGGA...CAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATTCCTCCAGAACACTGTaGCCTCCCCCAAAATCCCTG +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHSSRTL*PPPKSL
Trigger: CAGGGATTTTGGGGGAGGTCACAGTGTTCTGGAGGA...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACGCTGGCCACCACCGTaGTGTTGGCAGTGCTGCTGG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTRWPPP*CWQCCW
Trigger: CCAGCAGCACTGCCAACATCACGGTGGTGGCCAGCG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp GCATGGATGAACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTCAGAGCCAGAGGCTCTaGATAAGTCTTCTTAGACAA +
Preference number: 4 (lower is better)
Translates to: AWMNTTNTTTRHVKGTRAQSQRL*ISLLRQ
Trigger: TTGTCTAAGAAGACTTATTCAGAGCCTCTGGCTCTG...AGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTTCATCCATGC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATTCATCTGGTAGCAAATaGACATCAAAGCTAGCTTCA +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDSSGSK*TSKLAS
Trigger: TGAAGCTAGCTTTGATGTTCATTTGCTACCAGATGA...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCAAACAGAGAACCATGTaGTACTCTTCTCCAGATCCA +
Preference number: 4 (lower is better)
Translates to: EDGNVAPFCGLGFKSGLAKQRTM*YSSPDP
Trigger: TGGATCTGGAGAAGAGTATCACATGGTTCTCTGTTT...GGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAAAACCTGATCGGAGTTaGGCTCCGCCAGGAGCACTG +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRKPDRS*APPGAL
Trigger: CAGTGCTCCTGGCGGAGCTCAACTCCGATCAGGTTT...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACTGGCCACCTGCAGACTaGTTAAAGTGGCCTTCTTGT +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHWPPAD*LKWPSC
Trigger: ACAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCA...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCCACGATCATTTGTCCTTCCTCTaGAGACATCATCATATGCTT +
Preference number: 4 (lower is better)
Translates to: SEVLQVSVGDGYPPELHDHLSFL*RHHHML
Trigger: AAGCATATGATGATGTCTTCAGAGGAAGGACAAATG...ATCGTGGAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp AACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACATCCTCAGGACTGAATaGTGTCAAGGACACTGTTCT +
Preference number: 4 (lower is better)
Translates to: NTTNTTTRHVKGTRAAVNILRTE*CQGHCS
Trigger: AGAACAGTGTCCTTGACAGCATTCAGTCCTGAGGAT...GTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000639431.1
CDS-3UTR GCA 90 bp GGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCCAAAGTGGGTCAGGCACCACCACTAAAAAGAGATaGTACCCTGGTCATGTTTTT +
Preference number: 4 (lower is better)
Translates to: GSPTAETFIQVLQSGSGTTTKKR*YPGHVF
Trigger: AAAAACATGACCAGGGTAGCATCTCTTTTTAGTGGT...GGTGCCTGACCCACTTTGGAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CACAATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACGGCCAAGAGGTTCTCTaGTCCTCTGGGCTACCAATG +
Preference number: 4 (lower is better)
Translates to: HNELNCHCSKQSLCRFPNGQEVL*SSGLPM
Trigger: CATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCC...GTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CCAAGTGTTCCAGTCTCCCCCACATTCCAAAGATGTGCACGTGAGGCTGAATCATCTTTGACCACCAGCTaGCTCTCTGCATTTTCGGTA +
Preference number: 4 (lower is better)
Translates to: PSVPVSPTFQRCAREAESSLTTS*LSAFSV
Trigger: TACCGAAAATGCAGAGAGGCAGCTGGTGGTCAAAGA...TGATTCAGCCTCACGTGCACATCTTTGGAATGTGGGGGAGACTGGAACACTTGG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR GCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATTCTTTGACCACCAGCTaGCTCTCTGCATTTTCGGTA +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDSLTTS*LSAFSV
Trigger: TACCGAAAATGCAGAGAGGCAGCTGGTGGTCAAAGA...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTTCTTGTGAGCCACTaGCAGCCGAGAACCCACAGA +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHLLVSH*QPRTHR
Trigger: TCTGTGGGTTCTCGGCTGGCAGTGGCTCACAAGAAG...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACGTCAGACAACCAGCTTaGAGCAGCCTGATTCCAAAG +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHVRQPA*SSLIPK
Trigger: CTTTGGAATCAGGCTGCTGCAAGCTGGTTGTCTGAC...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp AGATTCTGGGTGGACTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGACATTCCACATAGTCTaGAGTTTCCTCAACCACTTT +
Preference number: 4 (lower is better)
Translates to: RFWVDLLISPPAGGIPLPTFHIV*SFLNHF
Trigger: AAAGTGGTTGAGGAAACTGCAGACTATGTGGAATGT...CGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGAATCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACAGCGAGTTGGGGACTTaGGTATGCAGACGCCAGAAA +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYSELGT*VCRRQK
Trigger: TTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCT...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp GGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTAGCGAGTTGGGGACTTaGGTATGCAGACGCCAGAAA +
Preference number: 4 (lower is better)
Translates to: GKTADIASLCAHHSSPARSELGT*VCRRQK
Trigger: TTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCT...ACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGGGAGTCAGTCAAGGTaGCCCCCTCCTGGCTGCCTT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREGSQSR*PPPGCL
Trigger: AAGGCAGCCAGGAGGGGGGCACCTTGACTGACTCCC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp CTTGCTGATTTCCCCTCCAGCAGGAGGCATTCCACTCCCGGGCGTGAAAAAGGCTATCAAGGATGGTTTTaGTTCAGACATTGTTCTAGG +
Preference number: 4 (lower is better)
Translates to: LADFPSSRRHSTPGREKGYQGWF*FRHCSR
Trigger: CCTAGAACAATGTCTGAAGCAAAACCATCCTTGATA...GCCTTTTTCACGCCCGGGAGTGGAATGCCTCCTGCTGGAGGGGAAATCAGCAAG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000638990.1
CDS-3UTR CCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGATTGGTTTCTGCTAGCTaGCCCCCAGGACCTGGGGAT +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRLVSAS*PPGPGD
Trigger: ATCCCCAGGTCCTGGGGGCCAGCTAGCAGAAACCAA...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTGTCATCCAGAAACACTaGGGACCCTCAGAAGCACTG +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSVIQKH*GPSEAL
Trigger: CAGTGCTTCTGAGGGTCCCCAGTGTTTCTGGATGAC...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCGGCGATTCCGGCTGGTaGAACTCCTTGTGTCCTGAC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSGDSGW*NSLCPD
Trigger: GTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCC...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GTTCACTCTAACAGTGTCGGAGCTTGGCAAAATTCTACTTCCACCTTCAGTGTACAGGGCGATTCCGGCTaGTGGAACTCCTTGTGTCCT +
Preference number: 4 (lower is better)
Translates to: VHSNSVGAWQNSTSTFSVQGDSG*WNSLCP
Trigger: AGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTG...TACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGGCAACCACGTTGGTTaGCTGCAGAATGGTAGTCGT +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGGNHVG*LQNGSR
Trigger: ACGACTACCATTCTGCAGCCAACCAACGTGGTTGCC...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp CCTGGCCATATCCTCCAGAGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTAATATAAACAATGGATaGCCCAAGGCTGAATGTTCC +
Preference number: 4 (lower is better)
Translates to: PGHILQRTGTWLHFVDLANINNG*PKAECS
Trigger: GGAACATTCAGCCTTGGGCCATCCATTGTTTATATT...AGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTGGAGGATATGGCCAGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp GAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCCTGGCACAGAAGATATaGGAAAGAACAGCCAAGCAA +
Preference number: 4 (lower is better)
Translates to: EHHHEARQRNKSCSEQSSLAQKI*ERTAKQ
Trigger: TTGCTTGGCTGTTCTTTCCCATATCTTCTGTGCCAG...GCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGCAAACATGGAGTACCTaGCACAGAAGATATGGGAAA +
Preference number: 4 (lower is better)
Translates to: SVLSRMVSEVLQVSVGDGQTWST*HRRYGK
Trigger: TTTCCCATATCTTCTGTGCCAGGTACTCCATGTTTG...CCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACGTTTGGAATGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGAC +
Preference number: 4 (lower is better)
Translates to: ARQRNKSCSEQSSIDVWNAISDP*PYPPED
Trigger: GTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGC...ATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CAA 72 bp ATTTGCGAATTCATCACCTTCCTGCATTATGGCCCATaGCCTTGTCACAGGCTCATAGTCACTCCCAGCCAC +
Preference number: 4 (lower is better)
Translates to: ICEFITFLHYGP*PCHRLIVTPSH
Trigger: GTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCGCAAAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CAA 72 bp GCAGCACCCAAATGCTCAAGCCTTCATGGAGTTGATTaGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCTTC +
Preference number: 4 (lower is better)
Translates to: AAPKCSSLHGVD*GVPKGFRIPLF
Trigger: GAAGAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGAGCATTTGGGTGCTGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGAAATTCAAATACGCCATaGGCGTGGTCAGAGGCTGCA +
Preference number: 4 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRNSNTP*AWSEAA
Trigger: TGCAGCCTCTGACCACGCTCATGGCGTATTTGAATT...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACAACACTGGTTCAGTTCCACTaGCAAAGAGTGACTCAGGGC +
Preference number: 4 (lower is better)
Translates to: PPLPEPLHQCRKYCRTTTLVQFH*QRVTQG
Trigger: GCCCTGAGTCACTCTTTGTCAGTGGAACTGAACCAG...TGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GACACTGTGAGATTTGCGAATTCATCACCTTCCTGCATTATGGCCCATTGCCTTGCAATATCTCCACAGTaGTATTGGCGCTCGTCTGCC +
Preference number: 4 (lower is better)
Translates to: DTVRFANSSPSCIMAHCLAISPQ*YWRSSA
Trigger: GGCAGACGAGCGCCAATATCACTGTGGAGATATTGC...AAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCGCAAATCTCACAGTGTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGAGTAGGTCCAGAAGTCTaGATTGTTGACAGCTGGGCT +
Preference number: 4 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRVGPEV*IVDSWA
Trigger: AGCCCAGCTGTCAACAATTCAGACTTCTGGACCTAC...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GCTCTTGAACACGATAAACCATCTGAGCAAAGGCTACTGTACCATAAGGATCATCATTCGACTGCCACTTaGCCTAAGCTGCCCCCTGTC +
Preference number: 4 (lower is better)
Translates to: ALEHDKPSEQRLLYHKDHHSTAT*PKLPPV
Trigger: GACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATG...ATGATCCTTATGGTACAGTAGCCTTTGCTCAGATGGTTTATCGTGTTCAAGAGC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTCTTCTGTTGTCCCACTaGCAGGCACCTCTTGAAAGT +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSLLLSH*QAPLES
Trigger: ACTTTCAAGAGGTGCCTGTCAGTGGGACAACAGAAG...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTAACCCTCTGTGCTTCTaGCACTCGAAGTTGCTCATG +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSNPLCF*HSKLLM
Trigger: CATGAGCAACTTCGAGTGTCAGAAGCACAGAGGGTT...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCCCATGCTGAAAGGTaGCTGTACTGCCATGCAAAA +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGAHAER*LYCHAK
Trigger: TTTTGCATGGCAGTACAGTCACCTTTCAGCATGGGC...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GTCCCCAACTCAGAAGGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCGTCTTGCTTGTGCTaGGGTATGTGGTGGATTCAG +
Preference number: 4 (lower is better)
Translates to: VPNSEGKTADIASLCAHHSSCLC*GMWWIQ
Trigger: CTGAATCCACCACATACCTCAGCACAAGCAAGACGA...ATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCCTTCTGAGTTGGGGAC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CCAACATCCAGAAGTGTCTGTAGGCCATGTGTAGTCCTCCCCAAAGCCATGTCACCCCTTGAGGGTTTGTaGGAAACACGTAGAAGAATT +
Preference number: 4 (lower is better)
Translates to: PTSRSVCRPCVVLPKAMSPLEGL*ETRRRI
Trigger: AATTCTTCTACGTGTTTCTCACAAACCCTCAAGGGG...TGACATGGCTTTGGGGAGGACTACACATGGCCTACAGACACTTCTGGATGTTGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCATCTGAGACAAGAGTaGTGTTGGCAGTCCCATACA +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHHLRQE*CWQSHT
Trigger: TGTATGGGACTGCCAACATCACTCTTGTCTCAGATG...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTTGGCCACTTTCATGCTaGTGGTATGGAGCACTCTGT +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSWPLSC*WYGALC
Trigger: ACAGAGTGCTCCATACCATCAGCATGAAAGTGGCCA...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTTTCGGCTGGCAACACTaGAAGCTTGAATTTTTCCTT +
Preference number: 4 (lower is better)
Translates to: LLSELGTCVCRRQKQNLCFGWQH*KLEFFL
Trigger: AAGGAAAAATTCAAGCTTTCAGTGTTGCCAGCCGAA...ACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACATTAGTCAGGAGTTGTaGACTCTGACCTTTCACACT +
Preference number: 4 (lower is better)
Translates to: NTTNTTTRHVKGTRAAVNISQEL*TLTFHT
Trigger: AGTGTGAAAGGTCAGAGTTCACAACTCCTGACTAAT...GTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACCAGAAATTCACAGACTaGATGAGCATCCAGCTAAAC +
Preference number: 4 (lower is better)
Translates to: NTTNTTTRHVKGTRAAVNQKFTD*MSIQLN
Trigger: GTTTAGCTGGATGCTCATTCAGTCTGTGAATTTCTG...GTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTCCACTCCCGGGCGTaGAAAAGGCTGTGCTGGGTC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESFHSRA*KRLCWV
Trigger: GACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp AGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGGAACATCCTATTAACTaGTACAAACTGACTCCACCT +
Preference number: 4 (lower is better)
Translates to: SVLSRMVSEVLQVSVGDGEHPIN*YKLTPP
Trigger: AGGTGGAGTCAGTTTGTATCAGTTAATAGGATGTTC...CCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATGACATTGAGTCAGTTTCCCAAGGAACTACAACAGGTCTTCAAATCACACAGTCCCTGCCTTGAGCCCTaGGCTACCATGGAAGGCTCT +
Preference number: 4 (lower is better)
Translates to: MTLSQFPKELQQVFKSHSPCLEP*ATMEGS
Trigger: AGAGCCTTCCATGGTAGCTCAGGGCTCAAGGCAGGG...ACTGTGTGATTTGAAGACCTGTTGTAGTTCCTTGGGAAACTGACTCAATGTCAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR GCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTTGGCTCGCTCACTTCTaGACCTCCTCGTATTGTATG +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSWLAHF*TSSYCM
Trigger: CATACAATACGAGGAGGTGCAGAAGTGAGCGAGCCA...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGTGCAGGCAGGGTCATTaGGTCCTTAGGCTGAGGAGG +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKCRQGH*VLRLRR
Trigger: CCTCCTCAGCCTAAGGACGCAATGACCCTGCCTGCA...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGTCCTGACATCATACAGTGTGATGTTCTGGGTTaGTTCCTCAACTTTAACAGG +
Preference number: 4 (lower is better)
Translates to: IKQGDSGWWNSLCPDIIQCDVLG*FLNFNR
Trigger: CCTGTTAAAGTTGAGGAAGCAACCCAGAACATCACA...CTGTATGATGTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR GCA 90 bp TCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCCACCAGCTGCCTCTCTaGATTTTCGGTAACAATCGG +
Preference number: 4 (lower is better)
Translates to: SSLHGVDLGVPKGFRIPLHQLPL*IFGNNR
Trigger: CCGATTGTTACCGAAAATGCAGAGAGGCAGCTGGTG...GAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp AGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTATCACAGTCACCAGTTaGAAAGTGAAATTAGAGCCC +
Preference number: 4 (lower is better)
Translates to: RTGTWLHFVDLALNQGWPITVTS*KVKLEP
Trigger: GGGCTCTAATTTCACTTTGCAACTGGTGACTGTGAT...AGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCGGCAGATACACCAGTTaGCTCAGTAACAATGGCAAC +
Preference number: 4 (lower is better)
Translates to: PSSEDIIICFPLWLHLVGGRYTS*LSNNGN
Trigger: GTTGCCATTGTTACTGAGGCAACTGGTGTATCTGCC...GCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGGCACTGTTGTTTATTaGTGCTCCAGCAGTAGCTTC +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGGTVVY*CSSSSF
Trigger: GAAGCTACTGCTGGAGCAGCAATAAACAACAGTGCC...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTGAAGACATCATCATATaGTTTCCACTGTGGCTTCAC +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPEDIII*FPLWLH
Trigger: GTGAAGCCACAGTGGAAAGCATATGATGATGTCTTC...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp CACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCGAAGACATCATCATATaGTTTCCACTGTGGCTTCAC +
Preference number: 4 (lower is better)
Translates to: HEHHHEARQRNKSCSEQSEDIII*FPLWLH
Trigger: GTGAAGCCACAGTGGAAAGCATATGATGATGTCTTC...GCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGCTCAATCAGTGGAATTTCTaGAGCATTTGTCCTTCCTCT +
Preference number: 4 (lower is better)
Translates to: MVSEVLQVSVGDGYPPELNQWNF*SICPSS
Trigger: AGAGGAAGGACAAATGCTGCAGAAATTCCACTGATT...GAGCTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCAT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp CGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTGAGAATCAGTGGAATTTCTaGAGCATTTGTCCTTCCTCT +
Preference number: 4 (lower is better)
Translates to: RMVSEVLQVSVGDGYPPENQWNF*SICPSS
Trigger: AGAGGAAGGACAAATGCTGCAGAAATTCCACTGATT...CTCAGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR GCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGGGAGTCAGTCAAGGTaGCCCCCTCCTGGCTGCCTT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADGSQSR*PPPGCL
Trigger: AAGGCAGCCAGGAGGGGGGCACCTTGACTGACTCCC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
49% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCTTTCCCGTTCTCCGTaGCTGCTGAGGACCACCCAG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESLSRSP*LLRTTQ
Trigger: CTGGGTGGTCCTCAGCAGCCACGGAGAACGGGAAAG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp CATTATGGCCCATTGCCTTGTCACAGGCTCATAGTCACTCCCAGCCACAGCCTGGATAGTGTGATGTTCTaGGTTGCTTCCTCAACTTTA +
Preference number: 4 (lower is better)
Translates to: HYGPLPCHRLIVTPSHSLDSVMF*VASSTL
Trigger: TAAAGTTGAGGAAGCAACCCAGAACATCACACTATC...CAGGCTGTGGCTGGGAGTGACTATGAGCCTGTGACAAGGCAATGGGCCATAATG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGGTTCCTTTTCCTCCTaGGGACCGGACAACCGTCAA +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRGSFSS*GPDNRQ
Trigger: TTGACGGTTGTCCGGTCCCCAGGAGGAAAAGGAACC...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCACCCACCCCAGATCTTGGCAGAGCAGCCTGCTATGATTTCTCCTCATTACCACCAATAAGTATTGACTaGCGATCCGAATACAGGGCA +
Preference number: 4 (lower is better)
Translates to: SPTPDLGRAACYDFSSLPPISID*RSEYRA
Trigger: TGCCCTGTATTCGGATCGCCAGTCAATACTTATTGG...TGGTAATGAGGAGAAATCATAGCAGGCTGCTCTGCCAAGATCTGGGGTGGGTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTCCAATAAGTATTGACTaGCGATCCGAATACAGGGCA +
Preference number: 4 (lower is better)
Translates to: SASWGLAYADARNRICVPPISID*RSEYRA
Trigger: TGCCCTGTATTCGGATCGCCAGTCAATACTTATTGG...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAACCAGCTTGCAGCAGCCTGATTCCAAAGGAGACACAGAGATGTCTGAGGAAAGTTCTAGTCCACTCTaGGACTCCTCACTGAATCCT +
Preference number: 4 (lower is better)
Translates to: TTSLQQPDSKGDTEMSEESSSPL*DSSLNP
Trigger: AGGATTCAGTGAGGAGTCCCAGAGTGGACTAGAACT...TTCCTCAGACATCTCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTGGTTGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCTTTCCAGAAATAGCTaGAGATATGATGGTACGACC +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPLSRNS*RYDGTT
Trigger: GGTCGTACCATCATATCTCCAGCTATTTCTGGAAAG...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp CCCCTCCTGGCTGCCTTGACCAGATTCATTATCACTGACACTGAGACCAGCACCAGTGTCCTTGCGCTTTaGGTTAATAAGAGAACAAAG +
Preference number: 4 (lower is better)
Translates to: PLLAALTRFIITDTETSTSVLAL*VNKRTK
Trigger: CTTTGTTCTCTTATTAACCCAAAGCGCAAGGACACT...GGTGCTGGTCTCAGTGTCAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATCTGGCACAGAAGATATaGGAAAGAACAGCCAAGCAA +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDLAQKI*ERTAKQ
Trigger: TTGCTTGGCTGTTCTTTCCCATATCTTCTGTGCCAG...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTAGCAGCATAGACGTTTaGAATAAAACACAGGTCACC +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPSSIDV*NKTQVT
Trigger: GGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCT...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp AAGGAGACACAGAGATGTCTGAGGAATAATTCTAGGCTCAGCAGCATAAATCCTTCTCTCCCAGTCAGGTaGCACCTCCTCCATAGCACC +
Preference number: 4 (lower is better)
Translates to: KETQRCLRNNSRLSSINPSLPVR*HLLHST
Trigger: GGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGA...AGGATTTATGCTGCTGAGCCTAGAATTATTCCTCAGACATCTCTGTGTCTCCTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CAGCCAGGGCAACTGTCCGTGTGGAGTCTGCACATTCTCCCCATATCTGCATGGAACCTGATTCTTTATTaGCACCACGTCCACTTTATA +
Preference number: 4 (lower is better)
Translates to: QPGQLSVWSLHILPISAWNLILY*HHVHFI
Trigger: TATAAAGTGGACGTGGTGCCAATAAAGAATCAGGTT...CCATGCAGATATGGGGAGAATGTGCAGACTCCACACGGACAGTTGCCCTGGCTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR CCA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTGCACAGCAAGGTAGATaGTTCACATCTAAGACAACC +
Preference number: 4 (lower is better)
Translates to: SASWGLAYADARNRICVPAQQGR*FTSKTT
Trigger: GGTTGTCTTAGATGTGAACCATCTACCTTGCTGTGC...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638990.1
CDS-3UTR TCA 90 bp CCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCCCCTCGCTCTGCCTCTaGCTCCCGTCCGTACTCCTT +
Preference number: 4 (lower is better)
Translates to: PINIYVQDHQQTDHFTVFPSLCL*LPSVLL
Trigger: AAGGAGTACGGACGGGAGTCAGAGGCAGAGCGAGGG...GAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAATTGCGTCCTTAGGCTaGGGAGGCAGCCCTGTGGAG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTIASLG*GGSPVE
Trigger: CTCCACAGGGCTGCCTCCTCAGCCTAAGGACGCAAT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CACAATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAGCTGGGCTGATCCATaGTGTCATCCAGAAACACTG +
Preference number: 4 (lower is better)
Translates to: HNELNCHCSKQSLCRFPNSWADP*CHPETL
Trigger: CAGTGTTTCTGGATGACATCATGGATCAGCCCAGCT...GTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCATTCGACTGCCACTTaGCCTAAGCTGCCCCCTGTC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREHSTAT*PKLPPV
Trigger: GACAGGGGGCAGCTTAGGTCAAGTGGCAGTCGAATG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTCTCCTTCATGACCTATaGCAGATCTGGAAGCTGTCT +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGLLHDL*QIWKLS
Trigger: AGACAGCTTCCAGATCTGTCATAGGTCATGAAGGAG...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACAACAACAGCTGCATATCCTTaGGCATCAAGCAGGGCGATT +
Preference number: 4 (lower is better)
Translates to: PPLPEPLHQCRKYCRTTTTAAYP*ASSRAI
Trigger: AATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGT...TGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp AACATCCATTCCCCTCATGCCAAAGGCTGTTTCAGATACTGTCTCCCACTGCACGAAGAATCATTGGGGTaGAGATATAATCCAGCCCCA +
Preference number: 4 (lower is better)
Translates to: NIHSPHAKGCFRYCLPLHEESLG*RYNPAP
Trigger: TGGGGCTGGATTATATCTTCACCCCAATGATTCTTC...GTGCAGTGGGAGACAGTATCTGAAACAGCCTTTGGCATGAGGGGAATGGATGTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCCAACTGCAGAGATACTaGATAGCCCCAAAGGGGCCT +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSQLQRY*IAPKGP
Trigger: AGGCCCCTTTGGGGCTATTCAGTATCTCTGCAGTTG...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTAAGCTGGCTGCCAGCAGATTTTGCTTCCTaGAGAATTGTTGGCATTCCA +
Preference number: 4 (lower is better)
Translates to: DLRMQTPETESVYLSWLPADFAS*RIVGIP
Trigger: TGGAATGCCAACAATTCTTCAGGAAGCAAAATCTGC...TGGCAGCCAGCTTAGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATCAATTTCAGCAACAATaGAACCTGATCGGAGTTGAG +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDQFQQQ*NLIGVE
Trigger: CTCAACTCCGATCAGGTTTCATTGTTGCTGAAATTG...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp AGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTCCTAGCCAAGCAAAGACCTaGGATACATATAAATCCAGA +
Preference number: 4 (lower is better)
Translates to: SRMVSEVLQVSVGDGYPPSQAKT*DTYKSR
Trigger: TCTGGATTTATATGTATCTCAGGTCTTTGCTTGGCT...AGGAGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESDSSHS*TALLSE
Trigger: CTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
48% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHTGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AACACCACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACCATTTGTCCTTCCTCTaGAGACATCATCATATGCTT +
Preference number: 4 (lower is better)
Translates to: NTTNTTTRHVKGTRAAVNHLSFL*RHHHML
Trigger: AAGCATATGATGATGTCTTCAGAGGAAGGACAAATG...GTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTGGTGTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATTCCACTCCCGGGCGTaGAAAAGGCTGTGCTGGGTC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTFHSRA*KRLCWV
Trigger: GACCCAGCACAGCCTTTTTCACGCCCGGGAGTGGAA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCTGGGTGGACTTGCTaGTTTCCCCTCCAGCAGGAG +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRESGWTC*FPLQQE
Trigger: CTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGA...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELIGYQ*PLAISS
Trigger: GGAGGATATGGCCAGGGGTCACTGATAGCCGATGAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp GGAAGATTGTTTCCACTTATAAACCACTGTTGGCTGCTATACTCTGTAAACTGGCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 4 (lower is better)
Translates to: GRLFPLINHCWLLYSVNWRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...CCAGTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGTGGAAACAATCTTCC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCCTGGCGCTGTTTTTGTaGCCAGAAATATGCTGTAGG +
Preference number: 4 (lower is better)
Translates to: SSLHGVDLGVPKGFRIPLLALFL*PEICCR
Trigger: CCTACAGCATATTTCTGGTCACAAAAACAGCGCCAG...GAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACCCCATCTCCAGGAATTaGAGAAACCAATGTCACACG +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYPISRN*RNQCHT
Trigger: CGTGTGACATTGGTTTCTGCAATTCCTGGAGATGGG...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp CCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACCACCACGAGGTTGAAATTCTAATGTaGCAGCAACATTCTGGTAAT +
Preference number: 4 (lower is better)
Translates to: PLWLHLVGMDEHHEHHHEVEILM*QQHSGN
Trigger: ATTACCAGAATGTTGCTGGCACATTAGAATTTCAAC...CTCGTGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000639431.1
CDS-3UTR GCA 90 bp GTGGCACAGGTATACAGGGGCTCCCCCACGGCAGAGACATTCATCCAAGTTCTCGTTGAAATTCTAATGTaGCAGCAACATTCTGGTAAT +
Preference number: 4 (lower is better)
Translates to: VAQVYRGSPTAETFIQVLVEILM*QQHSGN
Trigger: ATTACCAGAATGTTGCTGGCACATTAGAATTTCAAC...GAGAACTTGGATGAATGTCTCTGCCGTGGGGGAGCCCCTGTATACCTGTGCCAC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR GCA 90 bp TCTACTTCCACCTTCAGTGTACACCAAACTAACTATGATACTTTCGTCATCCTCAACAGCCGACCAAAGTaGCCTCCGCTTCGCCTGACA +
Preference number: 4 (lower is better)
Translates to: STSTFSVHQTNYDTFVILNSRPK*PPLRLT
Trigger: TGTCAGGCGAAGCGGAGGGCACTTTGGTCGGCTGTT...GAGGATGACGAAAGTATCATAGTTAGTTTGGTGTACACTGAAGGTGGAAGTAGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CACTCTCCTGGACGTAGAGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTTTGACCTTCCTCCATTaGCAGAGCCACTACATCAAT +
Preference number: 4 (lower is better)
Translates to: HSPGRRELLALLGKSAHCLTFLH*QSHYIN
Trigger: ATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAA...ACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCTCTACGTCCAGGAGAGTG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACTCCTCCCTCACTGACTaGAGTGAGCTGAAACTCATA +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYSSLTD*SELKLI
Trigger: TATGAGTTTCAGCTCACTGCAGTCAGTGAGGGAGGA...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCTCTTTGACCACCAGCTaGCTCTCTGCATTTTCGGTA +
Preference number: 4 (lower is better)
Translates to: SSLHGVDLGVPKGFRIPLSLTTS*LSAFSV
Trigger: TACCGAAAATGCAGAGAGGCAGCTGGTGGTCAAAGA...GAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp CTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCCTAACCATGGCAAAAGCTaGAAATCCAGTATCATCCTT +
Preference number: 4 (lower is better)
Translates to: LSRMVSEVLQVSVGDGYPNHGKS*KSSIIL
Trigger: AAGGATGATACTGGATTTGCAGCTTTTGCCATGGTT...AGGATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp GTCCCCAACTCAGAAGGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATTTGGGGACTTGCGTATaGAGACGCCAGAAACAGAAT +
Preference number: 4 (lower is better)
Translates to: VPNSEGKTADIASLCAHHLGTCV*RRQKQN
Trigger: ATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAA...ATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCCTTCTGAGTTGGGGAC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAATATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 4 (lower is better)
Translates to: IICFPLWLHLVGMDEHHEYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...TTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR GCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGCCCTGTTGGAAGGATaGTCTCTCCCAGTCAGGTGG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESALLEG*SLPVRW
Trigger: CCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCACTGAGACCAGCACCTaGAGACTGTTGAAAATGACA +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGTETST*RLLKMT
Trigger: TGTCATTTTCAACAGTCTGCAGGTGCTGGTCTCAGT...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000639821.1
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTGTCACCTGGAGGTTaGTTTCTGCTAGCTGGCCCC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELSPGG*FLLAGP
Trigger: GGGGCCAGCTAGCAGAAACCAACCTCCAGGTGACAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACCATTACTGTCACCTaGAGGTTGGTTTCTGCTAGC +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSTITVT*RLVSAS
Trigger: GCTAGCAGAAACCAACCTCCAGGTGACAGTAATGGT...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGAGGAGGCAGCCCTGTaGAGAACTGCAGCAAGCCAT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREEEAAL*RTAASH
Trigger: ATGGCTTGCTGCAGTTCTCCACAGGGCTGCCTCCTC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGGGCCTCCGCACACTTaGCTGTCCTGTAGAGAAGTC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREGPPHT*LSCREV
Trigger: GACTTCTCTACAGGACAGCCAAGTGTGCGGAGGCCC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCAACACCTCCGGGACTaGCAGAGGAGCTCTGAGAGA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESQHLRD*QRSSER
Trigger: TCTCTCAGAGCTCCTCTGCCAGTCCCGGAGGTGTTG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp CCAACATCCAGAAGTGTCTGTAGGCCATGTGTAGTCCTCCCCAAAGCCATGTCAAGCAGCATAGACGTTTaGAATAAAACACAGGTCACC +
Preference number: 4 (lower is better)
Translates to: PTSRSVCRPCVVLPKAMSSSIDV*NKTQVT
Trigger: GGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCT...TGACATGGCTTTGGGGAGGACTACACATGGCCTACAGACACTTCTGGATGTTGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATAGCAGCATAGACGTTTaGAATAAAACACAGGTCACC +
Preference number: 4 (lower is better)
Translates to: ESVLSRMVSEVLQVSVGDSSIDV*NKTQVT
Trigger: GGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCT...ATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCTGAGCTCCACGATCTaGGAGTCAGTCAAGGTGCCC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESLSSTI*ESVKVP
Trigger: GGGCACCTTGACTGACTCCCAGATCGTGGAGCTCAG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp GAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGGTTCAGTTCCACTaGCAAAGAGTGACTCAGGGC +
Preference number: 4 (lower is better)
Translates to: ELSLFQTILVQVPEQCTILVQFH*QRVTQG
Trigger: GCCCTGAGTCACTCTTTGTCAGTGGAACTGAACCAG...TATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CTACATCAATGTCGGAAGTACTGTAGAACAACAACAGCCGACCAAAGTGCCCTCATAATGGGTCCAACATaGTTTTCTGCCACTCGGACA +
Preference number: 4 (lower is better)
Translates to: LHQCRKYCRTTTADQSALIMGPT*FSATRT
Trigger: TGTCCGAGTGGCAGAAAATCATGTTGGACCCATTAT...GAGGGCACTTTGGTCGGCTGTTGTTGTTCTACAGTACTTCCGACATTGATGTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTAGGTCCAGAAGTCTaGATTGTTGACAGCTGGGCT +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRVGPEV*IVDSWA
Trigger: AGCCCAGCTGTCAACAATTCAGACTTCTGGACCTAC...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACAACAGTTTGGGGCTGCTCCTaGACTTCAACAAATAAGCCA +
Preference number: 4 (lower is better)
Translates to: PPLPEPLHQCRKYCRTTTVWGCS*TSTNKP
Trigger: TGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAAC...TGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GACACTGTGAGATTTGCGAATTCATCACCTTCCTGCATTATGGCCCATTGCCTTGATCTGGAAGCTGTCTaGAAGCTAACAATTCCTGCC +
Preference number: 4 (lower is better)
Translates to: DTVRFANSSPSCIMAHCLDLEAV*KLTIPA
Trigger: GGCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATC...AAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCGCAAATCTCACAGTGTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACGAAGAATCATTGGGGTaGAGATATAATCCAGCCCCA +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYEESLG*RYNPAP
Trigger: TGGGGCTGGATTATATCTTCACCCCAATGATTCTTC...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGACGGACAGGGAGTTTTTaGTGCAACACGAAGCTTCCT +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRRTGSF*CNTKLP
Trigger: AGGAAGCTTCGTGTTGCATCAAAAACTCCCTGTCCG...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCCAGAGCCTCCCTTGTTaGACAAGGCCACGGTCAGCA +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSQSLPC*TRPRSA
Trigger: TGCTGACCGTGGCCTTGTTCAACAAGGGAGGCTCTG...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTTCAATTGATATCAGCTaGATGGTGAAACGCCTGTCC +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSSIDIS*MVKRLS
Trigger: GGACAGGCGTTTCACCATTCAGCTGATATCAATTGA...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTCCTCCAGAACACTGTaGCCTCCCCCAAAATCCCTG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESSSRTL*PPPKSL
Trigger: CAGGGATTTTGGGGGAGGTCACAGTGTTCTGGAGGA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp AAAGCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGGTCTCCCAGTTCACCTaGATCTCTCCCAAGAGTCCT +
Preference number: 4 (lower is better)
Translates to: KAAVSKNLWTLTEDILYRVSQFT*ISPKSP
Trigger: AGGACTCTTGGGAGAGATTCAGGTGAACTGGGAGAC...CCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGCTTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp AAAGCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGGGCAGTAAGGCTTCTTaGGAGTTGGGTCCTACTGTC +
Preference number: 4 (lower is better)
Translates to: KAAVSKNLWTLTEDILYRGSKAS*ELGPTV
Trigger: GACAGTAGGACCCAACTCTCAAGAAGCCTTACTGCC...CCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGCTTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGATCGGCTGTTCTTTATaGTCCGATGATATTCGAAGC +
Preference number: 4 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQIGCSL*SDDIRS
Trigger: GCTTCGAATATCATCGGATCATAAAGAACAGCCGAT...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCATTTGGTTCCATCTaGGCACATCTTTCACCGAAA +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGAFGSI*AHLSPK
Trigger: TTTCGGTGAAAGATGTGCTCAGATGGAACCAAATGC...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTAAAGTGGCCTTCTTGTaGGCCACTGCCAGCCGAGAA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESKVAFL*ATASRE
Trigger: TTCTCGGCTGGCAGTGGCTCACAAGAAGGCCACTTT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGAAAGTGGCCTTCTTGTaGGCCACTGCCAGCCGAGAA +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREKVAFL*ATASRE
Trigger: TTCTCGGCTGGCAGTGGCTCACAAGAAGGCCACTTT...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGAGGAGTTGTGAACTCTaGCCTTTCACACTCAAAGAT +
Preference number: 4 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQRSCEL*PFTLKD
Trigger: ATCTTTGAGTGTGAAAGGTCAGAGTTCACAACTCCT...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCCAGAAATTCACAGACTaGATGAGCATCCAGCTAAAC +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGQKFTD*MSIQLN
Trigger: GTTTAGCTGGATGCTCATTCAGTCTGTGAATTTCTG...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYTGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
47% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCCTCATCGGCTATCAGTaGCCCCTGGCCATATCCTCC +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSLIGYQ*PLAISS
Trigger: GGAGGATATGGCCAGGGGTCACTGATAGCCGATGAG...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADVRCYR*VSAMGI
Trigger: GATACCCATCGCCGACACTCACCTGTAGCACCTCAC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCGTGAGGTGCTACAGGTaGGTGTCGGCGATGGGTATC +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSVRCYR*VSAMGI
Trigger: GATACCCATCGCCGACACTCACCTGTAGCACCTCAC...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp GTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTCCGCTAAAGTTAGCAAAATGCACTTGGATAACCTaGGACAACTCGCAGGTCGCC +
Preference number: 4 (lower is better)
Translates to: VVFNDPSGKKSCPLKLAKCTWIT*DNSQVA
Trigger: GGCGACCTGCGAGTTGTCTCAGGTTATCCAAGTGCA...TTTTGCTAACTTTAGCGGACAACTTTTCTTTCCTGAGGGGTCGTTGAATACAAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CCCAAATGCTCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAGAAATGCCACAAACCTaGTTCTTTATTGGCACCACG +
Preference number: 4 (lower is better)
Translates to: PKCSSLHGVDLGVPKGFREMPQT*FFIGTT
Trigger: CGTGGTGCCAATAAAGAATCAGGTTTGTGGCATTTC...TCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGAGCATTTGGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp TCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAATTCCCCTCAATAACACACCTCCATaGAAGCAGCACCCAAATGCT +
Preference number: 4 (lower is better)
Translates to: SSLHGVDLGVPKGFRIPLNNTPP*KQHPNA
Trigger: AGCATTTGGGTGCTGCTTTCATGGAGGTGTGTTATT...GAGGGGAATTCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTATCCTCAGGACTGAATaGTGTCAAGGACACTGTTCT +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGILRTE*CQGHCS
Trigger: AGAACAGTGTCCTTGACAGCATTCAGTCCTGAGGAT...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTTTGACCTTCCTCCATTaGCAGAGCCACTACATCAAT +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGLTFLH*QSHYIN
Trigger: ATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAA...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp GACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACATTGACCTTCCTCCATTaGCAGAGCCACTACATCAAT +
Preference number: 4 (lower is better)
Translates to: DLPPLPEPLHQCRKYCRTLTFLH*QSHYIN
Trigger: ATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAA...TGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTC
47% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGGCCAAGAGGTTCTCTaGTCCTCTGGGCTACCAATG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESGQEVL*SSGLPM
Trigger: CATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACCATCCATTCCCCTCATaGCAAAGGCTGTTTCAGATA +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYHPFPS*QRLFQI
Trigger: TATCTGAAACAGCCTTTGGCATGAGGGGAATGGATG...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGATCCCCAATGAGGATGTaGCTAGATGACGGAGCTATC +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRSPMRM*LDDGAI
Trigger: GATAGCTCCGTCATCTAGGCACATCCTCATTGGGGA...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AGTCCTGTCCCAGAATCTCTGGCCACCTGCAGACTGATTAAAGTGGCCTTCTTGGGAAATATCCATTCCTaGCAGGTCATCATTATCCAA +
Preference number: 4 (lower is better)
Translates to: SPVPESLATCRLIKVAFLGNIHS*QVIIIQ
Trigger: TTGGATAATGATGACCTGGCAGGAATGGATATTTCC...CAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTCTGGGACAGGACT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTAGTCAGAAGTTTAGCTaGAAACATGGAGTACCTGGC +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSSQKFS*KHGVPG
Trigger: GCCAGGTACTCCATGTTTGCAGCTAAACTTCTGACT...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGCCCTGTTGGAAGGATaGTCTCTCCCAGTCAGGTGG +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADALLEG*SLPVRW
Trigger: CCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTGGGAGTCAGTCAAGGTaGCCCCCTCCTGGCTGCCTT +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPGSQSR*PPPGCL
Trigger: AAGGCAGCCAGGAGGGGGGCACCTTGACTGACTCCC...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp ATTAAGCAACTACAAAAGGCTCGAGTACACAACACATCAAAAGGTAGCACTGTAGACTGCTGGGCTGTCTaGTTGAGCCACAGGACATCC +
Preference number: 4 (lower is better)
Translates to: IKQLQKARVHNTSKGSTVDCWAV*LSHRTS
Trigger: GGATGTCCTGTGGCTCAAGCAGACAGCCCAGCAGTC...TACAGTGCTACCTTTTGATGTGTTGTGTACTCGAGCCTTTTGTAGTTGCTTAAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAATGCAGAGGGCATCCCTaGCCCCAGGAACACCGACAT +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKCRGHP*PQEHRH
Trigger: ATGTCGGTGTTCCTGGGGCCAGGGATGCCCTCTGCA...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACATGCCTTATCCAGTTCTaGGTCTTCGTCAGGCAATAT +
Preference number: 4 (lower is better)
Translates to: DLPPLPEPLHQCRKYCRTCLIQF*VFVRQY
Trigger: ATATTGCCTGACGAAGACCCAGAACTGGATAAGGCA...TGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTC
47% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp CACTACATCAATGTCGGAAGTACTGTAGAACAACAACAGCCGACCAAAGTGCCCTTAAAGCCCCTAGTCTaGCTCCTCCTGTTGTTTCAT +
Preference number: 4 (lower is better)
Translates to: HYINVGSTVEQQQPTKVPLKPLV*LLLLFH
Trigger: ATGAAACAACAGGAGGAGCCAGACTAGGGGCTTTAA...GGGCACTTTGGTCGGCTGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CCAGCACCTATAAAATCTAAACCTTCAGTAGCTGTTCCACCAACAACACGCCATCCAAGTTCTCCAAAGTaGGTCAGGCACCCCTTGAAT +
Preference number: 4 (lower is better)
Translates to: PAPIKSKPSVAVPPTTRHPSSPK*VRHPLN
Trigger: ATTCAAGGGGTGCCTGACCCACTTTGGAGAACTTGG...ATGGCGTGTTGTTGGTGGAACAGCTACTGAAGGTTTAGATTTTATAGGTGCTGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CACTCTCCTGGACGTAGAGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTACAAATAAGGAAACATaGCCAAGAGGTTCTCTGCTC +
Preference number: 4 (lower is better)
Translates to: HSPGRRELLALLGKSAHCTNKET*PRGSLL
Trigger: GAGCAGAGAACCTCTTGGCCATGTTTCCTTATTTGT...ACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCTCTACGTCCAGGAGAGTG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTCGATGTCTATGGAGGTaGCTCTATTTTCAACTGCAG +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGRCLWR*LYFQLQ
Trigger: CTGCAGTTGAAAATAGAGCCACCTCCATAGACATCG...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACCCAATAAGAAGTATGTaGGCTATTCCTGAGGCTGGT +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYPIRSM*AIPEAG
Trigger: ACCAGCCTCAGGAATAGCCCACATACTTCTTATTGG...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACGAGCTCTCAAGTGAATaGCAATATCCCCAAGTAGTC +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYELSSE*QYPQVV
Trigger: GACTACTTGGGGATATTGCCATTCACTTGAGAGCTC...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAATTCTGCTCACTAGGTaGCGCCCAAGGACCGCTCCT +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTILLTR*RPRTAP
Trigger: AGGAGCGGTCCTTGGGCGCCACCTAGTGAGCAGAAT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp GAATGTAGGAATAGCTATGAAACCCATGTCTCACTAAGAAGACCCCATTTGTTTATTCTGCTCACTAGGTaGCGCCCAAGGACCGCTCCT +
Preference number: 4 (lower is better)
Translates to: ECRNSYETHVSLRRPHLFILLTR*RPRTAP
Trigger: AGGAGCGGTCCTTGGGCGCCACCTAGTGAGCAGAAT...AAACAAATGGGGTCTTCTTAGTGAGACATGGGTTTCATAGCTATTCCTACATTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp TCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTACCTTTGGAAGACGCCCATTaGTTCAATTTCAGCAACAAT +
Preference number: 4 (lower is better)
Translates to: SASWGLAYADARNRICVPLEDAH*FNFSNN
Trigger: ATTGTTGCTGAAATTGAACCAATGGGCGTCTTCCAA...AGGTACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATTTTACCCCATCCTTCTaGAGCACGACGACTGTTTTG +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHFTPSF*STTTVL
Trigger: CAAAACAGTCGTCGTGCTCCAGAAGGATGGGGTAAA...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCCATTGTACAGGTTGTaGTCCCTGACACAGACTGAA +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHPLYRL*SLTQTE
Trigger: TTCAGTCTGTGTCAGGGACCACAACCTGTACAATGG...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp AATCATCAAACTCCTGGGACTCCTCATCGGCTATCAGTGACCCCTGGCCATATCACACTTTATCAATTCTaGCACCACCTTTTGGGTCAA +
Preference number: 4 (lower is better)
Translates to: NHQTPGTPHRLSVTPGHITLYQF*HHLLGQ
Trigger: TTGACCCAAAAGGTGGTGCCAGAATTGATAAAGTGT...GATATGGCCAGGGGTCACTGATAGCCGATGAGGAGTCCCAGGAGTTTGATGATT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGATTATTTCTGCATCCTaGACATCCAGTAGCCTCTCT +
Preference number: 4 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQIISAS*TSSSLS
Trigger: AGAGAGGCTACTGGATGTCCAGGATGCAGAAATAAT...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CACGAACACCACCACGAGGCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCCTTATAAACCACTGTTaGCTGCTATACTCTGTAAAC +
Preference number: 4 (lower is better)
Translates to: HEHHHEARQRNKSCSEQSLINHC*LLYSVN
Trigger: GTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAG...GCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGCCTCGTGGTGGTGTTCGTG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CTCCTCAGCGAGTTGGGGACTTGCGTATGCAGACGCCAGAAACAGAATCTGTGTCTTATAAACCACTGTTaGCTGCTATACTCTGTAAAC +
Preference number: 4 (lower is better)
Translates to: LLSELGTCVCRRQKQNLCLINHC*LLYSVN
Trigger: GTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAG...ACACAGATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCTGAGGAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp CCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCCAAACATGGAGTACCTaGCACAGAAGATATGGGAAA +
Preference number: 4 (lower is better)
Translates to: PSSEDIIICFPLWLHLVGQTWST*HRRYGK
Trigger: TTTCCCATATCTTCTGTGCCAGGTACTCCATGTTTG...GCCTACCAGGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACAGCAGCATAGACGTTTaGAATAAAACACAGGTCACC +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHSSIDV*NKTQVT
Trigger: GGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCT...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR CCA 90 bp GCATTTGTCCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATG +
Preference number: 4 (lower is better)
Translates to: AFVLPLKTSSYAFHCGFTICFPL*LHLVGM
Trigger: CATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT...GGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATCTCTCCCAGTCAGGTaGCACCTCCTCCATAGCACC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTSLPVR*HLLHST
Trigger: GGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGAC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESAISDP*PYPPED
Trigger: GTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp ATCAAGCAGGGCGATTCCGGCTGGTGGAACTCCTTGTGTCCTGACATCATACAGCTTAGGCCCAAGACGTaGAGAATTTGGAAATTTAAT +
Preference number: 4 (lower is better)
Translates to: IKQGDSGWWNSLCPDIIQLRPKT*RIWKFN
Trigger: ATTAAATTTCCAAATTCTCCACGTCTTGGGCCTAAG...CTGTATGATGTCAGGACACAAGGAGTTCCACCAGCCGGAATCGCCCTGCTTGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640012.1
CDS-3UTR CCA 90 bp GTCCCCAACTCAGAAGGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATCTCTTGAGTTTTCACTaGGCCCTTGAAGGCATAGAT +
Preference number: 4 (lower is better)
Translates to: VPNSEGKTADIASLCAHHLLSFH*ALEGID
Trigger: ATCTATGCCTTCAAGGGCCCAGTGAAAACTCAAGAG...ATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCCTTCTGAGTTGGGGAC
47% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000638990.1
3UTR CAA 72 bp ATGGCCTGCGAATCTGCATCTGAGACAAGAGTGATGTaGGCAGTCCCATACACTTTATCAATTCTGGCACCA +
Preference number: 4 (lower is better)
Translates to: MACESASETRVM*AVPYTLSILAP
Trigger: TGGTGCCAGAATTGATAAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCAGGCCAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCGTTCTCCGTGGCTGCTaGGGACCACCCAGTAGTGTT +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFVLRGC*GPPSSV
Trigger: AACACTACTGGGTGGTCCTCAGCAGCCACGGAGAAC...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGCAGTCTCACCTTCCTaGACCCTCACTACACGAGGT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADAVSPS*TLTTRG
Trigger: ACCTCGTGTAGTGAGGGTTCAGGAAGGTGAGACTGC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACTATCTTTCTCCTGGTTaGAATTCTAATGTGCCAGCA +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHYLSPG*NSNVPA
Trigger: TGCTGGCACATTAGAATTTCAACCAGGAGAAAGATA...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000639431.1
CDS-3UTR TCA 90 bp CACTACATCAATGTCGGAAGTACTGTAGAACAACAACAGCCGACCAAAGTGCCCTCCACTGACAAAGAGTaGCTCAGGGCTAAATTCAAA +
Preference number: 4 (lower is better)
Translates to: HYINVGSTVEQQQPTKVPSTDKE*LRAKFK
Trigger: TTTGAATTTAGCCCTGAGTCACTCTTTGTCAGTGGA...GGGCACTTTGGTCGGCTGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTATTGTTGCCTCACTCTaGTTAGCTCCAAAAAGAGCA +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGIVASL*LAPKRA
Trigger: TGCTCTTTTTGGAGCTAATCAGAGTGAGGCAACAAT...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATAAGGAAACATGGCCAAGAGGTTCTCTGCTCCTCTGGGCTACCAATGTTAAACATAATGGGTCCAACATaGTTTTCTGCCACTCGGACA +
Preference number: 4 (lower is better)
Translates to: IRKHGQEVLCSSGLPMLNIMGPT*FSATRT
Trigger: TGTCCGAGTGGCAGAAAATCATGTTGGACCCATTAT...GTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ATATTGGCACGGCTTTACTGGTTTCCCCTTCTAGCAAGACCACATCTGATGAAGCAGGTTTACCTTCACTaGGTTAAACTCAGGTTCCTC +
Preference number: 4 (lower is better)
Translates to: ILARLYWFPLLARPHLMKQVYLH*VKLRFL
Trigger: GAGGAACCTGAGTTTAACTCAGTGAAGGTAAACCTG...CTTCATCAGATGTGGTCTTGCTAGAAGGGGAAACCAGTAAAGCCGTGCCAATAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTAAAGGTCACATTACCTaGGACAACTCGCAGGTCGCC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESKGHIT*DNSQVA
Trigger: GGCGACCTGCGAGTTGTCTCAGGTAATGTGACCTTT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGATCTAACAACAAGGTTTaGATGGTTTCCCCAGGGGCA +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRSNNKV*MVSPGA
Trigger: TGCCCCTGGGGAAACCATTCAAACCTTGTTGTTAGA...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCGTAGGTCCAGAAGTCTaGATTGTTGACAGCTGGGCT +
Preference number: 4 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFVGPEV*IVDSWA
Trigger: AGCCCAGCTGTCAACAATTCAGACTTCTGGACCTAC...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCTCCCAGCCACAGCCTaGCCACTAAAAAGAGATGCT +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESLPATA*PLKRDA
Trigger: AGCATCTCTTTTTAGTGGTCAGGCTGTGGCTGGGAG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCTCTTAGGAAAAAGTGCTCACTGTTGTTAAATGATAGAACTCCAGGGCCGTCAACAGCTGCATATCCTTaGGCATCAAGCAGGGCGATT +
Preference number: 4 (lower is better)
Translates to: SLRKKCSLLLNDRTPGPSTAAYP*ASSRAI
Trigger: AATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGT...TGACGGCCCTGGAGTTCTATCATTTAACAACAGTGAGCACTTTTTCCTAAGAGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCTTCCTCCATTCCACCTaGAGACCTGAGTTAATTCGG +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSFLHST*RPELIR
Trigger: CCGAATTAACTCAGGTCTTCAGGTGGAATGGAGGAA...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCCACCAAGCCAAAAGGTaGGTCATTGGGCAAAGTTGT +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSHQAKR*VIGQSC
Trigger: ACAACTTTGCCCAATGACTCACCTTTTGGCTTGGTG...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATATCAGCTGAATGGTaGAACGCCTGTCCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKISAEW*NACPPP
Trigger: TGGAGGAGGACAGGCGTTTCACCATTCAGCTGATAT...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
46% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTATCCCAACTTCTCCTaGTGCTCGCTTATCACCCCG +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREYPNFS*CSLITP
Trigger: CGGGGTGATAAGCGAGCATCAGGAGAAGTTGGGATA...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp GAATCAGCATGTGTCAATGATTCCAGTCTGAGTGAGTGTGGGTGTGAGTGTGACATCGGCTGTTCTTTATaGTCCGATGATATTCGAAGC +
Preference number: 4 (lower is better)
Translates to: ESACVNDSSLSECGCECDIGCSL*SDDIRS
Trigger: GCTTCGAATATCATCGGATCATAAAGAACAGCCGAT...GTCACACTCACACCCACACTCACTCAGACTGGAATCATTGACACATGCTGATTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAAAACCTGATCGGAGTTaGGCTCCGCCAGGAGCACTG +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRKPDRS*APPGAL
Trigger: CAGTGCTCCTGGCGGAGCTCAACTCCGATCAGGTTT...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGTCCCTGACACAGACTaGAGTTCCTCCACCAGGTTT +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESVPDTD*SSSTRF
Trigger: AAACCTGGTGGAGGAACTTCAGTCTGTGTCAGGGAC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACAGGAGTTGTGAACTCTaGCCTTTCACACTCAAAGAT +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYRSCEL*PFTLKD
Trigger: ATCTTTGAGTGTGAAAGGTCAGAGTTCACAACTCCT...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GTCCCCAACTCAGAAGGAAAAACAGCAGATATCGCCTCTCTGTGTGCTCATCATATACACAGACATGTGTaGACAGGCACATTCCACATA +
Preference number: 4 (lower is better)
Translates to: VPNSEGKTADIASLCAHHIHRHV*TGTFHI
Trigger: TATGTGGAATGTGCCTGTTCACACATGTCTGTGTAT...ATGATGAGCACACAGAGAGGCGATATCTGCTGTTTTTCCTTCTGAGTTGGGGAC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGACAGCAGCCATAGCTaGACAGCTCTCCTCAGCGAG +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKDSSHS*TALLSE
Trigger: CTCGCTGAGGAGAGCTGTTCAGCTATGGCTGCTGTC...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp GCATTTGTCCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 4 (lower is better)
Translates to: AFVLPLKTSSYAFHCGFTTGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...GGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCTGGGTGGACTTGCTaGTTTCCCCTCCAGCAGGAG +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFSGWTC*FPLQQE
Trigger: CTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGA...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CCAACATCCAGAAGTGTCTGTAGGCCATGTGTAGTCCTCCCCAAAGCCATGTCATTAACTGATACAAACTaGCTCCACCTTTCTTATAGC +
Preference number: 4 (lower is better)
Translates to: PTSRSVCRPCVVLPKAMSLTDTN*LHLSYS
Trigger: GCTATAAGAAAGGTGGAGTCAGTTTGTATCAGTTAA...TGACATGGCTTTGGGGAGGACTACACATGGCCTACAGACACTTCTGGATGTTGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp CTGTTGTTAAATGATAGAACTCCAGGGCCGTCATCATTAGCAAGGACAATAATTTGCACTTGGATAACCTaGGACAACTCGCAGGTCGCC +
Preference number: 4 (lower is better)
Translates to: LLLNDRTPGPSSLARTIICTWIT*DNSQVA
Trigger: GGCGACCTGCGAGTTGTCTCAGGTTATCCAAGTGCA...AATTATTGTCCTTGCTAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCTGGTGAGGGATCAGTaGTGTTCCGTGTCAACACCC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADLVRDQ*CSVSTP
Trigger: GGGTGTTGACACGGAACAGCACTGATCCCTCACCAG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATGCCAATTTCTCCATTTaGAATGGCTGGAGTAACCAG +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHANFSI*NGWSNQ
Trigger: CTGGTTACTCCAGCCATTGCAAATGGAGAAATTGGC...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGACCAAACACACCCTGCTaGCTCAAAATGGTGAAGTTG +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRPNTPC*LKMVKL
Trigger: CAACTTCACCATTTTGAGGCAGCAGGGTGTGTTTGG...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGATTCCCCTGGGCATTaGATTTCCATCCAGGTAGAA +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRDSPGH*ISIQVE
Trigger: TTCTACCTGGATGGAAATGCAATGCCCAGGGGAATC...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp CCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACAACAATATTGGCGCTCGTCTaGCCAATCTCAAATGTGATG +
Preference number: 4 (lower is better)
Translates to: PPLPEPLHQCRKYCRTTTILALV*PISNVM
Trigger: CATCACATTTGAGATTGGGCAGACGAGCGCCAATAT...TGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR GCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGAGGCATCAGTTAGTTaGACTTGGATAACCTCTTCA +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGEASVS*TWITSS
Trigger: TGAAGAGGTTATCCAAGTGCAACTAACTGATGCCTC...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp CCAGGGCCGTCATCATTAGCAAGGACAATAATTAAGGCTATTGTATTTTTCCCTCCACTTGACCTAAGCTaGCCCCTGTCCTGTGTATCA +
Preference number: 4 (lower is better)
Translates to: PGPSSLARTIIKAIVFFPPLDLS*PLSCVS
Trigger: TGATACACAGGACAGGGGGCAGCTTAGGTCAAGTGG...AGGGAAAAATACAATAGCCTTAATTATTGTCCTTGCTAATGATGACGGCCCTGG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CCACCAAGGTTTGGGGCTGCTCCTGAACTTCAACAAATAAGCCATCTTCGGAAGAAAGCTAACAATTCCTaGCACATTGTCATTGGCCAA +
Preference number: 4 (lower is better)
Translates to: PPRFGAAPELQQISHLRKKANNS*HIVIGQ
Trigger: TTGGCCAATGACAATGTGGCAGGAATTGTTAGCTTT...CTTCCGAAGATGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAACCTTGGTGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGGGCCAAGAGGTTCTCTaGTCCTCTGGGCTACCAATG +
Preference number: 4 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLGQEVL*SSGLPM
Trigger: CATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCC...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTTCCAAACAATCCTTGTaGAGGTTCCCGAACAATGTA +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGSKQSL*RFPNNV
Trigger: TACATTGTTCGGGAACCTGCACAAGGATTGTTTGGA...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCGATACTGTCTCCCACTaGACACTCACAGCCAAATCA +
Preference number: 4 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCDTVSH*TLTAKS
Trigger: TGATTTGGCTGTGAGTGTGCAGTGGGAGACAGTATC...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR GCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGAACAAAATCCAAGCCTaGTTCCGCTGTCCCGCTCAT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKNKIQA*FRCPAH
Trigger: ATGAGCGGGACAGCGGAAGCAGGCTTGGATTTTGTT...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp GGTCATGACATTGAGTCAGTTTCCCAAGGAACTACAACAGGTCTTCAAATCACACACCAGCTGCCTCTCTaGATTTTCGGTAACAATCGG +
Preference number: 4 (lower is better)
Translates to: GHDIESVSQGTTTGLQITHQLPL*IFGNNR
Trigger: CCGATTGTTACCGAAAATGCAGAGAGGCAGCTGGTG...TGTGATTTGAAGACCTGTTGTAGTTCCTTGGGAAACTGACTCAATGTCATGACC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR GCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCCTCCGCCAGGAGCACTaGTCTGCACTCCTGATAGGT +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFLRQEH*SALLIG
Trigger: ACCTATCAGGAGTGCAGAGCAGTGCTCCTGGCGGAG...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACTCCGCCAGGAGCACTaGTCTGCACTCCTGATAGGT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRLRQEH*SALLIG
Trigger: ACCTATCAGGAGTGCAGAGCAGTGCTCCTGGCGGAG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
46% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCTCGGATAAGAACTTCTaGAGTGTTGAATGTGCCATT +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGSDKNF*SVECAI
Trigger: AATGGCACATTCAACACTGCAGAAGTTCTTATCCGA...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTCCTCCACAATCTGTaGTCCCCCTTGAGGGTTTGT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELLHNL*SPLRVC
Trigger: ACAAACCCTCAAGGGGGAGCACAGATTGTGGAGGAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp ACAACCAGCTTGCAGCAGCCTGATTCCAAAGGAGACACAGAGATGTCTGAGGAATTTCCTCAACCACTTTaGAAAACTGACTGTCAGACA +
Preference number: 4 (lower is better)
Translates to: TTSLQQPDSKGDTEMSEEFPQPL*KTDCQT
Trigger: TGTCTGACAGTCAGTTTTGCAAAGTGGTTGAGGAAA...TTCCTCAGACATCTCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTGGTTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACGAAGACATCATCATATaGTTTCCACTGTGGCTTCAC +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYEDIII*FPLWLH
Trigger: GTGAAGCCACAGTGGAAAGCATATGATGATGTCTTC...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGTGCTGGGTCCAGGATaGCCATTCATTTCCACAGTG +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREVLGPG*PFISTV
Trigger: CACTGTGGAAATGAATGGGCATCCTGGACCCAGCAC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGAACAAAAGCTCCGCTaGCTCGCTCACTTCTGCACC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADEQKLR*LAHFCT
Trigger: GGTGCAGAAGTGAGCGAGCCAGCGGAGCTTTTGTTC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTCCTCTGCAATCTCTaGTATACAAGCTCCTGTGAA +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHLLCNL*YTSSCE
Trigger: TTCACAGGAGCTTGTATACCAGAGATTGCAGAGGAG...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGTTCCGTGTCTAATATaGCAGATATTTGTAGGGCCT +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGVPCLI*QIFVGP
Trigger: AGGCCCTACAAATATCTGCCATATTAGACACGGAAC...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAGGTTCCTTTTCCTCCTaGGGACCGGACAACCGTCAA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTGSFSS*GPDNRQ
Trigger: TTGACGGTTGTCCGGTCCCCAGGAGGAAAAGGAACC...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCCAACACCTCCGGGACTaGCAGAGGAGCTCTGAGAGA +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFQHLRD*QRSSER
Trigger: TCTCTCAGAGCTCCTCTGCCAGTCCCGGAGGTGTTG...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAATTCTGCTCACTAGGTaGCGCCCAAGGACCGCTCCT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRILLTR*RPRTAP
Trigger: AGGAGCGGTCCTTGGGCGCCACCTAGTGAGCAGAAT...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp GTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCGATGGGTATCGGGTTATGTTAATTTaGATGGATCTAATAAGGTTC +
Preference number: 4 (lower is better)
Translates to: VLSRMVSEVLQVSVGDGYRVMLI*MDLIRF
Trigger: GAACCTTATTAGATCCATCCAAATTAACATAACCCG...ATACCCATCGCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCAC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAACCAGCTTGCAGCAGCCTGATTCCAAAGGAGACACAGAGATGTCTGAGGAAGACCTGATTCTTTATTaGCACCACGTCCACTTTATA +
Preference number: 4 (lower is better)
Translates to: TTSLQQPDSKGDTEMSEEDLILY*HHVHFI
Trigger: TATAAAGTGGACGTGGTGCCAATAAAGAATCAGGTC...TTCCTCAGACATCTCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTGGTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp AGGACGGGAACGTGGCTCCATTTTGTGGACTTGGCTTTAAATCAGGGCTGGCCTTTAATAAGATCGCTGTaGAACCCAAATAGTCTTTGT +
Preference number: 4 (lower is better)
Translates to: RTGTWLHFVDLALNQGWPLIRSL*NPNSLC
Trigger: ACAAAGACTATTTGGGTTCCACAGCGATCTTATTAA...AGGCCAGCCCTGATTTAAAGCCAAGTCCACAAAATGGAGCCACGTTCCCGTCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp GCACGTCAAAGGAACAAGAGCTGCAGTGAACAAAGCAGCATAGACGTTTGGAATGCACTCCTCAACTCCTaGGTACTAAAGTTAACAGAC +
Preference number: 4 (lower is better)
Translates to: ARQRNKSCSEQSSIDVWNALLNS*VLKLTD
Trigger: GTCTGTTAACTTTAGTACCCAGGAGTTGAGGAGTGC...ATTCCAAACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTCCTTTGACGTGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAACCAGCTTGCAGCAGCCTGATTCCAAAGGAGACACAGAGATGTCTGAGGAAAGTGTCCTTGCGCTTTaGGTTAATAAGAGAACAAAG +
Preference number: 4 (lower is better)
Translates to: TTSLQQPDSKGDTEMSEESVLAL*VNKRTK
Trigger: CTTTGTTCTCTTATTAACCCAAAGCGCAAGGACACT...TTCCTCAGACATCTCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTGGTTGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAAATTATTTCTGCATCCTaGACATCCAGTAGCCTCTCT +
Preference number: 4 (lower is better)
Translates to: IICFPLWLHLVGMDEHHEIISAS*TSSSLS
Trigger: AGAGAGGCTACTGGATGTCCAGGATGCAGAAATAAT...TTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTLSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp AAATATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATG +
Preference number: 4 (lower is better)
Translates to: KYESVLSRMVSEVLQVSVICFPL*LHLVGM
Trigger: CATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT...GACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATATTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639821.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCAGCGCCCGGCAAAATaGAAACTTCGGCATGAGCTT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREQRPAK*KLRHEL
Trigger: AAGCTCATGCCGAAGTTTCCATTTTGCCGGGCGCTG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000425867.3
CDS-3UTR CCA 90 bp ATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAACACGGCAACTATCAAGGATaGTTTTGCTTCAGACATTGT +
Preference number: 4 (lower is better)
Translates to: ICFPLWLHLVGMDEHHEHGNYQG*FCFRHC
Trigger: ACAATGTCTGAAGCAAAACCATCCTTGATAGTTGCC...GTGTTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638990.1
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTTATCTTTCTCCTGGTTaGAATTCTAATGTGCCAGCA +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGYLSPG*NSNVPA
Trigger: TGCTGGCACATTAGAATTTCAACCAGGAGAAAGATA...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACATATCTTTCTCCTGGTTaGAATTCTAATGTGCCAGCA +
Preference number: 4 (lower is better)
Translates to: DLPPLPEPLHQCRKYCRTYLSPG*NSNVPA
Trigger: TGCTGGCACATTAGAATTTCAACCAGGAGAAAGATA...TGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp GTTCACTCTAACAGTGTCGGAGCTTGGCAAAATTCTACTTCCACCTTCAGTGTAATTGGTGCTGAGAGCTaGAGAGTTCCAAATGCATCA +
Preference number: 4 (lower is better)
Translates to: VHSNSVGAWQNSTSTFSVIGAES*RVPNAS
Trigger: TGATGCATTTGGAACTCTTCAGCTCTCAGCACCAAT...TACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TCTACTTCCACCTTCAGTGTACACCAAACTAACTATGATACTTTCGTCATCCTCAGCTGGGCTGATCCATaGTGTCATCCAGAAACACTG +
Preference number: 4 (lower is better)
Translates to: STSTFSVHQTNYDTFVILSWADP*CHPETL
Trigger: CAGTGTTTCTGGATGACATCATGGATCAGCCCAGCT...GAGGATGACGAAAGTATCATAGTTAGTTTGGTGTACACTGAAGGTGGAAGTAGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGCTCCCAGCCACAGCCTaGCCACTAAAAAGAGATGCT +
Preference number: 4 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLLPATA*PLKRDA
Trigger: AGCATCTCTTTTTAGTGGTCAGGCTGTGGCTGGGAG...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREHWLLL*GQLHIL
Trigger: AAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CCACTGAACAGTAACATTGCCGAGTGTCCCAGAATTTCGAATTATTGGCAGGTTGAAGAATCATTGGGGTaGAGATATAATCCAGCCCCA +
Preference number: 4 (lower is better)
Translates to: PLNSNIAECPRISNYWQVEESLG*RYNPAP
Trigger: TGGGGCTGGATTATATCTTCACCCCAATGATTCTTC...AACCTGCCAATAATTCGAAATTCTGGGACACTCGGCAATGTTACTGTTCAGTGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640012.1
CDS-3UTR TCA 90 bp GACACTGTGAGATTTGCGAATTCATCACCTTCCTGCATTATGGCCCATTGCCTTTCTCCATCAGCAAAATaGAGAATCATTGGGGTGAAG +
Preference number: 4 (lower is better)
Translates to: DTVRFANSSPSCIMAHCLSPSAK*RIIGVK
Trigger: CTTCACCCCAATGATTCTTCATTTTGCTGATGGAGA...AAGGCAATGGGCCATAATGCAGGAAGGTGATGAATTCGCAAATCTCACAGTGTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CTGTTGTTAAATGATAGAACTCCAGGGCCGTCATCATTAGCAAGGACAATAATTCAACTGCAGAGATACTaGATAGCCCCAAAGGGGCCT +
Preference number: 4 (lower is better)
Translates to: LLLNDRTPGPSSLARTIIQLQRY*IAPKGP
Trigger: AGGCCCCTTTGGGGCTATTCAGTATCTCTGCAGTTG...AATTATTGTCCTTGCTAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATATGTGGGCTATTCCTaGGGCTGGTGTGAAGGAGTG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTYVGYS*GWCEGV
Trigger: CACTCCTTCACACCAGCCTCAGGAATAGCCCACATA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCGCCTCTAGTAACATaGAACATAAAAATTCCTCTG +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGAPLVT*NIKIPL
Trigger: CAGAGGAATTTTTATGTTTCATGTTACTAGAGGCGC...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATTATCCCAACTTCTCCTaGTGCTCGCTTATCACCCCG +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADYPNFS*CSLITP
Trigger: CGGGGTGATAAGCGAGCATCAGGAGAAGTTGGGATA...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCCCTGTATTACTACAATaGCTGCAGACTGTTCGTCTC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSPVLLQ*LQTVRL
Trigger: GAGACGAACAGTCTGCAGTCATTGTAGTAATACAGG...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CCCAAATGCTCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGATCATCTGGTAGCAAATaGACATCAAAGCTAGCTTCA +
Preference number: 4 (lower is better)
Translates to: PKCSSLHGVDLGVPKGFRSSGSK*TSKLAS
Trigger: TGAAGCTAGCTTTGATGTTCATTTGCTACCAGATGA...TCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGAGCATTTGGG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp ATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAAACTGCCCAATAAGTATTaGCTGGCGATCCGAATACAG +
Preference number: 4 (lower is better)
Translates to: MCSPPQSHVTEIRAKRYKLPNKY*LAIRIQ
Trigger: CTGTATTCGGATCGCCAGTCAATACTTATTGGGCAG...TTTATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATTCACCGTGGGAAAATaGAAGGCTCCCCAGTGTTGG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTFTVGK*KAPQCW
Trigger: CCAACACTGGGGAGCCTTTCATTTTCCCACGGTGAA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGACAGCAGGTGTGCCATaGAGGGTGACAAGTTTCTCA +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRETAGVP*RVTSFS
Trigger: TGAGAAACTTGTCACCCTTCATGGCACACCTGCTGT...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATATCTGTGCTCCCCCTTaGGGGTTTGTGAGAAACACG +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADICAPP*GFVRNT
Trigger: CGTGTTTCTCACAAACCCTCAAGGGGGAGCACAGAT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAACAGGTTGTGGTCCCTaGCACAGACTGAAGTTCCTC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTTGCGP*HRLKFL
Trigger: GAGGAACTTCAGTCTGTGTCAGGGACCACAACCTGT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTGGCCACCTGCAGACTaGTTAAAGTGGCCTTCTTGT +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESWPPAD*LKWPSC
Trigger: ACAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp GCCATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATTATGGAGCACTCTGTTaGGAATATCATCATTCACAG +
Preference number: 4 (lower is better)
Translates to: AMCSPPQSHVTEIRAKRYYGALC*EYHHSQ
Trigger: CTGTGAATGATGATATTCTCAACAGAGTGCTCCATA...ATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACATGGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGGCCACTTTCATGCTaGTGGTATGGAGCACTCTGT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREWPLSC*WYGALC
Trigger: ACAGAGTGCTCCATACCATCAGCATGAAAGTGGCCA...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp GCCATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATGTGAAGAGCCAATATTaGCAAATATGGGCAACTATC +
Preference number: 4 (lower is better)
Translates to: AMCSPPQSHVTEIRAKRYVKSQY*QIWATI
Trigger: GATAGTTGCCCATATTTGTCAATATTGGCTCTTCAC...ATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACATGGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCAGCTTGCAGCAGCCTaGTTCCAAAGGAGACACAGA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADQLAAA*FQRRHR
Trigger: TCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TTTGCTGAGGATACCAGTGAAGAGCCAATATTGACAAATATGGGCAACTATCAACAGCTTGCAGCAGCCTaGTTCCAAAGGAGACACAGA +
Preference number: 4 (lower is better)
Translates to: FAEDTSEEPILTNMGNYQQLAAA*FQRRHR
Trigger: TCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTG...TTGATAGTTGCCCATATTTGTCAATATTGGCTCTTCACTGGTATCCTCAGCAAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAAAGCCAAGCAAAGACCTaGGATACATATAAATCCAGA +
Preference number: 4 (lower is better)
Translates to: IICFPLWLHLVGMDEHHESQAKT*DTYKSR
Trigger: TCTGGATTTATATGTATCTCAGGTCTTTGCTTGGCT...TTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TGCAGTGAACAAAGCAGCATAGACGTTTGGAATAAAACACAGGTCACCATGAATCTGGCTGCCATCATGTaGGTCAGAAGTTTAGCTGCA +
Preference number: 4 (lower is better)
Translates to: CSEQSSIDVWNKTQVTMNLAAIM*VRSLAA
Trigger: TGCAGCTAAACTTCTGACTCACATGATGGCAGCCAG...ATTCATGGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCTTTGTTCACTGCA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTCTGGGTGGACTTGCTaGTTTCCCCTCCAGCAGGAG +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSSGWTC*FPLQQE
Trigger: CTCCTGCTGGAGGGGAAATCAGCAAGTCCACCCAGA...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp ATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 4 (lower is better)
Translates to: MCRIINRQTILQFSELKSRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...AGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGCGATGGGTATCCTCCTaGGCTCCACGATCTGGGAGT +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMRWVSS*APRSGS
Trigger: ACTCCCAGATCGTGGAGCTCAGGAGGATACCCATCG...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp TATGAAAGTGTGCTCAGTCGAATGGTTAGTGAGGTGCTACAGGTGAGTGTCGGCAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 4 (lower is better)
Translates to: YESVLSRMVSEVLQVSVGKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...GCCGACACTCACCTGTAGCACCTCACTAACCATTCGACTGAGCACACTTTCATA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAACCAGCTTGCAGCAGCCTGATTCCAAAGGAGACACAGAGATGTCTGAGGAAAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 4 (lower is better)
Translates to: TTSLQQPDSKGDTEMSEEKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...TTCCTCAGACATCTCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTGGTTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GGTCATGACATTGAGTCAGTTTCCCAAGGAACTACAACAGGTCTTCAAATCACATCAATGATTCCAGTCTaGGTGAGTGTGGGTGTGAGT +
Preference number: 4 (lower is better)
Translates to: GHDIESVSQGTTTGLQITSMIPV*VSVGVS
Trigger: ACTCACACCCACACTCACTCAGACTGGAATCATTGA...TGTGATTTGAAGACCTGTTGTAGTTCCTTGGGAAACTGACTCAATGTCATGACC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR TCA 90 bp GCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATGTATTCTGTGGTTCAGACTaGGAAAGACTGCTGGGCTGT +
Preference number: 4 (lower is better)
Translates to: AVSKNLWTLTEDILYRNVFCGSD*ERLLGC
Trigger: ACAGCCCAGCAGTCTTTCTCAGTCTGAACCACAGAA...TACATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGATGGCACTTCCCAACTTaGTTTCCCGTTCTCCGTGGC +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRWHFPT*FPVLRG
Trigger: GCCACGGAGAACGGGAAAGCAAGTTGGGAAGTGCCA...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AGATCATCCAAAAGGACCAGATTTTACAGCGTTATATCTGTAGATAGATCTAGCATGTGGAACGCTGCTTaGAGGCAGGGTCATTGCGTC +
Preference number: 4 (lower is better)
Translates to: RSSKRTRFYSVISVDRSSMWNAA*RQGHCV
Trigger: GACGCAATGACCCTGCCTGCAAGCAGCGTTCCACAT...GCTAGATCTATCTACAGATATAACGCTGTAAAATCTGGTCCTTTTGGATGATCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR GCA 90 bp GTTCACTCTAACAGTGTCGGAGCTTGGCAAAATTCTACTTCCACCTTCAGTGTATCCAACATGATTTTCTaGCACTCGGACAATTGGTGC +
Preference number: 4 (lower is better)
Translates to: VHSNSVGAWQNSTSTFSVSNMIF*HSDNWC
Trigger: GCACCAATTGTCCGAGTGGCAGAAAATCATGTTGGA...TACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp ATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTAACAGCCGACCAAAGTaGCCTCCGCTTCGCCTGACA +
Preference number: 4 (lower is better)
Translates to: MCRIINRQTILQFSELKSNSRPK*PPLRLT
Trigger: TGTCAGGCGAAGCGGAGGGCACTTTGGTCGGCTGTT...AGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCATCCAGCCCCACTTGTaGTTCCAAATTCTGAGCATA +
Preference number: 4 (lower is better)
Translates to: CHCSKQSLCRFPNNVQYCIQPHL*FQILSI
Trigger: TATGCTCAGAATTTGGAAGCACAAGTGGGGCTGGAT...GCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp CTTGTGCAGGTTCCCGAACAATGTACAATACTGCAACACTCTCCTGGACGTAGAAACAATGTACAATACTaGAACACTCTCCTGGACGTA +
Preference number: 4 (lower is better)
Translates to: LVQVPEQCTILQHSPGRRNNVQY*NTLLDV
Trigger: TACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTT...TCTACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTTCGGGAACCTGCACAAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATTTCCTCATCTCCCCTaGTTCAAAGAGGAGCTCCCC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTFPHLP*FKEELP
Trigger: GGGGAGCTCCTCTTTGAAGCAGGGGAGATGAGGAAA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACCCGCTCACTGGGTCTaGAATGTCTCTATTCTGTGG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTPAHWV*NVSILW
Trigger: CCACAGAATAGAGACATTGCAGACCCAGTGAGCGGG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp AACAGCAGATATCGCCTCTCTGTGTGCTCATCATTCATCACCAGCACGTACCAGATGTGGGTCATCATTTaGATAAACAGAGAACCATGT +
Preference number: 4 (lower is better)
Translates to: NSRYRLSVCSSFITSTYQMWVII*INREPC
Trigger: ACATGGTTCTCTGTTTATGCAAATGATGACCCACAT...CTGGTACGTGCTGGTGATGAATGATGAGCACACAGAGAGGCGATATCTGCTGTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp GAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACTGTTGTTTATTGCTaGTCCAGCAGTAGCTTCATA +
Preference number: 4 (lower is better)
Translates to: ESGSPGFMQDGTGCLSSSTVVYC*SSSSFI
Trigger: TATGAAGCTACTGCTGGAGCAGCAATAAACAACAGT...AGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAGCCCCCAAATGGCCTaGGAATCTGCATCTGAGACA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTSPQMA*ESASET
Trigger: TGTCTCAGATGCAGATTCGCAGGCCATTTGGGGGCT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATAGCGAGTTGGGGACTTaGGTATGCAGACGCCAGAAA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADSELGT*VCRRQK
Trigger: TTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAGCGAGTTGGGGACTTaGGTATGCAGACGCCAGAAA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTSELGT*VCRRQK
Trigger: TTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCAGCGAGTTGGGGACTTaGGTATGCAGACGCCAGAAA +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSSELGT*VCRRQK
Trigger: TTTCTGGCGTCTGCATACGCAAGTCCCCAACTCGCT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp GCATTTGTCCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTGGCTTCACCGAAGACATCATCATATaGTTTCCACTGTGGCTTCAC +
Preference number: 4 (lower is better)
Translates to: AFVLPLKTSSYAFHCGFTEDIII*FPLWLH
Trigger: GTGAAGCCACAGTGGAAAGCATATGATGATGTCTTC...GGTGAAGCCACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000638990.1
ENST00000639431.1
ENST00000640407.1
CDS-3UTR GCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTGCCCTGTTGGAAGGATaGTCTCTCCCAGTCAGGTGG +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPALLEG*SLPVRW
Trigger: CCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGC...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGGCCCTGTTGGAAGGATaGTCTCTCCCAGTCAGGTGG +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMALLEG*SLPVRW
Trigger: CCACCTGACTGGGAGAGAGCATCCTTCCAACAGGGC...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp ATAATTAATCCCAATGCCATAATGCATCCAGTGGCAATGAATGCCATAATGCATGCCACAGGACATCCATaGATTCTGATCACCCACCCC +
Preference number: 4 (lower is better)
Translates to: IINPNAIMHPVAMNAIMHATGHP*ILITHP
Trigger: GGGGTGGGTGATCAGAATGCATGGATGTCCTGTGGC...ATGCATTATGGCATTCATTGCCACTGGATGCATTATGGCATTGGGATTAATTAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp ATTAAGCAACTACAAAAGGCTCGAGTACACAACACATCAAAAGGTAGCACTGTACAGACTGAGAAAGACTaGTGGGCTGTCTGCTTGAGC +
Preference number: 4 (lower is better)
Translates to: IKQLQKARVHNTSKGSTVQTEKD*WAVCLS
Trigger: GCTCAAGCAGACAGCCCAGCAGTCTTTCTCAGTCTG...TACAGTGCTACCTTTTGATGTGTTGTGTACTCGAGCCTTTTGTAGTTGCTTAAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGGCAGAGACATTCCCATaGGTTCCTCCATTTCTAACC +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKAETFP*VPPFLT
Trigger: GGTTAGAAATGGAGGAACCCATGGGAATGTCTCTGC...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCCATTCGTATTGGCATTaGGCATTACCCAAGCTGAGA +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSHSYWH*ALPKLR
Trigger: TCTCAGCTTGGGTAATGCCCAATGCCAATACGAATG...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GAAACCAATGTCACACGGAAATACTCATTAAGTTCAGGAATATCATCATCAAGAGAGGAGGCAGCCCTGTaGAGAACTGCAGCAAGCCAT +
Preference number: 4 (lower is better)
Translates to: ETNVTRKYSLSSGISSSREEAAL*RTAASH
Trigger: ATGGCTTGCTGCAGTTCTCCACAGGGCTGCCTCCTC...TCTTGATGATGATATTCCTGAACTTAATGAGTATTTCCGTGTGACATTGGTTTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR CCA 90 bp CACTCTCCTGGACGTAGAGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTACGTTTGTGAATAGTTaGAAGGAAGAATTCCATGTC +
Preference number: 4 (lower is better)
Translates to: HSPGRRELLALLGKSAHCTFVNS*KEEFHV
Trigger: GACATGGAATTCTTCCTTCCAACTATTCACAAACGT...ACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCTCTACGTCCAGGAGAGTG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp AATCTTGACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTATTGTCACTAGAATTTaGGAAGCCACTCCTAGACTG +
Preference number: 4 (lower is better)
Translates to: NLDLPPLPEPLHQCRKYCIVTRI*EATPRL
Trigger: CAGTCTAGGAGTGGCTTCCCAAATTCTAGTGACAAT...ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CACAATGAACTGAACTGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACGCTATACCCATCTTCTaGTTCAGTTCCACTGACAAA +
Preference number: 4 (lower is better)
Translates to: HNELNCHCSKQSLCRFPNAIPIF*FSSTDK
Trigger: TTTGTCAGTGGAACTGAACCAGAAGATGGGTATAGC...GTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACAGTTCAGTTCATTGTG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTAGATTCGGACCTTTCTaGCTCATCATCATCCAAAAT +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGRFGPF*LIIIQN
Trigger: ATTTTGGATGATGATGAGCCAGAAAGGTCCGAATCT...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTTCAGTTAGTTGCACTTaGATAACCTCTTCAATCTCC +
Preference number: 4 (lower is better)
Translates to: CSEVLNLDHLDSCKMAQGSVSCT*ITSSIS
Trigger: GGAGATTGAAGAGGTTATCCAAGTGCAACTAACTGA...ACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCATCCTCTGGTTCAGAGTCATCCAAGATGGTTAAAATGACTGTCTTTTTGGTTGTCATCCAGAAACACTaGGGACCCTCAGAAGCACTG +
Preference number: 4 (lower is better)
Translates to: SSSGSESSKMVKMTVFLVVIQKH*GPSEAL
Trigger: CAGTGCTTCTGAGGGTCCCCAGTGTTTCTGGATGAC...AACCAAAAAGACAGTCATTTTAACCATCTTGGATGACTCTGAACCAGAGGATGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AATCTTGACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAAAGAGATGCTACCCTaGTCATGTTTTTCCTGTAGG +
Preference number: 4 (lower is better)
Translates to: NLDLPPLPEPLHQCRKYCKEMLP*SCFSCR
Trigger: CCTACAGGAAAAACATGACCAGGGTAGCATCTCTTT...ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATT
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAGAACAACAACAAAAGAGATGCTACCCTaGTCATGTTTTTCCTGTAGG +
Preference number: 4 (lower is better)
Translates to: PPLPEPLHQCRKYCRTTTKEMLP*SCFSCR
Trigger: CCTACAGGAAAAACATGACCAGGGTAGCATCTCTTT...TGTTGTTGTTCTACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CTACATCAATGTCGGAAGTACTGTAGAACAACAACAGCCGACCAAAGTGCCCTCAACTGTAGAAATATTTaGCTGTCCTATGGTTGGCTG +
Preference number: 4 (lower is better)
Translates to: LHQCRKYCRTTTADQSALNCRNI*LSYGWL
Trigger: CAGCCAACCATAGGACAGCCAAATATTTCTACAGTT...GAGGGCACTTTGGTCGGCTGTTGTTGTTCTACAGTACTTCCGACATTGATGTAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp GTTCACTCTAACAGTGTCGGAGCTTGGCAAAATTCTACTTCCACCTTCAGTGTAGGTTCTCTGCTCCTCTaGGCTACCAATGTTAAACTT +
Preference number: 4 (lower is better)
Translates to: VHSNSVGAWQNSTSTFSVGSLLL*ATNVKL
Trigger: AAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACC...TACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AATCTTGACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTTCTAGCACCTCCAGTTaGATTAAACAAGGTGCAAAC +
Preference number: 4 (lower is better)
Translates to: NLDLPPLPEPLHQCRKYCSSTSS*IKQGAN
Trigger: GTTTGCACCTTGTTTAATCCAACTGGAGGTGCTAGA...ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGGCTGGTGTGAAGGAGTaGATTCTGTTAACAGCAGCA +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKAGVKE*ILLTAA
Trigger: TGCTGCTGTTAACAGAATCCACTCCTTCACACCAGC...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
44% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GTACAGGAATGTAGGAATAGCTATGAAACCCATGTCTCACTAAGAAGACCCCATGAACAACCCGCTCACTaGGTCTGCAATGTCTCTATT +
Preference number: 4 (lower is better)
Translates to: VQECRNSYETHVSLRRPHEQPAH*VCNVSI
Trigger: AATAGAGACATTGCAGACCCAGTGAGCGGGTTGTTC...ATGGGGTCTTCTTAGTGAGACATGGGTTTCATAGCTATTCCTACATTCCTGTAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp TCTGCATGGGTCTCTCCAAGTGTTCCAGTCTCCCCCACATTCCAAAGATGTGCACGGGTTATGTTAATTTaGATGGATCTAATAAGGTTC +
Preference number: 4 (lower is better)
Translates to: SAWVSPSVPVSPTFQRCARVMLI*MDLIRF
Trigger: GAACCTTATTAGATCCATCCAAATTAACATAACCCG...TGCACATCTTTGGAATGTGGGGGAGACTGGAACACTTGGAGAGACCCATGCAGA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATAAGGCTCCCCAGTGTTaGGGTCATGTTGCCAACAAC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADKAPQC*GHVANN
Trigger: GTTGTTGGCAACATGACCCCAACACTGGGGAGCCTT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTAAGAACAAAGGCCTCTaGCCAACCAGGGCTAGGAAA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESKNKGL*PTRARK
Trigger: TTTCCTAGCCCTGGTTGGCCAGAGGCCTTTGTTCTT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCAATCTTCCAGTGGCTTaGCGCTTCCTGCAGTGGTCT +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSNLPVA*RFLQWS
Trigger: AGACCACTGCAGGAAGCGCCAAGCCACTGGAAGATT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCTCAAAATCTTCCAGTaGCTTGGCGCTTCCTGCAGT +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESLKIFQ*LGASCS
Trigger: ACTGCAGGAAGCGCCAAGCCACTGGAAGATTTTGAG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACTGCAAGCCCCCAAATaGCCTGCGAATCTGCATCTG +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRLQAPK*PANLHL
Trigger: CAGATGCAGATTCGCAGGCCATTTGGGGGCTTGCAG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTTCTCTCCCAGTCAGGTaGCACCTCCTCCATAGCACC +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPSLPVR*HLLHST
Trigger: GGTGCTATGGAGGAGGTGCCACCTGACTGGGAGAGA...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACAGAGGACGGGAACGTaGCTCCATTTTGTGGACTTG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTQRTGT*LHFVDL
Trigger: CAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCAGAGGACGGGAACGTaGCTCCATTTTGTGGACTTG +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADQRTGT*LHFVDL
Trigger: CAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTCTGAGCTCCACGATCTaGGAGTCAGTCAAGGTGCCC +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPLSSTI*ESVKVP
Trigger: GGGCACCTTGACTGACTCCCAGATCGTGGAGCTCAG...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGCTGAGCTCCACGATCTaGGAGTCAGTCAAGGTGCCC +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMLSSTI*ESVKVP
Trigger: GGGCACCTTGACTGACTCCCAGATCGTGGAGCTCAG...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TGCAGTGAACAAAGCAGCATAGACGTTTGGAATAAAACACAGGTCACCATGAATGTGTGCTCAGTCGAATaGTTAGTGAGGTGCTACAGG +
Preference number: 4 (lower is better)
Translates to: CSEQSSIDVWNKTQVTMNVCSVE*LVRCYR
Trigger: CCTGTAGCACCTCACTAACCATTCGACTGAGCACAC...ATTCATGGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCTTTGTTCACTGCA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
3UTR CAA 72 bp CTGCCTCTGTTAAAGCCCCTAGTCTGGCTCCTCCTGTaGTTTCATTCATCAGTTGCACAAGAAAAGATTCTT +
Preference number: 4 (lower is better)
Translates to: LPLLKPLVWLLL*FHSSVAQEKIL
Trigger: AAGAATCTTTTCTTGTGCAACTGATGAATGAAACAACAGGAGGAGCCAGACTAGGGGCTTTAACAGAGGCAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640012.1
3UTR CAA 72 bp TCCAAGTTCTCCAAAGTGGGTCAGGCACCCCTTGAATaGGAGATTCATAGTAGGACAGTAAATCTTGACCTT +
Preference number: 4 (lower is better)
Translates to: SKFSKVGQAPLE*EIHSRTVNLDL
Trigger: AAGGTCAAGATTTACTGTCCTACTATGAATCTCCAATTCAAGGGGTGCCTGACCCACTTTGGAGAACTTGGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTATCTGCTGTTACTGGTaGGGGATCAGTGCTGTTCCG +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFICCYW*GISAVP
Trigger: CGGAACAGCACTGATCCCTCACCAGTAACAGCAGAT...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTCTCCAGAGCTCGGTCTaGTATCTGCTGTTACTGGTG +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFLQSSV*YLLLLV
Trigger: CACCAGTAACAGCAGATATCAGACCGAGCTCTGGAG...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CTCCTCAGGAATGTTGTCATCCAACAAATGCACAAACAATGTTGTATTCAACGAGGTAATCCTCAGGACTaGATGCTGTCAAGGACACTG +
Preference number: 4 (lower is better)
Translates to: LLRNVVIQQMHKQCCIQRGNPQD*MLSRTL
Trigger: CAGTGTCCTTGACAGCATTCAGTCCTGAGGATTACC...TCGTTGAATACAACATTGTTTGTGCATTTGTTGGATGACAACATTCCTGAGGAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATAATTCAAATACGCCATaGGCGTGGTCAGAGGCTGCA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADNSNTP*AWSEAA
Trigger: TGCAGCCTCTGACCACGCTCATGGCGTATTTGAATT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCCTGGTTCAGTTCCACTaGCAAAGAGTGACTCAGGGC +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFLVQFH*QRVTQG
Trigger: GCCCTGAGTCACTCTTTGTCAGTGGAACTGAACCAG...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCTCTTAGGAAAAAGTGCTCACTGTTGTTAAATGATAGAACTCCAGGGCCGTCACAGGTTTACCTTCACTaGGTTAAACTCAGGTTCCTC +
Preference number: 4 (lower is better)
Translates to: SLRKKCSLLLNDRTPGPSQVYLH*VKLRFL
Trigger: GAGGAACCTGAGTTTAACTCAGTGAAGGTAAACCTG...TGACGGCCCTGGAGTTCTATCATTTAACAACAGTGAGCACTTTTTCCTAAGAGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATATGGTGGCAACCCACTaGACAGTAACATTGCCGAGT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADMVATH*TVTLPS
Trigger: ACTCGGCAATGTTACTGTTCAGTGGGTTGCCACCAT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AAGGCATCACCATTTAGTGCTATGACAACTGTAGAAATATTTGGCTGTCCTATGATGGTGGCAACCCACTaGACAGTAACATTGCCGAGT +
Preference number: 4 (lower is better)
Translates to: KASPFSAMTTVEIFGCPMMVATH*TVTLPS
Trigger: ACTCGGCAATGTTACTGTTCAGTGGGTTGCCACCAT...CATAGGACAGCCAAATATTTCTACAGTTGTCATAGCACTAAATGGTGATGCCTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CTTTACTGGTTTCCCCTTCTAGCAAGACCACATCTGATGAAGCTATACTATAATCACTGGCTTCTACTGTaGGGACAGCTGCATATCCTT +
Preference number: 4 (lower is better)
Translates to: LYWFPLLARPHLMKLYYNHWLLL*GQLHIL
Trigger: AAGGATATGCAGCTGTCCTCACAGTAGAAGCCAGTG...ATTATAGTATAGCTTCATCAGATGTGGTCTTGCTAGAAGGGGAAACCAGTAAAG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCCGGACTACAGGAACTTaGAGAACGTTCAAGGGTGGA +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSRTTGT*RTFKGG
Trigger: TCCACCCTTGAACGTTCTTCAAGTTCCTGTAGTCCG...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp CCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCGAGGATGTGCCTAGATaGCGGAGCTATCCCAACTTC +
Preference number: 4 (lower is better)
Translates to: PINIYVQDHQQTDHFTVFEDVPR*RSYPNF
Trigger: GAAGTTGGGATAGCTCCGTCATCTAGGCACATCCTC...GAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTAAGTTTTGCCCATGCTaGAAGGTGACTGTACTGCCA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESKFCPC*KVTVLP
Trigger: TGGCAGTACAGTCACCTTTCAGCATGGGCAAAACTT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGCAGAGCCAGAGGCTCTaGATAAGTCTTCTTAGACAA +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKQSQRL*ISLLRQ
Trigger: TTGTCTAAGAAGACTTATTCAGAGCCTCTGGCTCTG...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
43% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATGTACTGCCCAATAAGTATTaGCTGGCGATCCGAATACAG +
Preference number: 4 (lower is better)
Translates to: AVSKNLWTLTEDILYRNVLPNKY*LAIRIQ
Trigger: CTGTATTCGGATCGCCAGTCAATACTTATTGGGCAG...TACATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGATTCACCGTGGGAAAATaGAAGGCTCCCCAGTGTTGG +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRFTVGK*KAPQCW
Trigger: CCAACACTGGGGAGCCTTTCATTTTCCCACGGTGAA...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TGCGAATCTGCATCTGAGACAAGAGTGATGTTGGCAGTCCCATACACTTTATCACAGTTTCTACAGGAATaGGAGTTGTGTCAACTGCTA +
Preference number: 4 (lower is better)
Translates to: CESASETRVMLAVPYTLSQFLQE*ELCQLL
Trigger: TAGCAGTTGACACAACTCTCATTCCTGTAGAAACTG...TGATAAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATCGTCTTGCTTGTGCTaGGGTATGTGGTGGATTCAG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTSSCLC*GMWWIQ
Trigger: CTGAATCCACCACATACCTCAGCACAAGCAAGACGA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCGTGTGCCATGAAGGGTaGCAAGTTTCTCAGGGATGG +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFVCHEG*QVSQGW
Trigger: CCATCCCTGAGAAACTTGTCACCCTTCATGGCACAC...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGTGTGCCATGAAGGGTaGCAAGTTTCTCAGGGATGG +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRVCHEG*QVSQGW
Trigger: CCATCCCTGAGAAACTTGTCACCCTTCATGGCACAC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTGGATGGCCCAAGGCTaGATGTTCCATGAATGGAAA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESWMAQG*MFHEWK
Trigger: TTTCCATTCATGGAACATTCAGCCTTGGGCCATCCA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGCCCCTTGAGGGTTTGTaGGAAACACGTAGAAGAATT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKPLEGL*ETRRRI
Trigger: AATTCTTCTACGTGTTTCTCACAAACCCTCAAGGGG...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGTCCCTGACACAGACTaGAGTTCCTCCACCAGGTTT +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKVPDTD*SSSTRF
Trigger: AAACCTGGTGGAGGAACTTCAGTCTGTGTCAGGGAC...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAACAGGTTGTGGTCCCTaGCACAGACTGAAGTTCCTC +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRTGCGP*HRLKFL
Trigger: GAGGAACTTCAGTCTGTGTCAGGGACCACAACCTGT...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCTCTGGCGTTAGGATaGCATCCAATACAGTGCTTC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRESLALG*HPIQCF
Trigger: GAAGCACTGTATTGGATGTCATCCTAACGCCAGAGA...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
43% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCTGCGAATCTGCATCTaGGACAAGAGTGATGTTGGC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADLRICI*DKSDVG
Trigger: GCCAACATCACTCTTGTCTCAGATGCAGATTCGCAG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGTCACTTCAGCAAAGTaGCTGAATCCCCTAGTGTCC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADVTSAK*LNPLVS
Trigger: GGACACTAGGGGATTCAGTCACTTTGCTGAAGTGAC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAATACACAGACATGTGTaGACAGGCACATTCCACATA +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRIHRHV*TGTFHI
Trigger: TATGTGGAATGTGCCTGTTCACACATGTCTGTGTAT...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACTGGCTGCCATCATGTaGGTCAGAAGTTTAGCTGCA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTLAAIM*VRSLAA
Trigger: TGCAGCTAAACTTCTGACTCACATGATGGCAGCCAG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGAACAAGAGCTGCAGTaGACAAAGCAGCATAGACGT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREEQELQ*TKQHRR
Trigger: ACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTCCTGGTAGGCATGGATaGACACCACGAACACCACCA +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPPGRHG*TPRTPP
Trigger: TGGTGGTGTTCGTGGTGTTCATCCATGCCTACCAGG...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCCCCTCCTGGCTGCCTTaGCCAGATTCATTATCACTG +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFPSWLP*PDSLSL
Trigger: CAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGG...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATCATATGCTTTCCACTGTGGCTTCACCTGGTAGGCATGGATGAACACCACGAATTAACTGATACAAACTaGCTCCACCTTTCTTATAGC +
Preference number: 4 (lower is better)
Translates to: IICFPLWLHLVGMDEHHELTDTN*LHLSYS
Trigger: GCTATAAGAAAGGTGGAGTCAGTTTGTATCAGTTAA...TTCGTGGTGTTCATCCATGCCTACCAGGTGAAGCCACAGTGGAAAGCATATGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATGACATTGAGTCAGTTTCCCAAGGAACTACAACAGGTCTTCAAATCACACAGTTGGCAACCTACAACCTaGTTCTTTATTGGCACCACG +
Preference number: 4 (lower is better)
Translates to: MTLSQFPKELQQVFKSHSWQPTT*FFIGTT
Trigger: CGTGGTGCCAATAAAGAATCAGGTTGTAGGTTGCCA...ACTGTGTGATTTGAAGACCTGTTGTAGTTCCTTGGGAAACTGACTCAATGTCAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000507314.2
CDS-3UTR TCA 90 bp ATTAAGCAACTACAAAAGGCTCGAGTACACAACACATCAAAAGGTAGCACTGTAGACATCCATGCATTCTaGTCACCCACCCCAGATCTT +
Preference number: 4 (lower is better)
Translates to: IKQLQKARVHNTSKGSTVDIHAF*SPTPDL
Trigger: AAGATCTGGGGTGGGTGATCAGAATGCATGGATGTC...TACAGTGCTACCTTTTGATGTGTTGTGTACTCGAGCCTTTTGTAGTTGCTTAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp GCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATGTAAAGCCTTCATGGAGTTaGTTTGGGTGTTCCCAAAGG +
Preference number: 4 (lower is better)
Translates to: AVSKNLWTLTEDILYRNVKPSWS*FGCSQR
Trigger: CCTTTGGGAACACCCAAATCAACTCCATGAAGGCTT...TACATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGAGGTGGGCAAAGCTGTaGTTCATCTGTCAGCAAGTT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRERWAKL*FICQQV
Trigger: AACTTGCTGACAGATGAATCACAGCTTTGCCCACCT...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640815.1
CDS-3UTR GCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATGTGGAACGCTGCTTaGAGGCAGGGTCATTGCGTC +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRMWNAA*RQGHCV
Trigger: GACGCAATGACCCTGCCTGCAAGCAGCGTTCCACAT...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCAGAGACATCTGCAAATaGTCCTCCTGTTCTAGTCAC +
Preference number: 4 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFRDICK*SSCSSH
Trigger: GTGACTAGAACAGGAGGAGCATTTGCAGATGTCTCT...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp AATCTTGACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTATCTTCACCAGCTATTaGAGTTATTGGCACAGCTTT +
Preference number: 4 (lower is better)
Translates to: NLDLPPLPEPLHQCRKYCIFTSY*SYWHSF
Trigger: AAAGCTGTGCCAATAACTGCAATAGCTGGTGAAGAT...ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACACCACTAAAAAGAGATaGTACCCTGGTCATGTTTTT +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYTTKKR*YPGHVF
Trigger: AAAAACATGACCAGGGTAGCATCTCTTTTTAGTGGT...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATAAGGAAACATGGCCAAGAGGTTCTCTGCTCCTCTGGGCTACCAATGTTAAACAAAGCTAACAATTCCTaGCACATTGTCATTGGCCAA +
Preference number: 4 (lower is better)
Translates to: IRKHGQEVLCSSGLPMLNKANNS*HIVIGQ
Trigger: TTGGCCAATGACAATGTGGCAGGAATTGTTAGCTTT...GTTTAACATTGGTAGCCCAGAGGAGCAGAGAACCTCTTGGCCATGTTTCCTTAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCTCAAACCTGCTTTGTTaGCATTCAATTACACCTCGG +
Preference number: 4 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCSNLLC*HSITPR
Trigger: CCGAGGTGTAATTGAATGGCAACAAAGCAGGTTTGA...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp AATCTTGACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTAACAATGTACAATACTaGAACACTCTCCTGGACGTA +
Preference number: 4 (lower is better)
Translates to: NLDLPPLPEPLHQCRKYCNNVQY*NTLLDV
Trigger: TACGTCCAGGAGAGTGTTGCAGTATTGTACATTGTT...ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATT
43% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp AGGCTCTTGAACACGATAAACCATCTGAGCAAAGGCTACTGTACCATAAGGATCTCCAAACAATCCTTGTaGAGGTTCCCGAACAATGTA +
Preference number: 4 (lower is better)
Translates to: RLLNTINHLSKGYCTIRISKQSL*RFPNNV
Trigger: TACATTGTTCGGGAACCTGCACAAGGATTGTTTGGA...GATCCTTATGGTACAGTAGCCTTTGCTCAGATGGTTTATCGTGTTCAAGAGCCT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp AGCCAATTTCCTACATTTCAACTTTTCAAAAAGAGAAGCAGTTACCAGTCTCTGCCCGCTCACTGGGTCTaGAATGTCTCTATTCTGTGG +
Preference number: 4 (lower is better)
Translates to: SQFPTFQLFKKRSSYQSLPAHWV*NVSILW
Trigger: CCACAGAATAGAGACATTGCAGACCCAGTGAGCGGG...CAGAGACTGGTAACTGCTTCTCTTTTTGAAAAGTTGAAATGTAGGAAATTGGCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCCACCAGCTGCCTCTCTaGATTTTCGGTAACAATCGG +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSHQLPL*IFGNNR
Trigger: CCGATTGTTACCGAAAATGCAGAGAGGCAGCTGGTG...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCATCACAGTCACCAGTTaGAAAGTGAAATTAGAGCCC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSITVTS*KVKLEP
Trigger: GGGCTCTAATTTCACTTTGCAACTGGTGACTGTGAT...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp GGAAGATTGTTTCCACTTATAAACCACTGTTGGCTGCTATACTCTGTAAACTGGGAGAGTTGTGTCAACTaGTACAGCCACAGTTGTCTC +
Preference number: 4 (lower is better)
Translates to: GRLFPLINHCWLLYSVNWESCVN*YSHSCL
Trigger: GAGACAACTGTGGCTGTAGCAGTTGACACAACTCTC...CCAGTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGTGGAAACAATCTTCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR GCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACCACGTTGGTTGGCTaGAGAATGGTAGTCGTCTTG +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSTTLVG*RMVVVL
Trigger: CAAGACGACTACCATTCTGCAGCCAACCAACGTGGT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTGGCAGATACACCAGTTaGCTCAGTAACAATGGCAAC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESGRYTS*LSNNGN
Trigger: GTTGCCATTGTTACTGAGGCAACTGGTGTATCTGCC...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
43% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGACCACGAAAGGGCAATaGATTTGGTTCCATCTGAGC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRETTKGQ*IWFHLS
Trigger: GCTCAGATGGAACCAAATGCATTGCCCTTTCGTGGT...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACTCCTCCACAATCTGTaGTCCCCCTTGAGGGTTTGT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRLLHNL*SPLRVC
Trigger: ACAAACCCTCAAGGGGGAGCACAGATTGTGGAGGAG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGGCACTGTTGTTTATTaGTGCTCCAGCAGTAGCTTC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREGTVVY*CSSSSF
Trigger: GAAGCTACTGCTGGAGCAGCAATAAACAACAGTGCC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTCTTCTTGTGAGCCACTaGCAGCCGAGAACCCACAGA +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPLLVSH*QPRTHR
Trigger: TCTGTGGGTTCTCGGCTGGCAGTGGCTCACAAGAAG...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAAGCCCCCAAATGGCCTaGGAATCTGCATCTGAGACA +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKSPQMA*ESASET
Trigger: TGTCTCAGATGCAGATTCGCAGGCCATTTGGGGGCT...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
43% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGTGCTGGGTCCAGGATaGCCATTCATTTCCACAGTG +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRVLGPG*PFISTV
Trigger: CACTGTGGAAATGAATGGGCATCCTGGACCCAGCAC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGTGCTGGGTCCAGGATaGCCATTCATTTCCACAGTG +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKVLGPG*PFISTV
Trigger: CACTGTGGAAATGAATGGGCATCCTGGACCCAGCAC...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATTTCTTCCATTTCTTCTaGAATCTCATCTGGAAGGGA +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHFFHFF*NLIWKG
Trigger: TCCCTTCCAGATGAGATTCCAGAAGAAATGGAAGAA...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACAGCAGGGAACTCACTaGACAGTATTTCCCAGCCCA +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRQQGTH*TVFPSP
Trigger: TGGGCTGGGAAATACTGTCCAGTGAGTTCCCTGCTG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCGCTATACCCATCTTCTaGTTCAGTTCCACTGACAAA +
Preference number: 4 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCAIPIF*FSSTDK
Trigger: TTTGTCAGTGGAACTGAACCAGAAGATGGGTATAGC...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp ATGTCTATGGAGGTGGCTCTATTTTCAACTGCAGAGATACTGAATAGCCCCAAACCAATGCAAAGTCACTaGAGACAGAGTTCCATGATG +
Preference number: 4 (lower is better)
Translates to: MSMEVALFSTAEILNSPKPMQSH*RQSSMM
Trigger: CATCATGGAACTCTGTCTCCAGTGACTTTGCATTGG...TTTGGGGCTATTCAGTATCTCTGCAGTTGAAAATAGAGCCACCTCCATAGACAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATAGCAAATCCAGAAGCTaGTATATAGTCTCTTCCTTG +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHSKSRS*YIVSSL
Trigger: CAAGGAAGAGACTATATACCAGCTTCTGGATTTGCT...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GCTCTTGAACACGATAAACCATCTGAGCAAAGGCTACTGTACCATAAGGATCATTGGCTGTCCTATGGTTaGCTGATTTTTCAAACTGGC +
Preference number: 4 (lower is better)
Translates to: ALEHDKPSEQRLLYHKDHWLSYG*LIFQTG
Trigger: GCCAGTTTGAAAAATCAGCCAACCATAGGACAGCCA...ATGATCCTTATGGTACAGTAGCCTTTGCTCAGATGGTTTATCGTGTTCAAGAGC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCAACAGTGTCGGAGCTTaGCAAAATTCTACTTCCACC +
Preference number: 4 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFNSVGA*QNSTST
Trigger: GGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTT...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCACAAATAAGGAAACATaGCCAAGAGGTTCTCTGCTC +
Preference number: 4 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCTNKET*PRGSLL
Trigger: GAGCAGAGAACCTCTTGGCCATGTTTCCTTATTTGT...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCTCTAGCACCTCCAGTTaGATTAAACAAGGTGCAAAC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSSSTSS*IKQGAN
Trigger: GTTTGCACCTTGTTTAATCCAACTGGAGGTGCTAGA...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TGTCACTGTTCCAAACAATCCTTGTGCAGGTTCCCGAACAATGTACAATACTGCAATACACGGTCCTATTaGCTTCTTCGATGTCTATGG +
Preference number: 4 (lower is better)
Translates to: CHCSKQSLCRFPNNVQYCNTRSY*LLRCLW
Trigger: CCATAGACATCGAAGAAGCCAATAGGACCGTGTATT...GCAGTATTGTACATTGTTCGGGAACCTGCACAAGGATTGTTTGGAACAGTGACA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAGAACGTTCAAGGGTaGAGGCACCTCATAGGCAGT +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTKNVQG*RHLIGS
Trigger: ACTGCCTATGAGGTGCCTCCACCCTTGAACGTTCTT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATAAGAACGTTCAAGGGTaGAGGCACCTCATAGGCAGT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADKNVQG*RHLIGS
Trigger: ACTGCCTATGAGGTGCCTCCACCCTTGAACGTTCTT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTACCAGAGTCGCACATaGCCAAAATCTCCACTGGAA +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREYQSRT*PKSPLE
Trigger: TTCCAGTGGAGATTTTGGCCATGTGCGACTCTGGTA...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp ATTAAGCAACTACAAAAGGCTCGAGTACACAACACATCAAAAGGTAGCACTGTAAGGCTTCTTGAGAGTTaGGTCCTACTGTCTCCCAGT +
Preference number: 4 (lower is better)
Translates to: IKQLQKARVHNTSKGSTVRLLES*VLLSPS
Trigger: ACTGGGAGACAGTAGGACCCAACTCTCAAGAAGCCT...TACAGTGCTACCTTTTGATGTGTTGTGTACTCGAGCCTTTTGTAGTTGCTTAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp ATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATAAACTAGAAATCATAACGTaGCTTGTGCCAGCAGTGATG +
Preference number: 4 (lower is better)
Translates to: MCSPPQSHVTEIRAKRYKLEIIT*LVPAVM
Trigger: CATCACTGCTGGCACAAGCCACGTTATGATTTCTAG...TTTATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATAAGAACAAAGGCCTCTaGCCAACCAGGGCTAGGAAA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADKNKGL*PTRARK
Trigger: TTTCCTAGCCCTGGTTGGCCAGAGGCCTTTGTTCTT...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCTCAAAATCTTCCAGTaGCTTGGCGCTTCCTGCAGT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADLKIFQ*LGASCS
Trigger: ACTGCAGGAAGCGCCAAGCCACTGGAAGATTTTGAG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGCTGCCCATGTTAGGTTaGAAATCCCATAGATACCAC +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKLPMLG*KSHRYH
Trigger: GTGGTATCTATGGGATTTCCAACCTAACATGGGCAG...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTAGTTCTAGTCCACTCTaGGACTCCTCACTGAATCCT +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESSSSPL*DSSLNP
Trigger: AGGATTCAGTGAGGAGTCCCAGAGTGGACTAGAACT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
43% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGACTTTCCAGAAATAGCTaGAGATATGATGGTACGACC +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRLSRNS*RYDGTT
Trigger: GGTCGTACCATCATATCTCCAGCTATTTCTGGAAAG...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCATTATTTCTGCATCCTaGACATCCAGTAGCCTCTCT +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSIISAS*TSSSLS
Trigger: AGAGAGGCTACTGGATGTCCAGGATGCAGAAATAAT...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATTTCTGCAGCATTTGTCCTTCCTCTGAAGACATCATCATATGCTTTCCACTGTTCTGTGTACCTAAGCTaGCTGCCATCATGTGAGTCA +
Preference number: 4 (lower is better)
Translates to: ISAAFVLPLKTSSYAFHCSVYLS*LPSCES
Trigger: TGACTCACATGATGGCAGCCAGCTTAGGTACACAGA...ACAGTGGAAAGCATATGATGATGTCTTCAGAGGAAGGACAAATGCTGCAGAAAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCCTCTCCTCAGCGAGTTaGGGACTTGCGTATGCAGAC +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSLSSAS*GLAYAD
Trigger: GTCTGCATACGCAAGTCCCCAACTCGCTGAGGAGAG...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCAGCAGCATAGACGTTTaGAATAAAACACAGGTCACC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSSSIDV*NKTQVT
Trigger: GGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCT...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGA +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKALNQG*PDCPVG
Trigger: TCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGC...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGCTTTAAATCAGGGCTaGCCTGACTGCCCTGTTGGA +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRALNQG*PDCPVG
Trigger: TCCAACAGGGCAGTCAGGCCAGCCCTGATTTAAAGC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTGCTATCAGTGACCCCTaGCCATATCCTCCAGAGGAC +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPAISDP*PYPPED
Trigger: GTCCTCTGGAGGATATGGCCAGGGGTCACTGATAGC...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGTGTGCTCAGTCGAATaGTTAGTGAGGTGCTACAGG +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADVCSVE*LVRCYR
Trigger: CCTGTAGCACCTCACTAACCATTCGACTGAGCACAC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp CCCAAATGCTCAAGCCTTCATGGAGTTGATTTGGGTGTTCCCAAAGGCTTCAGAGTATATGCACACCACTaGAAACATTTCCTAGAACTT +
Preference number: 4 (lower is better)
Translates to: PKCSSLHGVDLGVPKGFRVYAHH*KHFLEL
Trigger: AAGTTCTAGGAAATGTTTCCAGTGGTGTGCATATAC...TCTGAAGCCTTTGGGAACACCCAAATCAACTCCATGAAGGCTTGAGCATTTGGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
3UTR CAA 72 bp ATTCATAGTAGGACAGTAAATCTTGACCTTCCTCCATaGCCAGAGCCACTACATCAATGTCGGAAGTACTGT +
Preference number: 4 (lower is better)
Translates to: IHSRTVNLDLPP*PEPLHQCRKYC
Trigger: ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATTTACTGTCCTACTATGAAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
3UTR CAA 72 bp AGAGCTGTTGGCTCTCTTAGGAAAAAGTGCTCACTGTaGTTAAATGATAGAACTCCAGGGCCGTCATCATTA +
Preference number: 4 (lower is better)
Translates to: RAVGSLRKKCSL*LNDRTPGPSSL
Trigger: TAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAGTGAGCACTTTTTCCTAAGAGAGCCAACAGCTCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCACACAAGAAATGGTTaGTCCCTCCTCTGCAATCTC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADHTRNG*SLLCNL
Trigger: GAGATTGCAGAGGAGGGATCAACCATTTCTTGTGTG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGAGACTGGCACGTTTGTaGATAGTTGGAAGGAAGAAT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKRLARL*IVGRKN
Trigger: ATTCTTCCTTCCAACTATTCACAAACGTGCCAGTCT...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GCTCTTGAACACGATAAACCATCTGAGCAAAGGCTACTGTACCATAAGGATCATAGACTGGCACGTTTGTaGATAGTTGGAAGGAAGAAT +
Preference number: 4 (lower is better)
Translates to: ALEHDKPSEQRLLYHKDHRLARL*IVGRKN
Trigger: ATTCTTCCTTCCAACTATTCACAAACGTGCCAGTCT...ATGATCCTTATGGTACAGTAGCCTTTGCTCAGATGGTTTATCGTGTTCAAGAGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAGCAATATCTCCACAGTaGTATTGGCGCTCGTCTGCC +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRAISPQ*YWRSSA
Trigger: GGCAGACGAGCGCCAATATCACTGTGGAGATATTGC...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GCTCTTGAACACGATAAACCATCTGAGCAAAGGCTACTGTACCATAAGGATCATCAAGGACTTTTCCCATaGGGCCTTTCAACCTTATTA +
Preference number: 4 (lower is better)
Translates to: ALEHDKPSEQRLLYHKDHQGLFP*GLSTLL
Trigger: TAATAAGGTTGAAAGGCCTCATGGGAAAAGTCCTTG...ATGATCCTTATGGTACAGTAGCCTTTGCTCAGATGGTTTATCGTGTTCAAGAGC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTATTGGTGCTGAGAGCTaGAGAGTTCCAAATGCATCA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESIGAES*RVPNAS
Trigger: TGATGCATTTGGAACTCTTCAGCTCTCAGCACCAAT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTAGCTGGGCTGATCCATaGTGTCATCCAGAAACACTG +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFSWADP*CHPETL
Trigger: CAGTGTTTCTGGATGACATCATGGATCAGCCCAGCT...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCGTTTGGGGCTGCTCCTaGACTTCAACAAATAAGCCA +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSVWGCS*TSTNKP
Trigger: TGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAAC...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AAGGCATCACCATTTAGTGCTATGACAACTGTAGAAATATTTGGCTGTCCTATGGTTTGGGGCTGCTCCTaGACTTCAACAAATAAGCCA +
Preference number: 4 (lower is better)
Translates to: KASPFSAMTTVEIFGCPMVWGCS*TSTNKP
Trigger: TGGCTTATTTGTTGAAGTTCAGGAGCAGCCCCAAAC...CATAGGACAGCCAAATATTTCTACAGTTGTCATAGCACTAAATGGTGATGCCTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp CTTTACTGGTTTCCCCTTCTAGCAAGACCACATCTGATGAAGCTATACTATAATCTCCTTCATGACCTATaGCAGATCTGGAAGCTGTCT +
Preference number: 4 (lower is better)
Translates to: LYWFPLLARPHLMKLYYNLLHDL*QIWKLS
Trigger: AGACAGCTTCCAGATCTGTCATAGGTCATGAAGGAG...ATTATAGTATAGCTTCATCAGATGTGGTCTTGCTAGAAGGGGAAACCAGTAAAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640012.1
CDS-3UTR TCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAACAGCTGCATATCCTTaGGCATCAAGCAGGGCGATT +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKTAAYP*ASSRAI
Trigger: AATCGCCCTGCTTGATGCTCAAGGATATGCAGCTGT...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCTCTGTCACAATGAACTaGACTGTCACTGTTCCAAAC +
Preference number: 4 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFSVTMN*TVTVPN
Trigger: GTTTGGAACAGTGACAGTTCAGTTCATTGTGACAGA...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACACCAAGCCAAAAGGTaGGTCATTGGGCAAAGTTGT +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTHQAKR*VIGQSC
Trigger: ACAACTTTGCCCAATGACTCACCTTTTGGCTTGGTG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACGGACTACAGGAACTTaGAGAACGTTCAAGGGTGGA +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRRTTGT*RTFKGG
Trigger: TCCACCCTTGAACGTTCTTCAAGTTCCTGTAGTCCG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAATATCAGCTGAATGGTaGAACGCCTGTCCTCCTCCA +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRISAEW*NACPPP
Trigger: TGGAGGAGGACAGGCGTTTCACCATTCAGCTGATAT...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
42% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTCAATTGATATCAGCTaGATGGTGAAACGCCTGTCC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESSIDIS*MVKRLS
Trigger: GGACAGGCGTTTCACCATTCAGCTGATATCAATTGA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGGAGGATGTGCCTAGATaGCGGAGCTATCCCAACTTC +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMEDVPR*RSYPNF
Trigger: GAAGTTGGGATAGCTCCGTCATCTAGGCACATCCTC...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCACCACTGGGATCATaGTCAGCCCAACATCTTCCT +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFSPLGS*SAQHLP
Trigger: AGGAAGATGTTGGGCTGATCATGATCCCAGTGGTGA...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCGTCTCCCAGTTCACCTaGATCTCTCCCAAGAGTCCT +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSVSQFT*ISPKSP
Trigger: AGGACTCTTGGGAGAGATTCAGGTGAACTGGGAGAC...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGGTCTCCCAGTTCACCTaGATCTCTCCCAAGAGTCCT +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMVSQFT*ISPKSP
Trigger: AGGACTCTTGGGAGAGATTCAGGTGAACTGGGAGAC...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCTGGCAGTAAGGCTTCTTaGGAGTTGGGTCCTACTGTC +
Preference number: 4 (lower is better)
Translates to: CRIINRQTILQFSELKSSGSKAS*ELGPTV
Trigger: GACAGTAGGACCCAACTCTCAAGAAGCCTTACTGCC...AGAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCGGCAGTAAGGCTTCTTaGGAGTTGGGTCCTACTGTC +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSGSKAS*ELGPTV
Trigger: GACAGTAGGACCCAACTCTCAAGAAGCCTTACTGCC...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACTGCCCAATAAGTATTaGCTGGCGATCCGAATACAG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTLPNKY*LAIRIQ
Trigger: CTGTATTCGGATCGCCAGTCAATACTTATTGGGCAG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp GCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATTTCTTTATGATCCGATaGTATTCGAAGCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: AAVSKNLWTLTEDILYRNFFMIR*YSKPNS
Trigger: GCTGTTGGGCTTCGAATATCATCGGATCATAAAGAA...ATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCGTCTTGCTTGTGCTaGGGTATGTGGTGGATTCAG +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFSSCLC*GMWWIQ
Trigger: CTGAATCCACCACATACCTCAGCACAAGCAAGACGA...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATTGGATGGCCCAAGGCTaGATGTTCCATGAATGGAAA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADWMAQG*MFHEWK
Trigger: TTTCCATTCATGGAACATTCAGCCTTGGGCCATCCA...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGATCTGTGCTCCCCCTTaGGGGTTTGTGAGAAACACG +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMICAPP*GFVRNT
Trigger: CGTGTTTCTCACAAACCCTCAAGGGGGAGCACAGAT...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACTCGCCAAAAGACCTTaGCATCTTCAAAGGCCCTGT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRLAKRP*HLQRPC
Trigger: ACAGGGCCTTTGAAGATGTCAAGGTCTTTTGGCGAG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAACTCGCCAAAAGACCTTaGCATCTTCAAAGGCCCTGT +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKLAKRP*HLQRPC
Trigger: ACAGGGCCTTTGAAGATGTCAAGGTCTTTTGGCGAG...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCATCTGAGACAAGAGTaGTGTTGGCAGTCCCATACA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADHLRQE*CWQSHT
Trigger: TGTATGGGACTGCCAACATCACTCTTGTCTCAGATG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGACTGCGAATCTGCATCTaGGACAAGAGTGATGTTGGC +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRLRICI*DKSDVG
Trigger: GCCAACATCACTCTTGTCTCAGATGCAGATTCGCAG...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
42% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGTTCGGCTGGCAACACTaGAAGCTTGAATTTTTCCTT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKFGWQH*KLEFFL
Trigger: AAGGAAAAATTCAAGCTTTCAGTGTTGCCAGCCGAA...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCCAGCTTGCAGCAGCCTaGTTCCAAAGGAGACACAGA +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSQLAAA*FQRRHR
Trigger: TCTGTGTCTCCTTTGGAATCAGGCTGCTGCAAGCTG...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp GGAAGATTGTTTCCACTTATAAACCACTGTTGGCTGCTATACTCTGTAAACTGGGAAGGCTTCATTGTATaGAGACAAGTTGTCAGTCCG +
Preference number: 4 (lower is better)
Translates to: GRLFPLINHCWLLYSVNWEGFIV*RQVVSP
Trigger: CGGACTGACAACTTGTCTTCATACAATGAAGCCTTC...CCAGTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGTGGAAACAATCTTCC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGACAGGTCACCATGAATaGGTCCATAGATCTGTGACA +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRETGHHE*VHRSVT
Trigger: TGTCACAGATCTATGGACTCATTCATGGTGACCTGT...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
42% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp TGCGAATCTGCATCTGAGACAAGAGTGATGTTGGCAGTCCCATACACTTTATCACATTTGTCCTTCCTCTaGAGACATCATCATATGCTT +
Preference number: 4 (lower is better)
Translates to: CESASETRVMLAVPYTLSHLSFL*RHHHML
Trigger: AAGCATATGATGATGTCTTCAGAGGAAGGACAAATG...TGATAAAGTGTATGGGACTGCCAACATCACTCTTGTCTCAGATGCAGATTCGCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTCCCTCCTGGCTGCCTTaGCCAGATTCATTATCACTG +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPPSWLP*PDSLSL
Trigger: CAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGG...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCCCCTCCTGGCTGCCTTaGCCAGATTCATTATCACTG +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSPSWLP*PDSLSL
Trigger: CAGTGATAATGAATCTGGTCAAGGCAGCCAGGAGGG...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGTTGCAGTGAAGTCTTaGATCTGGATCACCTGGATT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREVAVKS*IWITWI
Trigger: AATCCAGGTGATCCAGATTCAAGACTTCACTGCAAC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
42% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGATCGTTCACCTGGGCTaGTTTCAATCTTCTGGTTTT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKIVHLG*FQSSGF
Trigger: AAAACCAGAAGATTGAAAGCAGCCCAGGTGAACGAT...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCAATATGGATATGCTCTaGTGTCTACTTCCAACCTCA +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSNMDML*CLLPTS
Trigger: TGAGGTTGGAAGTAGACAGCAGAGCATATCCATATT...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGCCAAAGTATCCTCGGTaGCTCAAAATCCAAAATGCA +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKPKYPR*LKIQNA
Trigger: TGCATTTTGGATTTTGAGGCACCGAGGATACTTTGG...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp CCAGGGCCGTCATCATTAGCAAGGACAATAATTAAGGCTATTGTATTTTTCCCTATCCTCAGGACTGAATaGTGTCAAGGACACTGTTCT +
Preference number: 4 (lower is better)
Translates to: PGPSSLARTIIKAIVFFPILRTE*CQGHCS
Trigger: AGAACAGTGTCCTTGACAGCATTCAGTCCTGAGGAT...AGGGAAAAATACAATAGCCTTAATTATTGTCCTTGCTAATGATGACGGCCCTGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR GCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTCCAACATGATTTTCTaGCACTCGGACAATTGGTGC +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESSNMIF*HSDNWC
Trigger: GCACCAATTGTCCGAGTGGCAGAAAATCATGTTGGA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATGTCTATGGAGGTGGCTCTATTTTCAACTGCAGAGATACTGAATAGCCCCAAAAGACACTGTGAGATTTaGGAATTCATCACCTTCCTG +
Preference number: 4 (lower is better)
Translates to: MSMEVALFSTAEILNSPKRHCEI*EFITFL
Trigger: CAGGAAGGTGATGAATTCGCAAATCTCACAGTGTCT...TTTGGGGCTATTCAGTATCTCTGCAGTTGAAAATAGAGCCACCTCCATAGACAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR GCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTCCACTTGACCTAAGCTaGCCCCTGTCCTGTGTATCA +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPPLDLS*PLSCVS
Trigger: TGATACACAGGACAGGGGGCAGCTTAGGTCAAGTGG...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCTCCAAACAATCCTTGTaGAGGTTCCCGAACAATGTA +
Preference number: 4 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFSKQSL*RFPNNV
Trigger: TACATTGTTCGGGAACCTGCACAAGGATTGTTTGGA...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCCAATAAACATTTACTaGCCCAAAGCTTCCAGCCAG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESPINIY*PKASSQ
Trigger: CTGGCTGGAAGCTTTGGGGCAGTAAATGTTTATTGG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR GCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAATCCCCAATGAGGATGTaGCTAGATGACGGAGCTATC +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKSPMRM*LDDGAI
Trigger: GATAGCTCCGTCATCTAGGCACATCCTCATTGGGGA...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR GCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTTTTCCTCATCTCCCCTaGTTCAAAGAGGAGCTCCCC +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPFPHLP*FKEELP
Trigger: GGGGAGCTCCTCTTTGAAGCAGGGGAGATGAGGAAA...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR GCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCTCAAGGATTTCAACATaGAGACTTTTCCTCATCTCC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSSRIST*RLFLIS
Trigger: GGAGATGAGGAAAAGTCTGCATGTTGAAATCCTTGA...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCCCCGCTCACTGGGTCTaGAATGTCTCTATTCTGTGG +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSPAHWV*NVSILW
Trigger: CCACAGAATAGAGACATTGCAGACCCAGTGAGCGGG...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGGCACTGTTGTTTATTaGTGCTCCAGCAGTAGCTTC +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADGTVVY*CSSSSF
Trigger: GAAGCTACTGCTGGAGCAGCAATAAACAACAGTGCC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGTCAGACAACCAGCTTaGAGCAGCCTGATTCCAAAG +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRVRQPA*SSLIPK
Trigger: CTTTGGAATCAGGCTGCTGCAAGCTGGTTGTCTGAC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATTGGGGACTTGCGTATaGAGACGCCAGAAACAGAAT +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTLGTCV*RRQKQN
Trigger: ATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACATATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTGATCACCTGGATTCATaGAAGATGGCACAGGGTGCT +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFDHLDS*KMAQGA
Trigger: AGCACCCTGTGCCATCTTGCATGAATCCAGGTGATC...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp GCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATGTACTTGGCAGAGCAGCCTaGTATGATTTCTCCTCATTA +
Preference number: 4 (lower is better)
Translates to: AVSKNLWTLTEDILYRNVLGRAA*YDFSSL
Trigger: TAATGAGGAGAAATCATAGCAGGCTGCTCTGCCAAG...TACATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR GCA 90 bp GCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGAATGTATCCAGTGGCAATGAATaGCATAATGCATGCACAGAG +
Preference number: 4 (lower is better)
Translates to: AVSKNLWTLTEDILYRNVSSGNE*HNACTE
Trigger: CTCTGTGCATGCATTATGGCATTCATTGCCACTGGA...TACATTCCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCACTCATTTCTGCCCTTaGGCTCACTCACTGCGATTG +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFTHFCP*AHSLRL
Trigger: CAATCGCAGTGAGTGAGCCCAAGGGCAGAAATGAGT...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCTCCACAGTGATATGTaGAACGCTGCTTGCAGGCAG +
Preference number: 4 (lower is better)
Translates to: SNQHLCAGSSTDRPFYSFLHSDM*NAACRQ
Trigger: CTGCCTGCAAGCAGCGTTCCACATATCACTGTGGAG...AAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATAGGGACAAAATCAACTTCTGGCTCTGCTAGGTTTCCTACTGTTTGGTTCTTCATTGTCACTAGAATTTaGGAAGCCACTCCTAGACTG +
Preference number: 4 (lower is better)
Translates to: IGTKSTSGSARFPTVWFFIVTRI*EATPRL
Trigger: CAGTCTAGGAGTGGCTTCCCAAATTCTAGTGACAAT...GAAGAACCAAACAGTAGGAAACCTAGCAGAGCCAGAAGTTGATTTTGTCCCTAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTTGGCACGGCTTTACTaGTTTCCCCTTCTAGCAAGA +
Preference number: 4 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLLARLY*FPLLAR
Trigger: TCTTGCTAGAAGGGGAAACCAGTAAAGCCGTGCCAA...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CTGTTGTTAAATGATAGAACTCCAGGGCCGTCATCATTAGCAAGGACAATAATTTTGGCACGGCTTTACTaGTTTCCCCTTCTAGCAAGA +
Preference number: 4 (lower is better)
Translates to: LLLNDRTPGPSSLARTIILARLY*FPLLAR
Trigger: TCTTGCTAGAAGGGGAAACCAGTAAAGCCGTGCCAA...AATTATTGTCCTTGCTAATGATGACGGCCCTGGAGTTCTATCATTTAACAACAG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CTACATCAATGTCGGAAGTACTGTAGAACAACAACAGCCGACCAAAGTGCCCTCATTAATGACATATATTaGCACGGCTTTACTGGTTTC +
Preference number: 4 (lower is better)
Translates to: LHQCRKYCRTTTADQSALINDIY*HGFTGF
Trigger: GAAACCAGTAAAGCCGTGCCAATATATGTCATTAAT...GAGGGCACTTTGGTCGGCTGTTGTTGTTCTACAGTACTTCCGACATTGATGTAG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCCCAAGTTCTCCAAAGTaGGTCAGGCACCCCTTGAAT +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFPSSPK*VRHPLN
Trigger: ATTCAAGGGGTGCCTGACCCACTTTGGAGAACTTGG...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTCCGCTAAAGTTAGCAAAATGGCTGTCCTATGGTTaGCTGATTTTTCAAACTGGC +
Preference number: 4 (lower is better)
Translates to: VVFNDPSGKKSCPLKLAKWLSYG*LIFQTG
Trigger: GCCAGTTTGAAAAATCAGCCAACCATAGGACAGCCA...TTTTGCTAACTTTAGCGGACAACTTTTCTTTCCTGAGGGGTCGTTGAATACAAC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp TCTCTTAGGAAAAAGTGCTCACTGTTGTTAAATGATAGAACTCCAGGGCCGTCAGTTCCGTGTCTAATATaGCAGATATTTGTAGGGCCT +
Preference number: 4 (lower is better)
Translates to: SLRKKCSLLLNDRTPGPSVPCLI*QIFVGP
Trigger: AGGCCCTACAAATATCTGCCATATTAGACACGGAAC...TGACGGCCCTGGAGTTCTATCATTTAACAACAGTGAGCACTTTTTCCTAAGAGA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp CCAGGGCCGTCATCATTAGCAAGGACAATAATTAAGGCTATTGTATTTTTCCCTCGATGTCTATGGAGGTaGCTCTATTTTCAACTGCAG +
Preference number: 4 (lower is better)
Translates to: PGPSSLARTIIKAIVFFPRCLWR*LYFQLQ
Trigger: CTGCAGTTGAAAATAGAGCCACCTCCATAGACATCG...AGGGAAAAATACAATAGCCTTAATTATTGTCCTTGCTAATGATGACGGCCCTGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000640779.1
CDS-3UTR CCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACGGATTCTTCTTTTTCTaGAACTGTATCATCAAGGAT +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYGFFFF*NCIIKD
Trigger: ATCCTTGATGATACAGTTCCAGAAAAAGAAGAATCC...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGAGCTCTCAAGTGAATaGCAATATCCCCAAGTAGTC +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREELSSE*QYPQVV
Trigger: GACTACTTGGGGATATTGCCATTCACTTGAGAGCTC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAGGTCATCCGGCAAAATaGAAACTTCGGCATGAGCTT +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTGHPAK*KLRHEL
Trigger: AAGCTCATGCCGAAGTTTCCATTTTGCCGGATGACC...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAAGGCTTCTTGAGAGTTaGGTCCTACTGTCTCCCAGT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRRLLES*VLLSPS
Trigger: ACTGGGAGACAGTAGGACCCAACTCTCAAGAAGCCT...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAAGGCTTCTTGAGAGTTaGGTCCTACTGTCTCCCAGT +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKRLLES*VLLSPS
Trigger: ACTGGGAGACAGTAGGACCCAACTCTCAAGAAGCCT...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCGAACAACCCGCTCACTaGGTCTGCAATGTCTCTATT +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSEQPAH*VCNVSI
Trigger: AATAGAGACATTGCAGACCCAGTGAGCGGGTTGTTC...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTAAGGCTCCCCAGTGTTaGGGTCATGTTGCCAACAAC +
Preference number: 4 (lower is better)
Translates to: SNQHLCAGSSTDRPFYSFKAPQC*GHVANN
Trigger: GTTGTTGGCAACATGACCCCAACACTGGGGAGCCTT...AAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCAAGGCTCCCCAGTGTTaGGGTCATGTTGCCAACAAC +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSKAPQC*GHVANN
Trigger: GTTGTTGGCAACATGACCCCAACACTGGGGAGCCTT...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCTAATCTTCCAGTGGCTTaGCGCTTCCTGCAGTGGTCT +
Preference number: 4 (lower is better)
Translates to: CRIINRQTILQFSELKSSNLPVA*RFLQWS
Trigger: AGACCACTGCAGGAAGCGCCAAGCCACTGGAAGATT...AGAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTGGCAACCACGTTGGTTaGCTGCAGAATGGTAGTCGT +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPGNHVG*LQNGSR
Trigger: ACGACTACCATTCTGCAGCCAACCAACGTGGTTGCC...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp TGCAGTGAACAAAGCAGCATAGACGTTTGGAATAAAACACAGGTCACCATGAATCTGCCCATGTTAGGTTaGAAATCCCATAGATACCAC +
Preference number: 4 (lower is better)
Translates to: CSEQSSIDVWNKTQVTMNLPMLG*KSHRYH
Trigger: GTGGTATCTATGGGATTTCCAACCTAACATGGGCAG...ATTCATGGTGACCTGTGTTTTATTCCAAACGTCTATGCTGCTTTGTTCACTGCA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAGTTCTAGTCCACTCTaGGACTCCTCACTGAATCCT +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTSSSPL*DSSLNP
Trigger: AGGATTCAGTGAGGAGTCCCAGAGTGGACTAGAACT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACCATTGTACAGGTTGTaGTCCCTGACACAGACTGAA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTPLYRL*SLTQTE
Trigger: TTCAGTCTGTGTCAGGGACCACAACCTGTACAATGG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR CCA 90 bp ATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACTCAAAAAGGACAATCTaGAAGCGTTTAGGAAATGAA +
Preference number: 4 (lower is better)
Translates to: IWITWIHARWHRVLVIIYSKRTI*KRLGNE
Trigger: TTCATTTCCTAAACGCTTCCAGATTGTCCTTTTTGA...GTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGAT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCTTCATGCTGATGGTATaGAGCACTCTGTTGAGAATA +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSFMLMV*STLLRI
Trigger: TATTCTCAACAGAGTGCTCCATACCATCAGCATGAA...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTGGCACAGAAGATATaGGAAAGAACAGCCAAGCAA +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELAQKI*ERTAKQ
Trigger: TTGCTTGGCTGTTCTTTCCCATATCTTCTGTGCCAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATTCTGTGTACCTAAGCTaGCTGCCATCATGTGAGTCA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADSVYLS*LPSCES
Trigger: TGACTCACATGATGGCAGCCAGCTTAGGTACACAGA...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR CCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAATATGCTTTCCACTGTaGCTTCACCTGGTAGGCATG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTICFPL*LHLVGM
Trigger: CATGCCTACCAGGTGAAGCCACAGTGGAAAGCATAT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGCAGAGGACGGGAACGTaGCTCCATTTTGTGGACTTG +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMQRTGT*LHFVDL
Trigger: CAAGTCCACAAAATGGAGCCACGTTCCCGTCCTCTG...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR CCA 90 bp AAAGCTGCAGTTTCCAAGAACCTGTGGACATTAACTGAGGACATATTGTACAGGTTCATGGAGTTGATTTaGGTGTTCCCAAAGGCTTCA +
Preference number: 4 (lower is better)
Translates to: KAAVSKNLWTLTEDILYRFMELI*VFPKAS
Trigger: TGAAGCCTTTGGGAACACCCAAATCAACTCCATGAA...CCTGTACAATATGTCCTCAGTTAATGTCCACAGGTTCTTGGAAACTGCAGCTTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR CCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGCCAGAAACAGAATCTaGGATCCAGCAGTGTATCCT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADARNRI*DPAVYP
Trigger: AGGATACACTGCTGGATCCCAGATTCTGTTTCTGGC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000640815.1
CDS-3UTR CCA 90 bp GCCATGTGTAGTCCTCCCCAAAGCCATGTCACGGAAATCAGAGCAAAGAGATATATACACTTCAACCTGTaGTACCTAACTGAAACTTTT +
Preference number: 4 (lower is better)
Translates to: AMCSPPQSHVTEIRAKRYIHFNL*YLTETF
Trigger: AAAAGTTTCAGTTAGGTACCACAGGTTGAAGTGTAT...ATATCTCTTTGCTCTGATTTCCGTGACATGGCTTTGGGGAGGACTACACATGGC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000640407.1
3UTR CAA 72 bp AGTTATATTAGCACAGGAACTTCTTTCCAGAGGCTCTaGAACACGATAAACCATCTGAGCAAAGGCTACTGT +
Preference number: 4 (lower is better)
Translates to: SYISTGTSFQRL*NTINHLSKGYC
Trigger: ACAGTAGCCTTTGCTCAGATGGTTTATCGTGTTCAAGAGCCTCTGGAAAGAAGTTCCTGTGCTAATATAACT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAACCTCAAAAGTCACCATaGCCATTCCATAGGTTCCCT +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKPQKSP*PFHRFP
Trigger: AGGGAACCTATGGAATGGTCATGGTGACTTTTGAGG...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTACAGTTGTGTTTGGCTaGAGATCAATGAAGTCCAGA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESTVVFG*RSMKSR
Trigger: TCTGGACTTCATTGATCTTCAGCCAAACACAACTGT...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGCGGGGTCACTGCTTTTaGATTAAAGCCAGAGGGCTT +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMRGHCF*IKARGL
Trigger: AAGCCCTCTGGCTTTAATTCAAAAGCAGTGACCCCG...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTACCCCCTTGATCGGATaGTGTGGAGCTCTACAGATT +
Preference number: 4 (lower is better)
Translates to: SNQHLCAGSSTDRPFYSFTPLIG*CGALQI
Trigger: AATCTGTAGAGCTCCACATCATCCGATCAAGGGGGT...AAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAATCTTGCTAGCAAGGTaGTCACTATCTCCCTTTCTC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTILLAR*SLSPFL
Trigger: GAGAAAGGGAGATAGTGATCACCTTGCTAGCAAGAT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTGGACTAACCACCCATaGTACACTAACATCACCAAA +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESWTNHP*YTNITK
Trigger: TTTGGTGATGTTAGTGTATCATGGGTGGTTAGTCCA...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTCTCCTTTCAGACTCTTaGTTCCCCTGGGCATTGCAT +
Preference number: 4 (lower is better)
Translates to: MCRIINRQTILQFSELKSLLSDS*FPWALH
Trigger: ATGCAATGCCCAGGGGAATCAAGAGTCTGAAAGGAG...AGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGGGTAATCCTCAGGACTaGATGCTGTCAAGGACACTG +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMGNPQD*MLSRTL
Trigger: CAGTGTCCTTGACAGCATTCAGTCCTGAGGATTACC...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp GAAACCAATGTCACACGGAAATACTCATTAAGTTCAGGAATATCATCATCAAGAGGTAATCCTCAGGACTaGATGCTGTCAAGGACACTG +
Preference number: 4 (lower is better)
Translates to: ETNVTRKYSLSSGISSSRGNPQD*MLSRTL
Trigger: CAGTGTCCTTGACAGCATTCAGTCCTGAGGATTACC...TCTTGATGATGATATTCCTGAACTTAATGAGTATTTCCGTGTGACATTGGTTTC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000450321.2
CDS-3UTR TCA 90 bp GTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCGGAAACACTGAGGACTaGCACAGAGAATGCCTTATC +
Preference number: 4 (lower is better)
Translates to: VQDHQQTDHFTVFRIKVFGNTED*HRECLI
Trigger: GATAAGGCATTCTCTGTGTCAGTCCTCAGTGTTTCC...GAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGATCTGGAAGCTGTCTaGAAGCTAACAATTCCTGCC +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRDLEAV*KLTIPA
Trigger: GGCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
41% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGGAGAGAAATTAGAAAACTCTCATCCATCTCTGGGAAATCATCAGGAAGAATAGATCTGGAAGCTGTCTaGAAGCTAACAATTCCTGCC +
Preference number: 4 (lower is better)
Translates to: RREIRKLSSISGKSSGRIDLEAV*KLTIPA
Trigger: GGCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATC...TATTCTTCCTGATGATTTCCCAGAGATGGATGAGAGTTTTCTAATTTCTCTCCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp TCCTTCATGACCTATGACAGATCTGGAAGCTGTCTGAAAGCTAACAATTCCTGCCTGTTGATGAAAAGCTaGATTGTTATGTTAGCCTCT +
Preference number: 4 (lower is better)
Translates to: SFMTYDRSGSCLKANNSCLLMKS*IVMLAS
Trigger: AGAGGCTAACATAACAATTCAGCTTTTCATCAACAG...GCAGGAATTGTTAGCTTTCAGACAGCTTCCAGATCTGTCATAGGTCATGAAGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp GTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTCCGCTAAAGTTAGCAAAATCACTTCTGTCACAATaGACTGAACTGTCACTGTTC +
Preference number: 4 (lower is better)
Translates to: VVFNDPSGKKSCPLKLAKSLLSQ*TELSLF
Trigger: GAACAGTGACAGTTCAGTTCATTGTGACAGAAGTGA...TTTTGCTAACTTTAGCGGACAACTTTTCTTTCCTGAGGGGTCGTTGAATACAAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR TCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCGACTTGCTTCTGTCCTaGTCAATAGTAGCACCTTTG +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSDLLLS*SIVAPL
Trigger: CAAAGGTGCTACTATTGATCAGGACAGAAGCAAGTC...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGCCAGCACTGTCTGGTaGTGCTTTCCAATAAACATT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADASTVW*CFPINI
Trigger: AATGTTTATTGGAAAGCATCACCAGACAGTGCTGGC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACACCTGTATTACTACAATaGCTGCAGACTGTTCGTCTC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTPVLLQ*LQTVRL
Trigger: GAGACGAACAGTCTGCAGTCATTGTAGTAATACAGG...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTAACCCTCTGTGCTTCTaGCACTCGAAGTTGCTCATG +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPNPLCF*HSKLLM
Trigger: CATGAGCAACTTCGAGTGTCAGAAGCACAGAGGGTT...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGTCACCACTGGGATCATaGTCAGCCCAACATCTTCCT +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMSPLGS*SAQHLP
Trigger: AGGAAGATGTTGGGCTGATCATGATCCCAGTGGTGA...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCGCCCATGCTGAAAGGTaGCTGTACTGCCATGCAAAA +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSAHAER*LYCHAK
Trigger: TTTTGCATGGCAGTACAGTCACCTTTCAGCATGGGC...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGTTTCAGGAGCAAACTaGACAACTCCATTTGGGTCA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADVSGAN*TTPFGS
Trigger: TGACCCAAATGGAGTTGTTCAGTTTGCTCCTGAAAC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATTAAGCAACTACAAAAGGCTCGAGTACACAACACATCAAAAGGTAGCACTGTAGTTTCAGGAGCAAACTaGACAACTCCATTTGGGTCA +
Preference number: 4 (lower is better)
Translates to: IKQLQKARVHNTSKGSTVVSGAN*TTPFGS
Trigger: TGACCCAAATGGAGTTGTTCAGTTTGCTCCTGAAAC...TACAGTGCTACCTTTTGATGTGTTGTGTACTCGAGCCTTTTGTAGTTGCTTAAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000638975.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCAGAGCCAGAGGCTCTaGATAAGTCTTCTTAGACAA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADQSQRL*ISLLRQ
Trigger: TTGTCTAAGAAGACTTATTCAGAGCCTCTGGCTCTG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp GGAAGATTGTTTCCACTTATAAACCACTGTTGGCTGCTATACTCTGTAAACTGGTTCTTTATGATCCGATaGTATTCGAAGCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: GRLFPLINHCWLLYSVNWFFMIR*YSKPNS
Trigger: GCTGTTGGGCTTCGAATATCATCGGATCATAAAGAA...CCAGTTTACAGAGTATAGCAGCCAACAGTGGTTTATAAGTGGAAACAATCTTCC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGGCAGATTTTGCTTCCTaGAGAATTGTTGGCATTCCA +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLREADFAS*RIVGIP
Trigger: TGGAATGCCAACAATTCTTCAGGAAGCAAAATCTGC...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAGATTCAAATCCGACCTaGGAATTGGCAGCTTTCTCA +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTDSNPT*ELAAFS
Trigger: TGAGAAAGCTGCCAATTCTCAGGTCGGATTTGAATC...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTCAATTTCAGCAACAATaGAACCTGATCGGAGTTGAG +
Preference number: 4 (lower is better)
Translates to: SSSTIHRFLLHRWMYLESQFQQQ*NLIGVE
Trigger: CTCAACTCCGATCAGGTTTCATTGTTGCTGAAATTG...ACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp CCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTACAGCAGGTGTGCCATaGAGGGTGACAAGTTTCTCA +
Preference number: 4 (lower is better)
Translates to: PNTTITFVLIIQYNSQVPTAGVP*RVTSFS
Trigger: TGAGAAACTTGTCACCCTTCATGGCACACCTGCTGT...AGGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGCATTTGGTTCCATCTaGGCACATCTTTCACCGAAA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADAFGSI*AHLSPK
Trigger: TTTCGGTGAAAGATGTGCTCAGATGGAACCAAATGC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCCCCTTGAGGGTTTGTaGGAAACACGTAGAAGAATT +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADPLEGL*ETRRRI
Trigger: AATTCTTCTACGTGTTTCTCACAAACCCTCAAGGGG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATCCTATGATGCCATTGTaGAGGTCACTCCCTGTAATA +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADPMMPL*RSLPVI
Trigger: TATTACAGGGAGTGACCTTCACAATGGCATCATAGG...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGATGGCCACCTGCAGACTaGTTAAAGTGGCCTTCTTGT +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRWPPAD*LKWPSC
Trigger: ACAAGAAGGCCACTTTAATCAGTCTGCAGGTGGCCA...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAATCTCTGGCGTTAGGATaGCATCCAATACAGTGCTTC +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKSLALG*HPIQCF
Trigger: GAAGCACTGTATTGGATGTCATCCTAACGCCAGAGA...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR TCA 90 bp TGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATTAAAGTCTTCTCTGCGAATCTGCATCTaGGACAAGAGTGATGTTGGC +
Preference number: 4 (lower is better)
Translates to: CRIINRQTILQFSELKSSLRICI*DKSDVG
Trigger: GCCAACATCACTCTTGTCTCAGATGCAGATTCGCAG...AGAAGACTTTAATTCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTGTCACTTCAGCAAAGTaGCTGAATCCCCTAGTGTCC +
Preference number: 4 (lower is better)
Translates to: SNQHLCAGSSTDRPFYSFVTSAK*LNPLVS
Trigger: GGACACTAGGGGATTCAGTCACTTTGCTGAAGTGAC...AAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp AGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATGAAGGCTTCATTGTATaGAGACAAGTTGTCAGTCCG +
Preference number: 4 (lower is better)
Translates to: RFLLHRWMYLESFSTKADEGFIV*RQVVSP
Trigger: CGGACTGACAACTTGTCTTCATACAATGAAGCCTTC...ATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAGAAGGCTTCATTGTATaGAGACAAGTTGTCAGTCCG +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTEGFIV*RQVVSP
Trigger: CGGACTGACAACTTGTCTTCATACAATGAAGCCTTC...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR TCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGACTGGCTGCCATCATGTaGGTCAGAAGTTTAGCTGCA +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRLAAIM*VRSLAA
Trigger: TGCAGCTAAACTTCTGACTCACATGATGGCAGCCAG...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAACAAGAGCTGCAGTaGACAAAGCAGCATAGACGT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLREQELQ*TKQHRR
Trigger: ACGTCTATGCTGCTTTGTTCACTGCAGCTCTTGTTC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR TCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAAAGCTGATACAAATATaGAAGTGTGCTCAGTCGAAT +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRKLIQI*KCAQSN
Trigger: ATTCGACTGAGCACACTTTCATATTTGTATCAGCTT...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR TCA 90 bp CATGAAAACATAAAGTCCCTGCAGACTGTTGAAAATGACAAAGAGAACCAACATTTTTCACTGGGCCCTTaGAGGCATAGATATGGGACT +
Preference number: 4 (lower is better)
Translates to: HENIKSLQTVENDKENQHFSLGP*RHRYGT
Trigger: AGTCCCATATCTATGCCTTCAAGGGCCCAGTGAAAA...ATGTTGGTTCTCTTTGTCATTTTCAACAGTCTGCAGGGACTTTATGTTTTCATG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000638990.1
CDS-3UTR GCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAATGCCTTCTTTTGCTTaGAAGGGGTCCACAGCTCCA +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRMPSFA*KGSTAP
Trigger: TGGAGCTGTGGACCCCTTGCAAGCAAAAGAAGGCAT...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAACTTTCCTTCTTCCACTaGTTTGTCTATGGGCTCCAG +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKLSFFH*FVYGLQ
Trigger: CTGGAGCCCATAGACAAAGCAGTGGAAGAAGGAAAG...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp CTCCAATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCACCAAACACACCCTaGTGCCTCAAAATGGTGAAG +
Preference number: 4 (lower is better)
Translates to: LQSTFMCRIINRQTILQFSPNTP*CLKMVK
Trigger: CTTCACCATTTTGAGGCAGCAGGGTGTGTTTGGTGA...AAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGATTGGAG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCATATTGGCGCTCGTCTaGCCAATCTCAAATGTGATG +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSILALV*PISNVM
Trigger: CATCACATTTGAGATTGGGCAGACGAGCGCCAATAT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TCTCTTAGGAAAAAGTGCTCACTGTTGTTAAATGATAGAACTCCAGGGCCGTCAATCTTCACCAGCTATTaGAGTTATTGGCACAGCTTT +
Preference number: 4 (lower is better)
Translates to: SLRKKCSLLLNDRTPGPSIFTSY*SYWHSF
Trigger: AAAGCTGTGCCAATAACTGCAATAGCTGGTGAAGAT...TGACGGCCCTGGAGTTCTATCATTTAACAACAGTGAGCACTTTTTCCTAAGAGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGATACTGTCTCCCACTaGACACTCACAGCCAAATCA +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRDTVSH*TLTAKS
Trigger: TGATTTGGCTGTGAGTGTGCAGTGGGAGACAGTATC...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGTATTACTACAATGACTaGAGACTGTTCGTCTCGCAT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKYYYND*RLFVSH
Trigger: ATGCGAGACGAACAGTCTGCAGTCATTGTAGTAATA...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
41% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAATCCTCCCTCACTGACTaGAGTGAGCTGAAACTCATA +
Preference number: 4 (lower is better)
Translates to: IHRFLLHRWMYLESFSTKSSLTD*SELKLI
Trigger: TATGAGTTTCAGCTCACTGCAGTCAGTGAGGGAGGA...TTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR GCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCAACAAAATCCAAGCCTaGTTCCGCTGTCCCGCTCAT +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSNKIQA*FRCPAH
Trigger: ATGAGCGGGACAGCGGAAGCAGGCTTGGATTTTGTT...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000405460.9
ENST00000425867.3
CDS-3UTR GCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGACACCAGCTGCCTCTCTaGATTTTCGGTAACAATCGG +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRHQLPL*IFGNNR
Trigger: CCGATTGTTACCGAAAATGCAGAGAGGCAGCTGGTG...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp AAGTCTTCTAGTTGCAGTGAAGTCTTGAATCTGGATCACCTGGATTCATGCAAGAACCATGGCAAAAGCTaGAAATCCAGTATCATCCTT +
Preference number: 4 (lower is better)
Translates to: KSSSCSEVLNLDHLDSCKNHGKS*KSSIIL
Trigger: AAGGATGATACTGGATTTGCAGCTTTTGCCATGGTT...CTTGCATGAATCCAGGTGATCCAGATTCAAGACTTCACTGCAACTAGAAGACTT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp ATCAACATTTATGTGCAGGATCATCAACAGACAGACCATTTTACAGTTTTCAGAGAATCTCTGGCCACCTaGAGACTGATTAAAGTGGCC +
Preference number: 4 (lower is better)
Translates to: INIYVQDHQQTDHFTVFRESLAT*RLIKVA
Trigger: GGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTC...TCTGAAAACTGTAAAATGGTCTGTCTGTTGATGATCCTGCACATAAATGTTGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR GCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGGAATCTCTGGCCACCTaGAGACTGATTAAAGTGGCC +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMESLAT*RLIKVA
Trigger: GGCCACTTTAATCAGTCTGCAGGTGGCCAGAGATTC...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000640407.1
CDS-3UTR GCA 90 bp TTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAAAGCTGATACAAATATGGTCAGACAACCAGCTTaGAGCAGCCTGATTCCAAAG +
Preference number: 4 (lower is better)
Translates to: LHRWMYLESFSTKADTNMVRQPA*SSLIPK
Trigger: CTTTGGAATCAGGCTGCTGCAAGCTGGTTGTCTGAC...CATATTTGTATCAGCTTTTGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp ACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCACAAGTCAGAAGTTTAGCTaGAAACATGGAGTACCTGGC +
Preference number: 4 (lower is better)
Translates to: TIHRFLLHRWMYLESFSTSQKFS*KHGVPG
Trigger: GCCAGGTACTCCATGTTTGCAGCTAAACTTCTGACT...TGTGCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGATTGGGGACTTGCGTATaGAGACGCCAGAAACAGAAT +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRLGTCV*RRQKQN
Trigger: ATTCTGTTTCTGGCGTCTGCATACGCAAGTCCCCAA...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp TTAATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGATATCGCCTCTCTGTGTaGTCATCATTCATCACCAGC +
Preference number: 4 (lower is better)
Translates to: LIIQYNSQVPITQVDVLRYRLSV*SSFITS
Trigger: GCTGGTGATGAATGATGAGCACACAGAGAGGCGATA...TCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGATTAA
41% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000405460.9
ENST00000425867.3
ENST00000638990.1
ENST00000640407.1
ENST00000640815.1
CDS-3UTR GCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAACAAATATGAAAGTGTaGTCAGTCGAATGGTTAGTG +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRTNMKV*SVEWLV
Trigger: CACTAACCATTCGACTGAGCACACTTTCATATTTGT...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCCAAATACAACAATCACGTTTGTATTAATCATCCAGTACAATTCACAGGTTCCTTCATCAGGGGGATTTaGGCCACCCTCTACCTCAAA +
Preference number: 4 (lower is better)
Translates to: SKYNNHVCINHPVQFTGSFIRGI*ATLYLK
Trigger: TTTGAGGTAGAGGGTGGCCCAAATCCCCCTGATGAA...GGAACCTGTGAATTGTACTGGATGATTAATACAAACGTGATTGTTGTATTTGGA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAAACAACAGTTGTGTTTaGCTGAAGATCAATGAAGTC +
Preference number: 4 (lower is better)
Translates to: SPGFMQDGTGCLSSSTYRNNSCV*LKINEV
Trigger: GACTTCATTGATCTTCAGCCAAACACAACTGTTGTT...TCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp ATCATCCAGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGCTGCAGCAAGCCATATaGATGATCACTAGCTTTGAT +
Preference number: 4 (lower is better)
Translates to: IIQYNSQVPITQVDVLRELQQAI*MITSFD
Trigger: ATCAAAGCTAGTGATCATCCATATGGCTTGCTGCAG...CTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACTGGATGAT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp TTGAATCTGGATCACCTGGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATAATGAATATCCCATATaGATCATCACTAGCCAAAAC +
Preference number: 4 (lower is better)
Translates to: LNLDHLDSCKMAQGACHHNEYPI*IITSQN
Trigger: GTTTTGGCTAGTGATGATCCATATGGGATATTCATT...ATGATGACAAGCACCCTGTGCCATCTTGCATGAATCCAGGTGATCCAGATTCAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCTTAAAGCCCCTAGTCTaGCTCCTCCTGTTGTTTCAT +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSLKPLV*LLLLFH
Trigger: ATGAAACAACAGGAGGAGCCAGACTAGGGGCTTTAA...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGTTAAAGCCCCTAGTCTaGCTCCTCCTGTTGTTTCAT +
Preference number: 4 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLLKPLV*LLLLFH
Trigger: ATGAAACAACAGGAGGAGCCAGACTAGGGGCTTTAA...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCAGGCACCCCTTGAATTaGAGATTCATAGTAGGACAG +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSRHPLN*RFIVGQ
Trigger: CTGTCCTACTATGAATCTCCAATTCAAGGGGTGCCT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GGATTCATGCAAGATGGCACAGGGTGCTTGTCATCATCTACATATAGAGTTAGCTATTTGGCTGTCCTATaGTTGGCTGATTTTTCAAAC +
Preference number: 4 (lower is better)
Translates to: GFMQDGTGCLSSSTYRVSYLAVL*LADFSN
Trigger: GTTTGAAAAATCAGCCAACCATAGGACAGCCAAATA...GCTAACTCTATATGTAGATGATGACAAGCACCCTGTGCCATCTTGCATGAATCC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp GTTCACTCTAACAGTGTCGGAGCTTGGCAAAATTCTACTTCCACCTTCAGTGTATATTTGGCTGTCCTATaGTTGGCTGATTTTTCAAAC +
Preference number: 4 (lower is better)
Translates to: VHSNSVGAWQNSTSTFSVYLAVL*LADFSN
Trigger: GTTTGAAAAATCAGCCAACCATAGGACAGCCAAATA...TACACTGAAGGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTTAGAGTGAAC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AGTACAATTCACAGGTTCCTATTACACAGGTGGATGTACTTAGAGAGTTTTAGCAACAGTGTCGGAGCTTaGCAAAATTCTACTTCCACC +
Preference number: 4 (lower is better)
Translates to: STIHRFLLHRWMYLESFSNSVGA*QNSTST
Trigger: GGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTT...GCTAAAACTCTCTAAGTACATCCACCTGTGTAATAGGAACCTGTGAATTGTACT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000405460.9
CDS-3UTR CCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGAACAGTGTCGGAGCTTaGCAAAATTCTACTTCCACC +
Preference number: 4 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLNSVGA*QNSTST
Trigger: GGTGGAAGTAGAATTTTGCCAAGCTCCGACACTGTT...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp AATCTTGACCTTCCTCCATTGCCAGAGCCACTACATCAATGTCGGAAGTACTGTTCATACAGAATGACTTaGTATACTTCTTTCTCCTCA +
Preference number: 4 (lower is better)
Translates to: NLDLPPLPEPLHQCRKYCSYRMT*YTSFSS
Trigger: TGAGGAGAAAGAAGTATACCAAGTCATTCTGTATGA...ACAGTACTTCCGACATTGATGTAGTGGCTCTGGCAATGGAGGAAGGTCAAGATT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp CAACAAATGCACAAACAATGTTGTATTCAACGACCCCTCAGGAAAGAAAAGTTGGGTTCTCTGCTCCTCTaGGCTACCAATGTTAAACTT +
Preference number: 4 (lower is better)
Translates to: QQMHKQCCIQRPLRKEKLGSLLL*ATNVKL
Trigger: AAGTTTAACATTGGTAGCCCAGAGGAGCAGAGAACC...CAACTTTTCTTTCCTGAGGGGTCGTTGAATACAACATTGTTTGTGCATTTGTTG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000640012.1
ENST00000640779.1
CDS-3UTR CCA 90 bp