RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ACE2 (Homo sapiens)

Ensembl gene IDs: ENSG00000130234

Ensembl transcript IDs: ENST00000252519.8, ENST00000427411.2, ENST00000471548.5, ENST00000473851.1, ENST00000677282.1, ENST00000678046.1, ENST00000678073.1, ENST00000679162.1, ENST00000679212.1, ENST00000679278.1, ENST00000680121.1

Found 1233 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp GTGACCCAAACCCTCTTTCTCAATGGACCCACAGTCCGATGGGGGTaGCAGCCTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGAT +
Preference number: 1 (lower is better)
Translates to: VTQTLFLNGPTVRWG*QPFLHQRLFPHSED
Trigger: ATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGTGGGTCCATTGAGAAAGAGGGTTTGGGTCAC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 90 bp GTGCCAGCCTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATaGGCTCATGCACAAGCTGGGTCTTTCTGGTCTCCCTCTCGAAGA +
Preference number: 1 (lower is better)
Translates to: VPAFPAPKTVSPLRG*AHAQAGSFWSPSRR
Trigger: TCTTCGAGAGGGAGACCAGAAAGACCCAGCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAGGCTGGCAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 90 bp CCCAAGAGAAAAGAAAGAACAGGTGACCCAAACCCTCTTTCTCAATaGACCCACAGTCCGATGGGGGTGCCAGCCTTTCCTGCACCAAAG +
Preference number: 1 (lower is better)
Translates to: PKRKERTGDPNPLSQ*THSPMGVPAFPAPK
Trigger: CTTTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGTGGGTCCATTGAGAAAGAGGGTTTGGGTCACCTGTTCTTTCTTTTCTCTTGGG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGG +
Preference number: 1 (lower is better)
Translates to: PQLENSRNEFLSGML*EFTEAPGSSFVLSG
Trigger: CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 90 bp CCTTGCTTCCGTATAGCCCAGGGTTTGGCAAAGTTTGTCTGTAAATaGCTTTGTGGGCCATGCCGTCTCTACTTCAACTACTCAGCTCTG +
Preference number: 1 (lower is better)
Translates to: PCFRIAQGLAKFVCK*LCGPCRLYFNYSAL
Trigger: CAGAGCTGAGTAGTTGAAGTAGAGACGGCATGGCCCACAAAGCCATTTACAGACAAACTTTGCCAAACCCTGGGCTATACGGAAGCAAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 90 bp CTGTATGCTAGGTTCTTTCCTACCCAAGAGAAAAGAAAGAACAGGTaGCCCAAACCCTCTTTCTCAATGGACCCACAGTCCGATGGGGGT +
Preference number: 1 (lower is better)
Translates to: LYARFFPTQEKRKNR*PKPSFSMDPQSDGG
Trigger: ACCCCCATCGGACTGTGGGTCCATTGAGAAAGAGGGTTTGGGTCACCTGTTCTTTCTTTTCTCTTGGGTAGGAAAGAACCTAGCATACAG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 90 bp GAGATTCTCATGTCTACATGTGTACTCAATGAACACATGTTACTCTaGTTAGGTTTGTGGGCCCCATGGTCTCCGAATCAGTTTCAGGTC +
Preference number: 1 (lower is better)
Translates to: EILMSTCVLNEHMLL*LGLWAPWSPNQFQV
Trigger: GACCTGAAACTGATTCGGAGACCATGGGGCCCACAAACCTAATCAGAGTAACATGTGTTCATTGAGTACACATGTAGACATGAGAATCTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 90 bp AATGGATTAAATGAAAGTGAGCTAATGCATGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAT +
Preference number: 1 (lower is better)
Translates to: NGLNESELMHAILNP*SYTSSQALSLQVIH
Trigger: ATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATTAGCTCACTTTCATTTAATCCATT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 90 bp CACAGTAGATTTAGCAAGTTGAGTTTCTCAGTTTTTATTCTATCTTaGGAGTGGGTTTATGAGGAGGAGAGATTGGACCTAAGGCCCCAT +
Preference number: 1 (lower is better)
Translates to: HSRFSKLSFSVFILS*EWVYEEERLDLRPH
Trigger: ATGGGGCCTTAGGTCCAATCTCTCCTCCTCATAAACCCACTCTCAAGATAGAATAAAAACTGAGAAACTCAACTTGCTAAATCTACTGTG
41% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 90 bp AGAACAGCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTaGAAACATCATTCCAAGTTAAACATCTGTCACCTAGCTTGGGCC +
Preference number: 1 (lower is better)
Translates to: RTASELFHPMLLSHD*KHHSKLNICHLAWA
Trigger: GGCCCAAGCTAGGTGACAGATGTTTAACTTGGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGCTGTTCT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR GCA 90 bp TTCCCTCCATTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTaGTTCCAAATAAAGTCTTTGCCAAATTCCATAGTTTTGCAGTCA +
Preference number: 1 (lower is better)
Translates to: FPPLSLQSYSVGFLP*FQIKSLPNSIVLQS
Trigger: TGACTGCAAAACTATGGAATTTGGCAAAGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAATGGAGGGAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CCA 90 bp GCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTaGCAAAACTCACCTCATATCTACTTGAGTTTATTAAGATTCCAA +
Preference number: 1 (lower is better)
Translates to: AFSDLPEVKHKVKRV*QNSPHIYLSLLRFQ
Trigger: TTGGAATCTTAATAAACTCAAGTAGATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 90 bp GATTGTTGCCCAGTGAAGTTGGTAGAAATTAGGATGAACTATGTATaGCATGGTGCTGTAAATTCTTCTACTTGTGGACTAATTTTGGTG +
Preference number: 1 (lower is better)
Translates to: DCCPVKLVEIRMNYV*HGAVNSSTCGLILV
Trigger: CACCAAAATTAGTCCACAAGTAGAAGAATTTACAGCACCATGTCATACATAGTTCATCCTAATTTCTACCAACTTCACTGGGCAACAATC
38% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACCAGACAAAAACAGGTaGTGGGGTGGCCGGGCACAA +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPPDKNR*WGGRAQ
Trigger: TTGTGCCCGGCCACCCCACCACCTGTTTTTGTCTGG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACTGAGGTCAGGAGTTTaGGACCAGCCTGGCCAAATG +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPLRSGV*DQPGQM
Trigger: CATTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 2 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAGCTCCCTCGTCTTGCTaGGCATTTTCTGACCTACCA +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPAPSSC*AFSDLP
Trigger: TGGTAGGTCAGAAAATGCTCAGCAAGACGAGGGAGC...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGCTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGA +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPTSRDI*KARSPR
Trigger: TCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAGCTCATGCACAAGCTaGGTCTTTCTGGTCTCCCTC +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPSSCTS*VFLVSL
Trigger: GAGGGAGACCAGAAAGACCCAGCTTGTGCATGAGCT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGCTGAGGTCAGGAGTTTaGGACCAGCCTGGCCAAATG +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRLRSGV*DQPGQM
Trigger: CATTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAG...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 2 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCGAGGAAGCTAGCACCTaGCATTTCTGGCCTGATCAC +
Preference number: 2 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSEEAST*HFWPDH
Trigger: GTGATCAGGCCAGAAATGGCAGGTGCTAGCTTCCTC...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGCTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 2 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGGTCAGGCAGATCACCTaGGGTCAGGAGTTTGAGACC +
Preference number: 2 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKVRQIT*GQEFET
Trigger: GGTCTCAAACTCCTGACCTCAGGTGATCTGCCTGAC...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCTGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 2 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCCTTTCAGAGGATGCTaGTACACAGGAGAAGGACCA +
Preference number: 2 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSPFRGC*YTGEGP
Trigger: TGGTCCTTCTCCTGTGTAGCAGCATCCTCTGAAAGG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGAGTTTGAGACCAGCCTaGCCAAATGGTGAAACTGCA +
Preference number: 2 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRSLRPA*PNGETA
Trigger: TGCAGTTTCACCATTTGGCCAGGCTGGTCTCAAACT...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGGGAAGAATAGTTCATTaGGAGACACCAGAGAAGAGG +
Preference number: 2 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRGRIVH*ETPEKR
Trigger: CCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCC...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 2 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAATGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 2 (lower is better)
Translates to: GTTRGLSENKSSDARRSQCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTCCAGGGTGCAGAGGTTaGAGTGAGCCAAGATCGCGC +
Preference number: 2 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAPGCRG*SEPRSR
Trigger: GCGCGATCTTGGCTCACTGCAACCTCTGCACCCTGG...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCGTAAAATCCAACAGATaGTCCCTCGTCTTGCTGAGC +
Preference number: 2 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSVKSNR*SLVLLS
Trigger: GCTCAGCAAGACGAGGGAGCATCTGTTGGATTTTAC...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGA +
Preference number: 2 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGTSRDI*KARSPR
Trigger: TCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAAGTTTGTCTGTAAATaGCTTTGTGGGCCATGCCGT +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPKFVCK*LCGPCR
Trigger: ACGGCATGGCCCACAAAGCCATTTACAGACAAACTT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 2 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 2 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAACCTGGTGGGCACAGTaGGGACTGTTCTGGAGAAAA +
Preference number: 2 (lower is better)
Translates to: GTTRGLSENKSSDARRSQTWWAQ*GLFWRK
Trigger: TTTTCTCCAGAACAGTCCTCACTGTGCCCACCAGGT...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 2 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 2 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGSFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 2 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTCTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 2 (lower is better)
Translates to: GSQIRKNSSLRDTREEEALSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGAAAGATTTAAGAGACTaGGTACCCACTTCAGAGGGT +
Preference number: 2 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRKDLRD*VPTSEG
Trigger: ACCCTCTGAAGTGGGTACCCAGTCTCTTAAATCTTT...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAATCACTATGTTTCTCTaGTCTGTGAGCTCCACAATG +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPITMFL*SVSSTM
Trigger: CATTGTGGAGCTCACAGACCAGAGAAACATAGTGAT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 2 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATACCTGGTGGGCACAGTaGGGACTGTTCTGGAGAAAA +
Preference number: 2 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYTWWAQ*GLFWRK
Trigger: TTTTCTCCAGAACAGTCCTCACTGTGCCCACCAGGT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCGGACACTATGTCACATaGACATGGGTCCTTTGCCAT +
Preference number: 2 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGGHYVT*TWVLCH
Trigger: ATGGCAAAGGACCCATGTGCATGTGACATAGTGTCC...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 2 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 2 (lower is better)
Translates to: HAILNPCSYTSSQALSLQKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTTGTGGGCCCAGTGAATaGCAGGATGGTGCAGATGGT +
Preference number: 2 (lower is better)
Translates to: GSQIRKNSSLRDTREEEACGPSE*QDGADG
Trigger: ACCATCTGCACCATCCTGCCATTCACTGGGCCCACA...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGTTTGTCTGTAAATaGCTTTGTGGGCCATGCCGT +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRKFVCK*LCGPCR
Trigger: ACGGCATGGCCCACAAAGCCATTTACAGACAAACTT...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGCATGGCACGCTAGGCTaGTGCTATCGTTGGAAGGGC +
Preference number: 2 (lower is better)
Translates to: ALVPELKQEISTKFPKYVHGTLG*CYRWKG
Trigger: GCCCTTCCAACGATAGCACCAGCCTAGCGTGCCATG...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
3UTR CAA 90 bp AACTTTCCCAAAGGGCAGGCTGCAGAGCAAGTTCAGATAAATCACTaGCTAGGTAAAATCCAACAGATGCTCCCTCGTCTTGCTGAGCAT +
Preference number: 2 (lower is better)
Translates to: NFPKGQAAEQVQINH*LGKIQQMLPRLAEH
Trigger: ATGCTCAGCAAGACGAGGGAGCATCTGTTGGATTTTACCTAGCAAGTGATTTATCTGAACTTGCTCTGCAGCCTGCCCTTTGGGAAAGTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACATCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 2 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 2 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 2 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCACCTTGAAGAAAGCATaGTCGATTCCAAACATCACT +
Preference number: 2 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSTLKKA*SIPNIT
Trigger: AGTGATGTTTGGAATCGATCATGCTTTCTTCAAGGT...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGTTAGACCTGTCACCTTaGAGAAAGCATGATCGATTC +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRLDLSP*RKHDRF
Trigger: GAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAA...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACTGCCATTTCTGGCCTaGTCACTATGTTTCTCTGGT +
Preference number: 2 (lower is better)
Translates to: GTTRGLSENKSSDARRSQLPFLA*SLCFSG
Trigger: ACCAGAGAAACATAGTGATCAGGCCAGAAATGGCAG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp GAACAGCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCCACCTAGCTTGGGCCTaGATCACCTGGCAGCATGCT +
Preference number: 2 (lower is better)
Translates to: EQPLNCSIQCYYHMTANIHLAWA*ITWQHA
Trigger: AGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTG...GATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGCTGTTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR CCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGATCACTATGTTTCTCTaGTCTGTGAGCTCCACAATG +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRITMFL*SVSSTM
Trigger: CATTGTGGAGCTCACAGACCAGAGAAACATAGTGAT...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 2 (lower is better)
Translates to: GTTRGLSENKSSDARRSQQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGATTCTTGCACTGTGCTaGACCAAGTTTATGAACTTC +
Preference number: 2 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRILALC*TKFMNF
Trigger: GAAGTTCATAAACTTGGTTCAGCACAGTGCAAGAAT...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 2 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAGATGAAATTGGTTCCTaGAGAAATTATTCTTGCACT +
Preference number: 2 (lower is better)
Translates to: TFKTVPADALLHGLLPNPDEIGS*RNYSCT
Trigger: AGTGCAAGAATAATTTCTGCAGGAACCAATTTCATC...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCAAACTGTCTATGAAATaGTTGCTTAGCCAAGGAGTA +
Preference number: 2 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSKLSMK*LLSQGV
Trigger: TACTCCTTGGCTAAGCAACCATTTCATAGACAGTTT...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAAGCACCTGCCATTTCTaGCCTGATCACTATGTTTCT +
Preference number: 2 (lower is better)
Translates to: GTTRGLSENKSSDARRSQSTCHF*PDHYVS
Trigger: AGAAACATAGTGATCAGGCCAGAAATGGCAGGTGCT...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCATCTGTCACCTAGCTTaGGCCTGCATCACCTGGCAG +
Preference number: 2 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSICHLA*ACITWQ
Trigger: CTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAGAT...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CAA 90 bp CTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTaGTCTCTCAGAAGCCAGTTACAGGTAAAAGCTAAGTCCAAGGTT +
Preference number: 2 (lower is better)
Translates to: LCSCNRCTRSERFSS*SLRSQLQVKAKSKV
Trigger: AACCTTGGACTTAGCTTTTACCTGTAACTGGCTTCTGAGAGACAAAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
3UTR-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 2 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACTTCACTTGGCTAACTaGTCCACAATTACCATAGAG +
Preference number: 2 (lower is better)
Translates to: GTTRGLSENKSSDARRSQLHLAN*STITIE
Trigger: CTCTATGGTAATTGTGGATCAGTTAGCCAAGTGAAG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 2 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 2 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 2 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGCAATATGAAAATGAATaGGTGTGGCTGGGTTCCAAT +
Preference number: 2 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKQYENE*VWLGSN
Trigger: ATTGGAACCCAGCCACACCCATTCATTTTCATATTG...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 90 bp ATGTCACATGCACATGGGTCCTTTGCCATGTCTGGGGAGGCTCTTTaGAAGGTGTTAGATGATGAAATTGGTTCCTGCAGAAATTATTCT +
Preference number: 2 (lower is better)
Translates to: MSHAHGSFAMSGEAL*KVLDDEIGSCRNYS
Trigger: AGAATAATTTCTGCAGGAACCAATTTCATCATCTAACACCTTCAAAAGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCATGTGACAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCTTCACTTGGCTAACTaGTCCACAATTACCATAGAG +
Preference number: 2 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYLHLAN*STITIE
Trigger: CTCTATGGTAATTGTGGATCAGTTAGCCAAGTGAAG...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTAGCACCTGCCATTTCTaGCCTGATCACTATGTTTCT +
Preference number: 2 (lower is better)
Translates to: GSQIRKNSSLRDTREEEASTCHF*PDHYVS
Trigger: AGAAACATAGTGATCAGGCCAGAAATGGCAGGTGCT...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 2 (lower is better)
Translates to: SEGEHTVGISIHSTVREQHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATATTCTTGCACTGTGCTaGACCAAGTTTATGAACTTC +
Preference number: 2 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYILALC*TKFMNF
Trigger: GAAGTTCATAAACTTGGTTCAGCACAGTGCAAGAAT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 2 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 2 (lower is better)
Translates to: NIQLEFPFTPQLENSRNEAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATAGTCCAAGGTTGTACATaGTTAGAGCAATGCAGGAAT +
Preference number: 2 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIIVQGCT*LEQCRN
Trigger: ATTCCTGCATTGCTCTAACCATGTACAACCTTGGAC...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
3UTR CAA 90 bp AAATTAAGTTACGGAAATAAGCAGGTTTTTCTTTCTGTGTTACAGTaGGACACTATGTCACATGCACATGGGTCCTTTGCCATGTCTGGG +
Preference number: 2 (lower is better)
Translates to: KLSYGNKQVFLSVLQ*DTMSHAHGSFAMSG
Trigger: CCCAGACATGGCAAAGGACCCATGTGCATGTGACATAGTGTCCAACTGTAACACAGAAAGAAAAACCTGCTTATTTCCGTAACTTAATTT
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 2 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 2 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAACATGGTTAGAGCAATaGAGGAATTCCATTTACAGG +
Preference number: 2 (lower is better)
Translates to: IVIVTSSATVSSTSAAVITWLEQ*RNSIYR
Trigger: CCTGTAAATGGAATTCCTGCATTGCTCTAACCATGT...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679162.1
3UTR-3UTR CCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCATGATTTGGTGGTGGTaGTATCGGAGTGAGTTTTCC +
Preference number: 2 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSMIWWW*YRSEFS
Trigger: GGAAAACTCACTCCGATACCACCACCACCAAATCAT...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR CCA 90 bp TGCATTTCATTGTTGTGTCTTTTCCTAGCCAGTAAGCCCATAAATAGTCACCAATCTATCATGATTTGGTaGTGGTGGTATCGGAGTGAG +
Preference number: 2 (lower is better)
Translates to: CISLLCLFLASKPINSHQSIMIW*WWYRSE
Trigger: CTCACTCCGATACCACCACCACCAAATCATGATAGA...TTGGTGACTATTTATGGGCTTACTGGCTAGGAAAAGACACAACAATGAAATGCA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CAA 90 bp GGACTAGTTTTACAATTACTTTGTACAATAAAGCAATCTGAGAATTaGCAATACATCACGAGACATTTGGAAGGCCAGGAGCCCCAGACA +
Preference number: 2 (lower is better)
Translates to: GLVLQLLCTIKQSEN*QYITRHLEGQEPQT
Trigger: TGTCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGTATTGCAAATTCTCAGATTGCTTTATTGTACAAAGTAATTGTAAAACTAGTCC
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCATCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 2 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 2 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCACACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 2 (lower is better)
Translates to: CRQITIVLELSYCEESMSHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTCACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 2 (lower is better)
Translates to: DSKHHCRQITIVLELSYCHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCATTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 2 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTTTAGGAATTTCCTACTaGAGGGCAGATCCATATGTA +
Preference number: 2 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSLGISY*RADPYV
Trigger: TACATATGGATCTGCCCTTCAGTAGGAAATTCCTAA...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR TCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTCATAAGAACAGCCTCTaGATTGTTCCATCCAATGTT +
Preference number: 2 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSHKNSL*IVPSNV
Trigger: AACATTGGATGGAACAATTCAGAGGCTGTTCTTATG...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR GCA 90 bp TCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATACACATGAACATTAAATGTCTCCTCTACCTCTaGAGCTGTAATAGGTGTACT +
Preference number: 2 (lower is better)
Translates to: SPYLGSSRLAEIIHMNIKCLLYL*SCNRCT
Trigger: AGTACACCTATTACAGCTGCAGAGGTAGAGGAGACA...TTTAATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
3UTR-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATATTGTAACATTATGCTaGTCACCACATAGAATGAGT +
Preference number: 2 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYIVTLC*SPHRMS
Trigger: ACTCATTCTATGTGGTGACCAGCATAATGTTACAAT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 90 bp ATTAGCTGTCATTCTTTCCTTACCATCAACATGGCCAAGACTGCTTaGTGGAAGTATCCTGGTGTTGAAATGAAACTCTATAGGACAAAA +
Preference number: 2 (lower is better)
Translates to: ISCHSFLTINMAKTA*WKYPGVEMKLYRTK
Trigger: TTTTGTCCTATAGAGTTTCATTTCAACACCAGGATACTTCCACAAAGCAGTCTTGGCCATGTTGATGGTAAGGAAAGAATGACAGCTAAT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTACATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 2 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTACACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 2 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCACAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 2 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR TCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCCCATATGTAGTTTTATaGCAGGGGAGAGATCTTGAT +
Preference number: 2 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSPYVVL*QGRDLD
Trigger: ATCAAGATCTCTCCCCTGTCATAAAACTACATATGG...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
39% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR GCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 2 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CCA 90 bp TCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATACACATGAACATTAAAGTCCAAGGTTGTACATaGTTAGAGCAATGCAGGAAT +
Preference number: 2 (lower is better)
Translates to: SPYLGSSRLAEIIHMNIKVQGCT*LEQCRN
Trigger: ATTCCTGCATTGCTCTAACCATGTACAACCTTGGAC...TTTAATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGA
39% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
3UTR CAA 90 bp AAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCTACTaGAGTTTATTAAGATTCCAACACAGTAGATTTAGCAAGTTGAGT +
Preference number: 2 (lower is better)
Translates to: KHKVKRVWQNSPHIY*SLLRFQHSRFSKLS
Trigger: ACTCAACTTGCTAAATCTACTGTGTTGGAATCTTAATAAACTCAAGTAGATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTT
37% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR GCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTAACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 2 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
37% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 72 bp ACCCTCTTTCTCAATGGACCCACAGTCCGATGGGGGTaGCAGCCTTTCCTGCACCAAAGACTGTTTCCCCAC +
Preference number: 3 (lower is better)
Translates to: TLFLNGPTVRWG*QPFLHQRLFPH
Trigger: GTGGGGAAACAGTCTTTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGTGGGTCCATTGAGAAAGAGGGT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 72 bp ACCCAAACCCTCTTTCTCAATGGACCCACAGTCCGATaGGGGTGCCAGCCTTTCCTGCACCAAAGACTGTTT +
Preference number: 3 (lower is better)
Translates to: TQTLFLNGPTVR*GCQPFLHQRLF
Trigger: AAACAGTCTTTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGTGGGTCCATTGAGAAAGAGGGTTTGGGT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 72 bp TTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATaGGCTCATGCACAAGCTGGGTCTTTCTGGTCTCCC +
Preference number: 3 (lower is better)
Translates to: FPAPKTVSPLRG*AHAQAGSFWSP
Trigger: GGGAGACCAGAAAGACCCAGCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTTGCCATTCTCAATCCTaGCAGCTACACCAGTTCCCA +
Preference number: 3 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSCHSQS*QLHQFP
Trigger: TGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACCCCTGGCTCTAGTTTaGTGTTGTCAGGGAGATGTT +
Preference number: 3 (lower is better)
Translates to: TFKTVPADALLHGLLPNPPLALV*CCQGDV
Trigger: AACATCTCCCTGACAACACAAAACTAGAGCCAGGGG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCATGCACATGGGTCCTTaGCCATGTCTGGGGAGGCTC +
Preference number: 3 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGMHMGP*PCLGRL
Trigger: GAGCCTCCCCAGACATGGCAAAGGACCCATGTGCAT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGTACATCACGAGACATTaGGAAGGCCAGGAGCCCCAG +
Preference number: 3 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKYITRH*EGQEPQ
Trigger: CTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGTA...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTGAAGATGCTCTCTCCTaGGCCATGTTGTCTTTGGAC +
Preference number: 3 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLEDALS*AMLSLD
Trigger: GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTC...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCTGCCATTCTCAATCCTaGCAGCTACACCAGTTCCCA +
Preference number: 3 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPCHSQS*QLHQFP
Trigger: TGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAATACATCACGAGACATTaGGAAGGCCAGGAGCCCCAG +
Preference number: 3 (lower is better)
Translates to: GTTRGLSENKSSDARRSQYITRH*EGQEPQ
Trigger: CTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGTA...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCCCATGGGCCATTGTTaGCCAGCTTCCATCCTAGGC +
Preference number: 3 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYPMGHC*PASILG
Trigger: GCCTAGGATGGAAGCTGGCAAACAATGGCCCATGGG...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAATGTGGTGGGCAGGATTaGGCCCATGGGCCATTGTTT +
Preference number: 3 (lower is better)
Translates to: GTTRGLSENKSSDARRSQCGGQD*AHGPLF
Trigger: AAACAATGGCCCATGGGCCAAATCCTGCCCACCACA...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAGGCAGGATAATCACTaGAACCCAGGGTGCAGAGGT +
Preference number: 3 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGRQDNH*NPGCRG
Trigger: ACCTCTGCACCCTGGGTTCAAGTGATTATCCTGCCT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 72 bp CATTCCAAGTTAAACATCTGTCACCTAGCTTGGGCCTaGATCACCTGGCAGCATGCTTTTGGGGAGGGATTT +
Preference number: 3 (lower is better)
Translates to: HSKLNICHLAWA*ITWQHAFGEGF
Trigger: AAATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAGATGTTTAACTTGGAATG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CCA 72 bp GAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTG +
Preference number: 3 (lower is better)
Translates to: ENSRNEFLSGML*EFTEAPGSSFV
Trigger: CACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCGAAGATGCTCTCTCCTaGGCCATGTTGTCTTTGGAC +
Preference number: 3 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGEDALS*AMLSLD
Trigger: GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTC...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGGAAGATGCTCTCTCCTaGGCCATGTTGTCTTTGGAC +
Preference number: 3 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQEDALS*AMLSLD
Trigger: GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTC...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTGCCATTCTCAATCCTaGCAGCTACACCAGTTCCCA +
Preference number: 3 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQCHSQS*QLHQFP
Trigger: TGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 72 bp ACAGTTGGACACTATGTCACATGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCTTTTGAAGGTGTTAGA +
Preference number: 3 (lower is better)
Translates to: TVGHYVTCTWVL*HVWGGSFEGVR
Trigger: TCTAACACCTTCAAAAGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCATGTGACATAGTGTCCAACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 72 bp CGTATAGCCCAGGGTTTGGCAAAGTTTGTCTGTAAATaGCTTTGTGGGCCATGCCGTCTCTACTTCAACTAC +
Preference number: 3 (lower is better)
Translates to: RIAQGLAKFVCK*LCGPCRLYFNY
Trigger: GTAGTTGAAGTAGAGACGGCATGGCCCACAAAGCCATTTACAGACAAACTTTGCCAAACCCTGGGCTATACG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGGTTGTCAGGGAGATGTaGATCAAGCACCTTGGAAGT +
Preference number: 3 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQVVREM*IKHLGS
Trigger: ACTTCCAAGGTGCTTGATCAACATCTCCCTGACAAC...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAACTTCATAAAGATCTaGTGGCAACTACAAAGGATG +
Preference number: 3 (lower is better)
Translates to: TFKTVPADALLHGLLPNPNFIKI*WQLQRM
Trigger: CATCCTTTGTAGTTGCCACAAGATCTTTATGAAGTT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAGGGTTTGGCAAAGTTaGTCTGTAAATGGCTTTGTG +
Preference number: 3 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRRVWQS*SVNGFV
Trigger: CACAAAGCCATTTACAGACAAACTTTGCCAAACCCT...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTCCACAATGGACCTTTaGCATTTGCAGTTTCATTTA +
Preference number: 3 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRSTMDL*HLQFHL
Trigger: TAAATGAAACTGCAAATGCAAAAGGTCCATTGTGGA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 72 bp GCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTaGTCCATCCATATTCCATACAAGATCCAACACTTG +
Preference number: 3 (lower is better)
Translates to: AATPVPRHCPYK*SIHIPYKIQHL
Trigger: CAAGTGTTGGATCTTGTATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 72 bp TTCTGTGTTACAGTTGGACACTATGTCACATGCACATaGGTCCTTTGCCATGTCTGGGGAGGCTCTTTTGAA +
Preference number: 3 (lower is better)
Translates to: FCVTVGHYVTCT*VLCHVWGGSFE
Trigger: TTCAAAAGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCATGTGACATAGTGTCCAACTGTAACACAGAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACGAAGATGCTCTCTCCTaGGCCATGTTGTCTTTGGAC +
Preference number: 3 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENEDALS*AMLSLD
Trigger: GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTC...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 72 bp AATGAAAGTGAGCTAATGCATGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAGGCACTGTCCTTACAA +
Preference number: 3 (lower is better)
Translates to: NESELMHAILNP*SYTSSQALSLQ
Trigger: TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATTAGCTCACTTTCATT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 72 bp AGCAATCTGAGAATTTGCAATACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGACACTCAGATGATAAC +
Preference number: 3 (lower is better)
Translates to: SNLRICNTSRDI*KARSPRHSDDN
Trigger: GTTATCATCTGAGTGTCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGTATTGCAAATTCTCAGATTGCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAAGGGTTTGGCAAAGTTaGTCTGTAAATGGCTTTGTG +
Preference number: 3 (lower is better)
Translates to: GTTRGLSENKSSDARRSQRVWQS*SVNGFV
Trigger: CACAAAGCCATTTACAGACAAACTTTGCCAAACCCT...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAGAAGATGCTCTCTCCTaGGCCATGTTGTCTTTGGAC +
Preference number: 3 (lower is better)
Translates to: CRQITIVLELSYCEESMSEDALS*AMLSLD
Trigger: GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTC...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGAACGTTTCTCCTCTTaGTCTCTCAGAAGCCAGTTA +
Preference number: 3 (lower is better)
Translates to: IVIVTSSATVSSTSAAVIERFSS*SLRSQL
Trigger: TAACTGGCTTCTGAGAGACAAAGAGGAGAAACGTTC...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
3UTR TCA 72 bp GAAAGTGGAGATTCTCATGTCTACATGTGTACTCAATaGACACATGTTACTCTGATTAGGTTTGTGGGCCCC +
Preference number: 3 (lower is better)
Translates to: ESGDSHVYMCTQ*THVTLIRFVGP
Trigger: GGGGCCCACAAACCTAATCAGAGTAACATGTGTTCATTGAGTACACATGTAGACATGAGAATCTCCACTTTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 72 bp AAGACACACATAGCTGTTTCTATCATGATTTGGTGGTaGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCT +
Preference number: 3 (lower is better)
Translates to: KTHIAVSIMIWW*WYRSEFSSTDS
Trigger: AGAATCAGTGCTGGAAAACTCACTCCGATACCACCACCACCAAATCATGATAGAAACAGCTATGTGTGTCTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR CAA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTACCCCTGGCTCTAGTTTaGTGTTGTCAGGGAGATGTT +
Preference number: 3 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLPLALV*CCQGDV
Trigger: AACATCTCCCTGACAACACAAAACTAGAGCCAGGGG...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 72 bp TCTTCTCTCTTTAGACCTGTCACCTTGAAGAAAGCATaGTCGATTCCAAACATCACTGTAGGCAAATCACCA +
Preference number: 3 (lower is better)
Translates to: SSLFRPVTLKKA*SIPNITVGKSP
Trigger: TGGTGATTTGCCTACAGTGATGTTTGGAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAAAGAGAGAAGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CCA 72 bp ACACACATAGCTGTTTCTATCATGATTTGGTGGTGGTaGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTA +
Preference number: 3 (lower is better)
Translates to: THIAVSIMIWWW*YRSEFSSTDSL
Trigger: TAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCACCACCAAATCATGATAGAAACAGCTATGTGTGT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CCA 72 bp AAAAAGACACACATAGCTGTTTCTATCATGATTTGGTaGTGGTGGTATCGGAGTGAGTTTTCCAGCACTGAT +
Preference number: 3 (lower is better)
Translates to: KKTHIAVSIMIW*WWYRSEFSSTD
Trigger: ATCAGTGCTGGAAAACTCACTCCGATACCACCACCACCAAATCATGATAGAAACAGCTATGTGTGTCTTTTT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR-3UTR CAA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCATGCCATTCTCAATCCTaGCAGCTACACCAGTTCCCA +
Preference number: 3 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSCHSQS*QLHQFP
Trigger: TGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATAGGGTGAACATACAGTaGGAATTTCCATTCACTCCA +
Preference number: 3 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDRVNIQ*EFPFTP
Trigger: TGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTTCCACAATGGACCTTTaGCATTTGCAGTTTCATTTA +
Preference number: 3 (lower is better)
Translates to: GSQIRKNSSLRDTREEEASTMDL*HLQFHL
Trigger: TAAATGAAACTGCAAATGCAAAAGGTCCATTGTGGA...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR-3UTR CAA 90 bp AAAGTATTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCGAACGTTTCTCCTCTTaGTCTCTCAGAAGCCAGTTA +
Preference number: 3 (lower is better)
Translates to: KVLFLIVIVTSSATVSSTERFSS*SLRSQL
Trigger: TAACTGGCTTCTGAGAGACAAAGAGGAGAAACGTTC...GGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAATACTTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
3UTR TCA 72 bp CAGAAATTCAACAGACATTTACATTTAGATTATCCCTaGACAGCCTGTGAGACCAAATACACACTTTCCCTA +
Preference number: 3 (lower is better)
Translates to: QKFNRHLHLDYP*TACETKYTLSL
Trigger: TAGGGAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATGTAAATGTCTGTTGAATTTCTG
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 72 bp CCAGTGAAGTTGGTAGAAATTAGGATGAACTATGTATaGCATGGTGCTGTAAATTCTTCTACTTGTGGACTA +
Preference number: 3 (lower is better)
Translates to: PVKLVEIRMNYV*HGAVNSSTCGL
Trigger: TAGTCCACAAGTAGAAGAATTTACAGCACCATGTCATACATAGTTCATCCTAATTTCTACCAACTTCACTGG
38% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR TCA 72 bp AAATTGGTTCCTGCAGAAATTATTCTTGCACTGTGCTaGACCAAGTTTATGAACTTCATAAAGATCTTGTGG +
Preference number: 3 (lower is better)
Translates to: KLVPAEIILALC*TKFMNFIKILW
Trigger: CCACAAGATCTTTATGAAGTTCATAAACTTGGTTCAGCACAGTGCAAGAATAATTTCTGCAGGAACCAATTT
36% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR GCA 72 bp TCTGAATTGTTCCATCCAATGTTATTATCACATGACTaGAAACATCATTCCAAGTTAAACATCTGTCACCTA +
Preference number: 3 (lower is better)
Translates to: SELFHPMLLSHD*KHHSKLNICHL
Trigger: TAGGTGACAGATGTTTAACTTGGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGA
35% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGTGCAGATTTAAGGCCTaGATGGCTGGAGTAGCAGGT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGCRFKA*MAGVAG
Trigger: ACCTGCTACTCCAGCCATTCAGGCCTTAAATCTGCA...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGGGACAGAGAGTGGGCTaGTACAGAGTTGTTTGTCAG +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGGQRVG*YRVVCQ
Trigger: CTGACAAACAACTCTGTATCAGCCCACTCTCTGTCC...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGSFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGCCTTTGAACTTGGGTTaGGCGCTCTCCTGTCACTTT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGPLNLG*ALSCHF
Trigger: AAAGTGACAGGAGAGCGCCCAACCCAAGTTCAAAGG...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGTTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTGAGGTCAGGAGTTTaGGACCAGCCTGGCCAAATG +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLALRSGV*DQPGQM
Trigger: CATTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAG...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGTGTTTCTCTGGTCTGTaGGCTCCACAATGGACCTTT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGCFSGL*APQWTF
Trigger: AAAGGTCCATTGTGGAGCTCACAGACCAGAGAAACA...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGTTGAGAGTGGGTTTATaGGGAGGAGAGATTGGACCT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGLRVGL*GGEIGP
Trigger: AGGTCCAATCTCTCCTCCTCATAAACCCACTCTCAA...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTTGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGGGACACTATGTCACATaGACATGGGTCCTTTGCCAT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGGHYVT*TWVLCH
Trigger: ATGGCAAAGGACCCATGTGCATGTGACATAGTGTCC...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCACCAGGGTGCAGAGGTTaGAGTGAGCCAAGATCGCGC +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPPGCRG*SEPRSR
Trigger: GCGCGATCTTGGCTCACTGCAACCTCTGCACCCTGG...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGCCAGGGTGCAGAGGTTaGAGTGAGCCAAGATCGCGC +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRPGCRG*SEPRSR
Trigger: GCGCGATCTTGGCTCACTGCAACCTCTGCACCCTGG...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGAACAGTACCTGCGGATaGCCTTCTTCACGGCCTGCT +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRNSTCG*PSSRPA
Trigger: AGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTT...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTCCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGIALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGIRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTGTGGGCCCAGTGAATaGCAGGATGGTGCAGATGGT +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRCGPSE*QDGADG
Trigger: ACCATCTGCACCATCCTGCCATTCACTGGGCCCACA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGTTTGAGACCAGCCTaGCCAAATGGTGAAACTGCA +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGSLRPA*PNGETA
Trigger: TGCAGTTTCACCATTTGGCCAGGCTGGTCTCAAACT...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 72 bp TGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTaGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGG +
Preference number: 4 (lower is better)
Translates to: CSGSSRRPLALV*CCQGDVDQAPW
Trigger: CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTTCCCCACTCAGAGGATaGGCTCATGCACAAGCTGGG +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPSPLRG*AHAQAG
Trigger: CCCAGCTTGTGCATGAGCTCATCCTCTGAGTGGGGA...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTTCCCCACTCAGAGGATaGGCTCATGCACAAGCTGGG +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLSPLRG*AHAQAG
Trigger: CCCAGCTTGTGCATGAGCTCATCCTCTGAGTGGGGA...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGGGCCTGGTCCACCATTaGATCAGTAACATCTATGTT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGGLVHH*ISNIYV
Trigger: AACATAGATGTTACTGATGCAATGGTGGACCAGGCC...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGTGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCCCAGGGTGCAGAGGTTaGAGTGAGCCAAGATCGCGC +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGPGCRG*SEPRSR
Trigger: GCGCGATCTTGGCTCACTGCAACCTCTGCACCCTGG...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAACAGTCCGATGGGGGTaGCAGCCTTTCCTGCACCAA +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPTVRWG*QPFLHQ
Trigger: TTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGT...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAACAGTCCGATGGGGGTaGCAGCCTTTCCTGCACCAA +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQTVRWG*QPFLHQ
Trigger: TTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGT...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGCCCTTCTTCACGGCCTaGTACCGAACCCACAGGTTT +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLPFFTA*YRTHRF
Trigger: AAACCTGTGGGTTCGGTAGCAGGCCGTGAAGAAGGG...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGTGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGCPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGTCCCCAACAGCTTCATaGAATCCTTCATTAGCTCCA +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGSPTAS*NPSLAP
Trigger: TGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGA...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGCTCATGCACAAGCTaGGTCTTTCTGGTCTCCCTC +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSSSCTS*VFLVSL
Trigger: GAGGGAGACCAGAAAGACCCAGCTTGTGCATGAGCT...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSTSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPTSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTCAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGIQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTGTCAGGCAGATCACCTaGGGTCAGGAGTTTGAGACC +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLVRQIT*GQEFET
Trigger: GGTCTCAAACTCCTGACCTCAGGTGATCTGCCTGAC...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ATATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: ISVGLKPVLITLLRQFKAMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...AGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGINMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSSFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPSFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCTGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTTGGCTTTGTGGGCCATaGCGTCTCTACTTCAACTAC +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAWLCGP*RLYFNY
Trigger: GTAGTTGAAGTAGAGACGGCATGGCCCACAAAGCCA...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCAGAGGATGAGCTCATaGACAAGCTGGGTCTTTCTG +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAQRMSS*TSWVFL
Trigger: CAGAAAGACCCAGCTTGTGCATGAGCTCATCCTCTG...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCCCTTCTTCACGGCCTaGTACCGAACCCACAGGTTT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPPFFTA*YRTHRF
Trigger: AAACCTGTGGGTTCGGTAGCAGGCCGTGAAGAAGGG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
52% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCCTGTTCCTCAATGGTaGACTGAGCAGCAGTTACAG +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAPVPQW*TEQQLQ
Trigger: CTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGG...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAAAGATTTAAGAGACTaGGTACCCACTTCAGAGGGT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGKDLRD*VPTSEG
Trigger: ACCCTCTGAAGTGGGTACCCAGTCTCTTAAATCTTT...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGA +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYTSRDI*KARSPR
Trigger: TCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGT...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCCCAGACAAAAACAGGTaGTGGGGTGGCCGGGCACAA +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGPDKNR*WGGRAQ
Trigger: TTGTGCCCGGCCACCCCACCACCTGTTTTTGTCTGG...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGCATGGCACGCTAGGCTaGTGCTATCGTTGGAAGGGC +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEHGTLG*CYRWKG
Trigger: GCCCTTCCAACGATAGCACCAGCCTAGCGTGCCATG...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCATTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTACCTGGTGGGCACAGTaGGGACTGTTCTGGAGAAAA +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSTWWAQ*GLFWRK
Trigger: TTTTCTCCAGAACAGTCCTCACTGTGCCCACCAGGT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGCTGAGGTCAGGAGTTTaGGACCAGCCTGGCCAAATG +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKLRSGV*DQPGQM
Trigger: CATTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAG...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCGTCAGGCAGATCACCTaGGGTCAGGAGTTTGAGACC +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGVRQIT*GQEFET
Trigger: GGTCTCAAACTCCTGACCTCAGGTGATCTGCCTGAC...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGGCTCCCTCGTCTTGCTaGGCATTTTCTGACCTACCA +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRAPSSC*AFSDLP
Trigger: TGGTAGGTCAGAAAATGCTCAGCAAGACGAGGGAGC...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAGCTCCCTCGTCTTGCTaGGCATTTTCTGACCTACCA +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPAPSSC*AFSDLP
Trigger: TGGTAGGTCAGAAAATGCTCAGCAAGACGAGGGAGC...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTGCAGATTTAAGGCCTaGATGGCTGGAGTAGCAGGT +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYCRFKA*MAGVAG
Trigger: ACCTGCTACTCCAGCCATTCAGGCCTTAAATCTGCA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: WGLNPSSSPYLGSSRLAEYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...CTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSLEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGIEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGAGGAAGCTAGCACCTaGCATTTCTGGCCTGATCAC +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSEEAST*HFWPDH
Trigger: GTGATCAGGCCAGAAATGGCAGGTGCTAGCTTCCTC...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAGAGGAAGCTAGCACCTaGCATTTCTGGCCTGATCAC +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPEEAST*HFWPDH
Trigger: GTGATCAGGCCAGAAATGGCAGGTGCTAGCTTCCTC...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCGAGGAAGCTAGCACCTaGCATTTCTGGCCTGATCAC +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPEEAST*HFWPDH
Trigger: GTGATCAGGCCAGAAATGGCAGGTGCTAGCTTCCTC...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGCCCTTCTTCACGGCCTaGTACCGAACCCACAGGTTT +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQPFFTA*YRTHRF
Trigger: AAACCTGTGGGTTCGGTAGCAGGCCGTGAAGAAGGG...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGAACAGTACCTGCGGATaGCCTTCTTCACGGCCTGCT +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQNSTCG*PSSRPA
Trigger: AGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTT...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGTCCCTCATTCCCCTCTaGCTCAGAGCTCTCCTCAAT +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRSLIPL*LRALLN
Trigger: ATTGAGGAGAGCTCTGAGGCAGAGGGGAATGAGGGA...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000677282.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPCASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRCASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGCCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCTGTGGGCCCAGTGAATaGCAGGATGGTGCAGATGGT +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGCGPSE*QDGADG
Trigger: ACCATCTGCACCATCCTGCCATTCACTGGGCCCACA...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAGTTTGAGACCAGCCTaGCCAAATGGTGAAACTGCA +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPSLRPA*PNGETA
Trigger: TGCAGTTTCACCATTTGGCCAGGCTGGTCTCAAACT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCAAGCTGGGTCTTTCTaGTCTCCCTCTCGAAGATTT +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAQAGSF*SPSRRF
Trigger: AAATCTTCGAGAGGGAGACCAGAAAGACCCAGCTTG...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTAGCTCATGCACAAGCTaGGTCTTTCTGGTCTCCCTC +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPSSCTS*VFLVSL
Trigger: GAGGGAGACCAGAAAGACCCAGCTTGTGCATGAGCT...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTTCCTCAATGGTGGACTaGGCAGCAGTTACAGCAACA +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPSSMVD*AAVTAT
Trigger: TGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGA...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTTCCTCAATGGTGGACTaGGCAGCAGTTACAGCAACA +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSSSMVD*AAVTAT
Trigger: TGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGA...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPTSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTCTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSLQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTTGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: QWGLNPSSSPYLGSSRLARAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...AGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAACCCACTTCAGAGGGTaGACATACAGTTGGAATTTC +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPTHFRG*TYSWNF
Trigger: GAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTACCCACTTCAGAGGGTaGACATACAGTTGGAATTTC +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLATHFRG*TYSWNF
Trigger: GAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTGTTTCTCTGGTCTGTaGGCTCCACAATGGACCTTT +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYCFSGL*APQWTF
Trigger: AAAGGTCCATTGTGGAGCTCACAGACCAGAGAAACA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCTGCCATTTCTGGCCTaGTCACTATGTTTCTCTGGT +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSLPFLA*SLCFSG
Trigger: ACCAGAGAAACATAGTGATCAGGCCAGAAATGGCAG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTATCATCTTAAATCCTTaGGTTTGGGGATCTGGGGCT +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSIILNP*VWGSGA
Trigger: AGCCCCAGATCCCCAAACTCAAGGATTTAAGATGAT...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGGATGAACTATGTATaGCATGGTGCTGTAAATTCT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGRMNYV*HGAVNS
Trigger: AGAATTTACAGCACCATGTCATACATAGTTCATCCT...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGGACAGAGAGTGGGCTaGTACAGAGTTGTTTGTCAG +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSGQRVG*YRVVCQ
Trigger: CTGACAAACAACTCTGTATCAGCCCACTCTCTGTCC...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTCCATATGTAGTTTTATaGCAGGGGAGAGATCTTGAT +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGIPYVVL*QGRDLD
Trigger: ATCAAGATCTCTCCCCTGTCATAAAACTACATATGG...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGCCAGGGTGCAGAGGTTaGAGTGAGCCAAGATCGCGC +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWPGCRG*SEPRSR
Trigger: GCGCGATCTTGGCTCACTGCAACCTCTGCACCCTGG...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTGGCTTTGTGGGCCATaGCGTCTCTACTTCAACTAC +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYWLCGP*RLYFNY
Trigger: GTAGTTGAAGTAGAGACGGCATGGCCCACAAAGCCA...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACGTAAAATCCAACAGATaGTCCCTCGTCTTGCTGAGC +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYVKSNR*SLVLLS
Trigger: GCTCAGCAAGACGAGGGAGCATCTGTTGGATTTTAC...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGTCCCAAAGGGCAGGCTaGAGAGCAAGTTCAGATAAA +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWSQRAG*RASSDK
Trigger: TTTATCTGAACTTGCTCTGCAGCCTGCCCTTTGGGA...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGACAGTCCGATGGGGGTaGCAGCCTTTCCTGCACCAA +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWETVRWG*QPFLHQ
Trigger: TTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGT...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRCPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPECASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATCAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: GMLWEFTEAPGSSFVLSGKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...CCCTGACAACACAAAACTAGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCCTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTGTCCTTTGCCATGTCTaGGGAGGCTCTTTTGAAGGT +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLVLCHV*GGSFEG
Trigger: ACCTTCAAAAGAGCCTCCCCAGACATGGCAAAGGAC...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTATGTCACATGCACATaGGTCCTTTGCCATGTCTGG +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYYVTCT*VLCHVW
Trigger: CCAGACATGGCAAAGGACCCATGTGCATGTGACATA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAGTTTGAGACCAGCCTaGCCAAATGGTGAAACTGCA +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYSLRPA*PNGETA
Trigger: TGCAGTTTCACCATTTGGCCAGGCTGGTCTCAAACT...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCTCCTCAATGGTGGACTaGGCAGCAGTTACAGCAACA +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGSSMVD*AAVTAT
Trigger: TGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGA...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCTCCTCAATGGTGGACTaGGCAGCAGTTACAGCAACA +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSSSMVD*AAVTAT
Trigger: TGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGA...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR TCA 90 bp CAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: QWGLNPSSSPYLGSSRLAGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...AGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPETSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGCTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWLQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGTGGAGACATTGTAAAAGGGTGTCCAGGTGAGAACAGCACAAGCAAAGGTGTGTGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: SGDIVKGCPGENSTSKGVCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...CACACCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTTACAATGTCTCCACT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTATGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: YQWGLNPSSSPYLGSSRLCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...TAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGCAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTAGCATATGCAACAGATaGTCGGAACAGGTACATTTC +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLASICNR*SEQVHF
Trigger: GAAATGTACCTGTTCCGATCATCTGTTGCATATGCT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGACCCACTTCAGAGGGTaGACATACAGTTGGAATTTC +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLTHFRG*TYSWNF
Trigger: GAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTTCTCTTATCAGCCTTTaGACTTGGGTTGGGCGCTAT +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLSLISL*TWVGRY
Trigger: ATAGCGCCCAACCCAAGTTCAAAGGCTGATAAGAGA...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000427411.2
CDS-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACTTCACTTGGCTAACTaGTCCACAATTACCATAGAG +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPLHLAN*STITIE
Trigger: CTCTATGGTAATTGTGGATCAGTTAGCCAAGTGAAG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGCTGCCATTTCTGGCCTaGTCACTATGTTTCTCTGGT +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRLPFLA*SLCFSG
Trigger: ACCAGAGAAACATAGTGATCAGGCCAGAAATGGCAG...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGCCATTTCTGGCCTaGTCACTATGTTTCTCTGGT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPLPFLA*SLCFSG
Trigger: ACCAGAGAAACATAGTGATCAGGCCAGAAATGGCAG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTCTGCCATTTCTGGCCTaGTCACTATGTTTCTCTGGT +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSLPFLA*SLCFSG
Trigger: ACCAGAGAAACATAGTGATCAGGCCAGAAATGGCAG...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCGGAAGAATAGTTCATTaGGAGACACCAGAGAAGAGG +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSGRIVH*ETPEKR
Trigger: CCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCC...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTTTGCTGAGCATTTTCTaGCCTACCAGAAGTCAAACA +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLALLSIF*PTRSQT
Trigger: TGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGCAA...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGCTCCCTCGTCTTGCTaGGCATTTTCTGACCTACCA +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTAPSSC*AFSDLP
Trigger: TGGTAGGTCAGAAAATGCTCAGCAAGACGAGGGAGC...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACTCCCCACTCAGAGGATaGGCTCATGCACAAGCTGGG +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENSPLRG*AHAQAG
Trigger: CCCAGCTTGTGCATGAGCTCATCCTCTGAGTGGGGA...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTAGGGCACCATTACAATaGAGAGACACCCCAATTAAA +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLARAPLQ*RDTPIK
Trigger: TTTAATTGGGGTGTCTCTTCATTGTAATGGTGCCCT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGTCTCTTATCAGCCTTTaGACTTGGGTTGGGCGCTTT +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRSLISL*TWVGRF
Trigger: AAAGCGCCCAACCCAAGTTCAAAGGCTGATAAGAGA...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678073.1
CDS-3UTR GCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATAATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIIMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGGCATTCATCAACTTTaGCCTCACATAGGCATGAAG +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLGIHQL*PHIGMK
Trigger: CTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCC...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGCTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQLEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCCCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKSFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGCAGGTATCTAAGAAATaGTGTGCTCACACTGGGGTA +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWQVSKK*CAHTGV
Trigger: TACCCCAGTGTGAGCACAGCATTTCTTAGATACCTG...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCAGGTATCTAAGAAATaGTGTGCTCACACTGGGGTA +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSQVSKK*CAHTGV
Trigger: TACCCCAGTGTGAGCACAGCATTTCTTAGATACCTG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAGAGGAAGCTAGCACCTaGCATTTCTGGCCTGATCAC +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQEEAST*HFWPDH
Trigger: GTGATCAGGCCAGAAATGGCAGGTGCTAGCTTCCTC...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGTAAAATCCAACAGATaGTCCCTCGTCTTGCTGAGC +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSVKSNR*SLVLLS
Trigger: GCTCAGCAAGACGAGGGAGCATCTGTTGGATTTTAC...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTTCCCAAAGGGCAGGCTaGAGAGCAAGTTCAGATAAA +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPSQRAG*RASSDK
Trigger: TTTATCTGAACTTGCTCTGCAGCCTGCCCTTTGGGA...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACTTAAACCAAGTGTCTaGCTACACTCTTTTGGCAGT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPLKPSV*LHSFGS
Trigger: ACTGCCAAAAGAGTGTAGGCAGACACTTGGTTTAAG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCCCCTTCTTCACGGCCTaGTACCGAACCCACAGGTTT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFPFFTA*YRTHRF
Trigger: AAACCTGTGGGTTCGGTAGCAGGCCGTGAAGAAGGG...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCAACAGTACCTGCGGATaGCCTTCTTCACGGCCTGCT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFNSTCG*PSSRPA
Trigger: AGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTT...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLCASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACCTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCCTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTCCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTCCCCAACAGCTTCATaGAATCCTTCATTAGCTCCA +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASSPTAS*NPSLAP
Trigger: TGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGA...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTACAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: YQWGLNPSSSPYLGSSRLQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...TAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CTGTCACCTAGCTTGGGCCTGCATCACCTGGCAGCATGCTTTTGGGGAGGGATTAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: LSPSLGLHHLAACFWGGIKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...AATCCCTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR CCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: QWGLNPSSSPYLGSSRLALTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...AGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAATGCTGTGCTCACACTaGGGTAGTGACTGTGAGAAA +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQMLCSH*GSDCEK
Trigger: TTTCTCACAGTCACTACCCCAGTGTGAGCACAGCAT...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTTATGTCACATGCACATaGGTCCTTTGCCATGTCTGG +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLYVTCT*VLCHVW
Trigger: CCAGACATGGCAAAGGACCCATGTGCATGTGACATA...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCTATGTCACATGCACATaGGTCCTTTGCCATGTCTGG +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPYVTCT*VLCHVW
Trigger: CCAGACATGGCAAAGGACCCATGTGCATGTGACATA...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATATGTCACATGCACATaGGTCCTTTGCCATGTCTGG +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPYVTCT*VLCHVW
Trigger: CCAGACATGGCAAAGGACCCATGTGCATGTGACATA...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGCCAGACAAAAACAGGTaGTGGGGTGGCCGGGCACAA +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQPDKNR*WGGRAQ
Trigger: TTGTGCCCGGCCACCCCACCACCTGTTTTTGTCTGG...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTATCACTATGTTTCTCTaGTCTGTGAGCTCCACAATG +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAITMFL*SVSSTM
Trigger: CATTGTGGAGCTCACAGACCAGAGAAACATAGTGAT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAGCACCTGCCATTTCTaGCCTGATCACTATGTTTCT +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYSTCHF*PDHYVS
Trigger: AGAAACATAGTGATCAGGCCAGAAATGGCAGGTGCT...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCAAGCTGGGTCTTTCTaGTCTCCCTCTCGAAGATTT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPQAGSF*SPSRRF
Trigger: AAATCTTCGAGAGGGAGACCAGAAAGACCCAGCTTG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGCAAAGGGACAGAGAGTaGGCTGATACAGAGTTGTTT +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLQRDRE*ADTELF
Trigger: AAACAACTCTGTATCAGCCCACTCTCTGTCCCTTTG...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAACTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQLQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATATGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSICGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCATTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGAGCATATGCAACAGATaGTCGGAACAGGTACATTTC +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLSICNR*SEQVHF
Trigger: GAAATGTACCTGTTCCGATCATCTGTTGCATATGCT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGACCTTGAAGAAAGCATaGTCGATTCCAAACATCACT +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRTLKKA*SIPNIT
Trigger: AGTGATGTTTGGAATCGATCATGCTTTCTTCAAGGT...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTTAGACCTGTCACCTTaGAGAAAGCATGATCGATTC +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYLDLSP*RKHDRF
Trigger: GAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGTTAGACCTGTCACCTTaGAGAAAGCATGATCGATTC +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLLDLSP*RKHDRF
Trigger: GAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAA...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCTTCACTTGGCTAACTaGTCCACAATTACCATAGAG +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSLHLAN*STITIE
Trigger: CTCTATGGTAATTGTGGATCAGTTAGCCAAGTGAAG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGCTTCACTTGGCTAACTaGTCCACAATTACCATAGAG +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWLHLAN*STITIE
Trigger: CTCTATGGTAATTGTGGATCAGTTAGCCAAGTGAAG...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGGATGGTGCAGATGGTaGTGCGAAATGTTGATTGTA +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSGWCRW*CEMLIV
Trigger: TACAATCAACATTTCGCATCACCATCTGCACCATCC...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACACCTGGTGGGCACAGTaGGGACTGTTCTGGAGAAAA +
Preference number: 4 (lower is better)
Translates to: TESNVNEDALSLAMLSLDTWWAQ*GLFWRK
Trigger: TTTTCTCCAGAACAGTCCTCACTGTGCCCACCAGGT...GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTGTCAGGCAGATCACCTaGGGTCAGGAGTTTGAGACC +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAVRQIT*GQEFET
Trigger: GGTCTCAAACTCCTGACCTCAGGTGATCTGCCTGAC...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCGGAAGAATAGTTCATTaGGAGACACCAGAGAAGAGG +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPGRIVH*ETPEKR
Trigger: CCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCC...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAGGACAGAGAGTGGGCTaGTACAGAGTTGTTTGTCAG +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIGQRVG*YRVVCQ
Trigger: CTGACAAACAACTCTGTATCAGCCCACTCTCTGTCC...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACTTGTGTTCAACCGTTTaGTCTTGTCTTCTGAGAGCA +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYLCSTV*SCLLRA
Trigger: TGCTCTCAGAAGACAAGAGCAAACGGTTGAACACAA...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGGGGAGATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: FRNFLLKGRSICSFMTGEMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...CTCCCCTGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGGCATTCATCAACTTTaGCCTCACATAGGCATGAAG +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQGIHQL*PHIGMK
Trigger: CTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCC...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCGGCATTCATCAACTTTaGCCTCACATAGGCATGAAG +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPGIHQL*PHIGMK
Trigger: CTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCC...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATACTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSILEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTAGGTTGTGCAGCATATaGCATATCATACTGGATATG +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLARLCSI*HIILDM
Trigger: CATATCCAGTATGATATGGCATATGCTGCACAACCT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTCCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCACCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQNMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAAATTATATTGTATGTTaGCCCAAGCTGTGGGCCCAG +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPNYIVC*PKLWAQ
Trigger: CTGGGCCCACAGCTTGGGGCAACATACAATATAATT...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTGCACATGGGTCCTTTaGCATGTCTGGGGAGGCTCT +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQCTWVL*HVWGGS
Trigger: AGAGCCTCCCCAGACATGGCAAAGGACCCATGTGCA...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACCTTTCAGAGGATGCTaGTACACAGGAGAAGGACCA +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQPFRGC*YTGEGP
Trigger: TGGTCCTTCTCCTGTGTAGCAGCATCCTCTGAAAGG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATATGGCTTTGTGGGCCATaGCGTCTCTACTTCAACTAC +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIWLCGP*RLYFNY
Trigger: GTAGTTGAAGTAGAGACGGCATGGCCCACAAAGCCA...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCGTAAAATCCAACAGATaGTCCCTCGTCTTGCTGAGC +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGVKSNR*SLVLLS
Trigger: GCTCAGCAAGACGAGGGAGCATCTGTTGGATTTTAC...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGTCCCAAAGGGCAGGCTaGAGAGCAAGTTCAGATAAA +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKSQRAG*RASSDK
Trigger: TTTATCTGAACTTGCTCTGCAGCCTGCCCTTTGGGA...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCTCCCAAAGGGCAGGCTaGAGAGCAAGTTCAGATAAA +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGSQRAG*RASSDK
Trigger: TTTATCTGAACTTGCTCTGCAGCCTGCCCTTTGGGA...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACAGAGGATGAGCTCATaGACAAGCTGGGTCTTTCTG +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTQRMSS*TSWVFL
Trigger: CAGAAAGACCCAGCTTGTGCATGAGCTCATCCTCTG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAACAGTCCGATGGGGGTaGCAGCCTTTCCTGCACCAA +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRTVRWG*QPFLHQ
Trigger: TTGGTGCAGGAAAGGCTGGCACCCCCATCGGACTGT...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCACCAATTAAACCCTGCTaGTATTTTCCAGAGATCAGT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPPIKPC*YFPEIS
Trigger: ACTGATCTCTGGAAAATAGCAGCAGGGTTTAATTGG...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCCAATTAAACCCTGCTaGTATTTTCCAGAGATCAGT +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAPIKPC*YFPEIS
Trigger: ACTGATCTCTGGAAAATAGCAGCAGGGTTTAATTGG...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACCTGTTCCTCAATGGTaGACTGAGCAGCAGTTACAG +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTPVPQW*TEQQLQ
Trigger: CTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLATFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTTGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSCSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCAGGGAGGCATCCAATTaGACTGATATAGGAAGGATA +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASREASN*TDIGRI
Trigger: TATCCTTCCTATATCAGTCCAATTGGATGCCTCCCT...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYCASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGCCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGCCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATACCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: IVIVTSSATVSSTSAAVIPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCCCAACAGCTTCATaGAATCCTTCATTAGCTCCA +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYSPTAS*NPSLAP
Trigger: TGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGA...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTCAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGACTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYTSRDI*KARSPR
Trigger: TCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAGTCCTTTGCCATGTCTaGGGAGGCTCTTTTGAAGGT +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIVLCHV*GGSFEG
Trigger: ACCTTCAAAAGAGCCTCCCCAGACATGGCAAAGGAC...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGTTTCTGTGTTACAGTTaGACACTATGTCACATGCAC +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRFLCYS*TLCHMH
Trigger: GTGCATGTGACATAGTGTCCAACTGTAACACAGAAA...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGACCAGACAAAAACAGGTaGTGGGGTGGCCGGGCACAA +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRPDKNR*WGGRAQ
Trigger: TTGTGCCCGGCCACCCCACCACCTGTTTTTGTCTGG...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTAAGTTTGTCTGTAAATaGCTTTGTGGGCCATGCCGT +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPKFVCK*LCGPCR
Trigger: ACGGCATGGCCCACAAAGCCATTTACAGACAAACTT...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATAAGTTTGTCTGTAAATaGCTTTGTGGGCCATGCCGT +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYKFVCK*LCGPCR
Trigger: ACGGCATGGCCCACAAAGCCATTTACAGACAAACTT...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCATCACTATGTTTCTCTaGTCTGTGAGCTCCACAATG +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSITMFL*SVSSTM
Trigger: CATTGTGGAGCTCACAGACCAGAGAAACATAGTGAT...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCAGCTCATGCACAAGCTaGGTCTTTCTGGTCTCCCTC +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFSSCTS*VFLVSL
Trigger: GAGGGAGACCAGAAAGACCCAGCTTGTGCATGAGCT...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTCCAAATCTCAAGACCTaGATACAAAATGTAGAGCTG +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSPNLKT*IQNVEL
Trigger: CAGCTCTACATTTTGTATCCAGGTCTTGAGATTTGG...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGTCCTCAATGGTGGACTaGGCAGCAGTTACAGCAACA +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKSSMVD*AAVTAT
Trigger: TGTTGCTGTAACTGCTGCTCAGTCCACCATTGAGGA...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGATTCCAAGAAGCAAGTaGACTTTGATAGAACAGGTC +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLIPRSK*TLIEQV
Trigger: GACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAAT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp AGAGCAATGCAGGAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: RAMQEFHLQAPNGFLAHVISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...CACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTCCTGCATTGCTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR TCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLTSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGTGGAGACATTGTAAAAGGGTGTCCAGGTGAGAACAGCACAAGCAAAGGTGTGGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: SGDIVKGCPGENSTSKGVGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...CACACCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTTACAATGTCTCCACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR TCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAAGCATATGCAACAGATaGTCGGAACAGGTACATTTC +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPSICNR*SEQVHF
Trigger: GAAATGTACCTGTTCCGATCATCTGTTGCATATGCT...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: ALVPELKQEISTKFPKYVDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCACATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTCACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGACCTTGAAGAAAGCATaGTCGATTCCAAACATCACT +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLTLKKA*SIPNIT
Trigger: AGTGATGTTTGGAATCGATCATGCTTTCTTCAAGGT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCACCCACTTCAGAGGGTaGACATACAGTTGGAATTTC +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGTHFRG*TYSWNF
Trigger: GAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAACAAGATCACATCCACTaGATGACTTTCCCTAGACTA +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQQDHIH*MTFPRL
Trigger: TAGTCTAGGGAAAGTCATTCAGTGGATGTGATCTTG...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTTTGGTTCCTAACCTaGTGGTGTATACACTCTGTA +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQVWFLT*WCIHSV
Trigger: TACAGAGTGTATACACCATCAGGTTAGGAACCAAAC...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGTTTGGTTCCTAACCTaGTGGTGTATACACTCTGTA +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPVWFLT*WCIHSV
Trigger: TACAGAGTGTATACACCATCAGGTTAGGAACCAAAC...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGAGGAGAGATTGGACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGATTTCAACACAGAATTaGCACTCGTTAACAGTCTTC +
Preference number: 4 (lower is better)
Translates to: GGEIGPKAPSLPKCGGRRISTQN*HSLTVF
Trigger: GAAGACTGTTAACGAGTGTCAATTCTGTGTTGAAAT...CCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTCCAATCTCTCCTCC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTAGGGCACCATTACAATaGAGAGACACCCCAATTAAA +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSRAPLQ*RDTPIK
Trigger: TTTAATTGGGGTGTCTCTTCATTGTAATGGTGCCCT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCATCATCTTAAATCCTTaGGTTTGGGGATCTGGGGCT +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGIILNP*VWGSGA
Trigger: AGCCCCAGATCCCCAAACTCAAGGATTTAAGATGAT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAGGATGAACTATGTATaGCATGGTGCTGTAAATTCT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPRMNYV*HGAVNS
Trigger: AGAATTTACAGCACCATGTCATACATAGTTCATCCT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATAGTTTCCTGGCTCATGTaGGAGAAGTCAGCGTCAGCA +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIIVSWLM*EKSASA
Trigger: TGCTGACGCTGACTTCTCTCACATGAGCCAGGAAAC...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR GCA 90 bp ACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: TESNVNEDALSLAMLSLDYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGTGGAGACATTGTAAAAGGGTGTCCAGGTGAGAACAGCACAAGCAAAGGTGTGGGCCTGGTCCACCATTaGATCAGTAACATCTATGTT +
Preference number: 4 (lower is better)
Translates to: SGDIVKGCPGENSTSKGVGLVHH*ISNIYV
Trigger: AACATAGATGTTACTGATGCAATGGTGGACCAGGCC...CACACCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTTACAATGTCTCCACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCGGCCTGGTCCACCATTaGATCAGTAACATCTATGTT +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGGLVHH*ISNIYV
Trigger: AACATAGATGTTACTGATGCAATGGTGGACCAGGCC...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGGCCTGGTCCACCATTaGATCAGTAACATCTATGTT +
Preference number: 4 (lower is better)
Translates to: YQWGLNPSSSPYLGSSRLGLVHH*ISNIYV
Trigger: AACATAGATGTTACTGATGCAATGGTGGACCAGGCC...TAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTCTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGLEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGAGGTTGTGCAGCATATaGCATATCATACTGGATATG +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWRLCSI*HIILDM
Trigger: CATATCCAGTATGATATGGCATATGCTGCACAACCT...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGCCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPEPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp AGAGCAATGCAGGAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGCCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: RAMQEFHLQAPNGFLAHVPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...CACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTCCTGCATTGCTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 4 (lower is better)
Translates to: TESNVNEDALSLAMLSLDAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWESFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGCAGGTATCTAAGAAATaGTGTGCTCACACTGGGGTA +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKQVSKK*CAHTGV
Trigger: TACCCCAGTGTGAGCACAGCATTTCTTAGATACCTG...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAGTCATTGTAACATTATaGTGGTCACCACATAGAATG +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPVIVTL*WSPHRM
Trigger: CATTCTATGTGGTGACCAGCATAATGTTACAATGAC...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAGGACACTATGTCACATaGACATGGGTCCTTTGCCAT +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIGHYVT*TWVLCH
Trigger: ATGGCAAAGGACCCATGTGCATGTGACATAGTGTCC...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCCTTTCAGAGGATGCTaGTACACAGGAGAAGGACCA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYPFRGC*YTGEGP
Trigger: TGGTCCTTCTCCTGTGTAGCAGCATCCTCTGAAAGG...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCCAGAGGATGAGCTCATaGACAAGCTGGGTCTTTCTG +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFQRMSS*TSWVFL
Trigger: CAGAAAGACCCAGCTTGTGCATGAGCTCATCCTCTG...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATACCCCAATTAAACCCTaGTGCTATTTTCCAGAGATC +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYTPIKP*CYFPEI
Trigger: GATCTCTGGAAAATAGCAGCAGGGTTTAATTGGGGT...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGTGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPECPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp AGAGCAATGCAGGAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGTGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: RAMQEFHLQAPNGFLAHVCPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...CACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTCCTGCATTGCTCT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR CCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLTFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTATGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: YQWGLNPSSSPYLGSSRLCSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...TAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTAGGGAGGCATCCAATTaGACTGATATAGGAAGGATA +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLREASN*TDIGRI
Trigger: TATCCTTCCTATATCAGTCCAATTGGATGCCTCCCT...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTAGTAACATCTATGTTTaGTTTCTGTCCAAAGGGAAC +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLASNIYV*FLSKGN
Trigger: GTTCCCTTTGGACAGAAACCAAACATAGATGTTACT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWCASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATATGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: IVIVTSSATVSSTSAAVICASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp AGTGGAGACATTGTAAAAGGGTGTCCAGGTGAGAACAGCACAAGCAAAGGTGTGCTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: SGDIVKGCPGENSTSKGVLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...CACACCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTTACAATGTCTCCACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp ACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACCAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: TESNVNEDALSLAMLSLDQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGCAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp GTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: VEMSFYQACSGSSRRPLAKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...AGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGTGGAGACATTGTAAAAGGGTGTCCAGGTGAGAACAGCACAAGCAAAGGTGTGCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: SGDIVKGCPGENSTSKGVLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...CACACCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTTACAATGTCTCCACT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGGTCCTTTGCCATGTCTaGGGAGGCTCTTTTGAAGGT +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEVLCHV*GGSFEG
Trigger: ACCTTCAAAAGAGCCTCCCCAGACATGGCAAAGGAC...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCCAATATGAAAATGAATaGGTGTGGCTGGGTTCCAAT +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSQYENE*VWLGSN
Trigger: ATTGGAACCCAGCCACACCCATTCATTTTCATATTG...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATACAAGCTGGGTCTTTCTaGTCTCCCTCTCGAAGATTT +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIQAGSF*SPSRRF
Trigger: AAATCTTCGAGAGGGAGACCAGAAAGACCCAGCTTG...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGCACAAGCCTGCAACCTaGGAATTACTATTCTACTTT +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWHKPAT*ELLFYF
Trigger: AAAGTAGAATAGTAATTCCCAGGTTGCAGGCTTGTG...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000677282.1
CDS-3UTR CCA 90 bp TGCATTTCATTGTTGTGTCTTTTCCTAGCCAGTAAGCCCATAAATAGTCACCAATGGGCCTGCATCACCTaGCAGCATGCTTTTGGGGAG +
Preference number: 4 (lower is better)
Translates to: CISLLCLFLASKPINSHQWACIT*QHAFGE
Trigger: CTCCCCAAAAGCATGCTGCCAGGTGATGCAGGCCCA...TTGGTGACTATTTATGGGCTTACTGGCTAGGAAAAGACACAACAATGAAATGCA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTATCTGTCACCTAGCTTaGGCCTGCATCACCTGGCAG +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSICHLA*ACITWQ
Trigger: CTGCCAGGTGATGCAGGCCCAAGCTAGGTGACAGAT...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGTCCAAGGTTGTACATGGTTAGAGCAATGCAGGAATTCCATTTACAGGCCCCTGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: SPRLYMVRAMQEFHLQAPGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...AGGGGCCTGTAAATGGAATTCCTGCATTGCTCTAACCATGTACAACCTTGGACT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR TCA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: IVIVTSSATVSSTSAAVITSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
46% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AATGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: NACHSQSLQLHQFPGTVLFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...AAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCATT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR TCA 90 bp ATATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: ISVGLKPVLITLLRQFKASFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...AGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATAT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATACAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTCTCTCAGAAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: CSCNRCTRSERFSSLSLRRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...TCTGAGAGACAAAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCTTAGACCTGTCACCTTaGAGAAAGCATGATCGATTC +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGLDLSP*RKHDRF
Trigger: GAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAA...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCTTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGACTAAAACCTCCTCATaGGATTTTCTCTCTTATCAG +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLTKTSS*DFLSYQ
Trigger: CTGATAAGAGAGAAAATCTCATGAGGAGGTTTTAGT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGCAAGATCACATCCACTaGATGACTTTCCCTAGACTA +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQQDHIH*MTFPRL
Trigger: TAGTCTAGGGAAAGTCATTCAGTGGATGTGATCTTG...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCATTCTTGCACTGTGCTaGACCAAGTTTATGAACTTC +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPILALC*TKFMNF
Trigger: GAAGTTCATAAACTTGGTTCAGCACAGTGCAAGAAT...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCTGAGGTCAGGAGTTTaGGACCAGCCTGGCCAAATG +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDLRSGV*DQPGQM
Trigger: CATTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATGTCAGGCAGATCACCTaGGGTCAGGAGTTTGAGACC +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDVRQIT*GQEFET
Trigger: GGTCTCAAACTCCTGACCTCAGGTGATCTGCCTGAC...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTGAGAGTGGGTTTATaGGGAGGAGAGATTGGACCT +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWELRVGL*GGEIGP
Trigger: AGGTCCAATCTCTCCTCCTCATAAACCCACTCTCAA...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCTTGAGAGTGGGTTTATaGGGAGGAGAGATTGGACCT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFLRVGL*GGEIGP
Trigger: AGGTCCAATCTCTCCTCCTCATAAACCCACTCTCAA...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTCCCCACTCAGAGGATaGGCTCATGCACAAGCTGGG +
Preference number: 4 (lower is better)
Translates to: NIQLEFPFTPQLENSRNESPLRG*AHAQAG
Trigger: CCCAGCTTGTGCATGAGCTCATCCTCTGAGTGGGGA...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGGTAGCAGGTGTTACCTaGACATTTGTGAACATTTTA +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWVAGVT*TFVNIL
Trigger: TAAAATGTTCACAAATGTTCAGGTAACACCTGCTAC...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAAAAAAGGGTGTCCAGGTaGGAACAGCACAAGCAAAGG +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKKRVSR*EQHKQR
Trigger: CCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTT...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
46% GC, longest homopolymer 8 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTAATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: NIQLEFPFTPQLENSRNEMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATATATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIIYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGCTCTGTCCTCATAATGATTTaGTCTTGCCATCTCATTTTT +
Preference number: 4 (lower is better)
Translates to: RNEFLSGMLWEFTEAPGSVLIMI*SCHLIF
Trigger: AAAAATGAGATGGCAAGAGCAAATCATTATGAGGAC...AGAGCCAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAGTCCTCATAATGATTTaGTCTTGCCATCTCATTTTT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPVLIMI*SCHLIF
Trigger: AAAAATGAGATGGCAAGAGCAAATCATTATGAGGAC...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATACTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIILEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTAGGTTGTGCAGCATATaGCATATCATACTGGATATG +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSRLCSI*HIILDM
Trigger: CATATCCAGTATGATATGGCATATGCTGCACAACCT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATAGGTTGTGCAGCATATaGCATATCATACTGGATATG +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYRLCSI*HIILDM
Trigger: CATATCCAGTATGATATGGCATATGCTGCACAACCT...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQNMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLNMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR GCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACGCCATTCTCAATCCTTaGAGCTACACCAGTTCCCAG +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENAILNP*SYTSSQ
Trigger: CTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGC...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGGTCATTGTAACATTATaGTGGTCACCACATAGAATG +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLVIVTL*WSPHRM
Trigger: CATTCTATGTGGTGACCAGCATAATGTTACAATGAC...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAAATTATATTGTATGTTaGCCCAAGCTGTGGGCCCAG +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTNYIVC*PKLWAQ
Trigger: CTGGGCCCACAGCTTGGGGCAACATACAATATAATT...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGCCTTTCAGAGGATGCTaGTACACAGGAGAAGGACCA +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWPFRGC*YTGEGP
Trigger: TGGTCCTTCTCCTGTGTAGCAGCATCCTCTGAAAGG...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACTGGCTTTGTGGGCCATaGCGTCTCTACTTCAACTAC +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENWLCGP*RLYFNY
Trigger: GTAGTTGAAGTAGAGACGGCATGGCCCACAAAGCCA...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGCTTAAACCAAGTGTCTaGCTACACTCTTTTGGCAGT +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKLKPSV*LHSFGS
Trigger: ACTGCCAAAAGAGTGTAGGCAGACACTTGGTTTAAG...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTCAGAGGATGAGCTCATaGACAAGCTGGGTCTTTCTG +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAQRMSS*TSWVFL
Trigger: CAGAAAGACCCAGCTTGTGCATGAGCTCATCCTCTG...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCCAATTAAACCCTGCTaGTATTTTCCAGAGATCAGT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPPIKPC*YFPEIS
Trigger: ACTGATCTCTGGAAAATAGCAGCAGGGTTTAATTGG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGACCCCAATTAAACCCTaGTGCTATTTTCCAGAGATC +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKTPIKP*CYFPEI
Trigger: GATCTCTGGAAAATAGCAGCAGGGTTTAATTGGGGT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAAACAGTACCTGCGGATaGCCTTCTTCACGGCCTGCT +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSNSTCG*PSSRPA
Trigger: AGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTT...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGGCCCCTGGCTCTAGTTTTGTGTTGTCAGGGAGATGTTGATCAAGCACCTTGGAAAACGATTGATTGTTaGCCAGTGAAGTTGGTAGAA +
Preference number: 4 (lower is better)
Translates to: RPLALVLCCQGDVDQAPWKTIDC*PVKLVE
Trigger: TTCTACCAACTTCACTGGGCAACAATCAATCGTTTT...CCAAGGTGCTTGATCAACATCTCCCTGACAACACAAAACTAGAGCCAGGGGCCT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTCTCCTCTACCTCTaGAGCTGTAATAGGTGTACT +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLCLLYL*SCNRCT
Trigger: AGTACACCTATTACAGCTGCAGAGGTAGAGGAGACA...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLCPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATAGGTCTTCGGCTTCGTaGTTAAACTTGTCCAAAAAT +
Preference number: 4 (lower is better)
Translates to: PCSYTSSQALSLQVIHPYRSSAS*LNLSKN
Trigger: ATTTTTGGACAAGTTTAACCACGAAGCCGAAGACCT...ATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTAGGTCTTCGGCTTCGTaGTTAAACTTGTCCAAAAAT +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPRSSAS*LNLSKN
Trigger: ATTTTTGGACAAGTTTAACCACGAAGCCGAAGACCT...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GACCTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: DLRPHLYLNVEGGGSQIRTFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...CCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAGGTC
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCATTCCAGTACTGTAGATaGTGCTCATTGTATTTAGAA +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPFQYCR*CSLYLE
Trigger: TTCTAAATACAATGAGCACCATCTACAGTACTGGAA...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCATTCTTGTGGATTATCTaGGTTACAAACTTTTCCAGT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPFLWII*VTNFSS
Trigger: ACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAA...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGAGGGAGGCATCCAATTaGACTGATATAGGAAGGATA +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKREASN*TDIGRI
Trigger: TATCCTTCCTATATCAGTCCAATTGGATGCCTCCCT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCAGTAACATCTATGTTTaGTTTCTGTCCAAAGGGAAC +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASSNIYV*FLSKGN
Trigger: GTTCCCTTTGGACAGAAACCAAACATAGATGTTACT...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTCTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TGCATTTCATTGTTGTGTCTTTTCCTAGCCAGTAAGCCCATAAATAGTCACCAACCAGGTCCCAAGCTGTaGGATGGCAGACTGCTTTCT +
Preference number: 4 (lower is better)
Translates to: CISLLCLFLASKPINSHQPGPKL*DGRLLS
Trigger: AGAAAGCAGTCTGCCATCCCACAGCTTGGGACCTGG...TTGGTGACTATTTATGGGCTTACTGGCTAGGAAAAGACACAACAATGAAATGCA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp ACCTTTAAAACAGTACCTGCGGATGCCCTTCTTCACGGCCTGCTACCGAACCCAAAAGAATTCTTGTTCTaGTCTTTCAGCCAGGTAAAT +
Preference number: 4 (lower is better)
Translates to: TFKTVPADALLHGLLPNPKEFLF*SFSQVN
Trigger: ATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTT...TGGGTTCGGTAGCAGGCCGTGAAGAAGGGCATCCGCAGGTACTGTTTTAAAGGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: IVIVTSSATVSSTSAAVIMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTACTATCAGGCATGCTCTaGGAGTTCACGGAGGCCCCT +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLLSGML*EFTEAP
Trigger: AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAG...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGAAAGATTTAAGAGACTaGGTACCCACTTCAGAGGGT +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKKDLRD*VPTSEG
Trigger: ACCCTCTGAAGTGGGTACCCAGTCTCTTAAATCTTT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATATGCTGTGCTCACACTaGGGTAGTGACTGTGAGAAA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYMLCSH*GSDCEK
Trigger: TTTCTCACAGTCACTACCCCAGTGTGAGCACAGCAT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATTGTGGGCCCAGTGAATaGCAGGATGGTGCAGATGGT +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDCGPSE*QDGADG
Trigger: ACCATCTGCACCATCCTGCCATTCACTGGGCCCACA...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTTTTCTGTGTTACAGTTaGACACTATGTCACATGCAC +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSFLCYS*TLCHMH
Trigger: GTGCATGTGACATAGTGTCCAACTGTAACACAGAAA...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTCCAGACAAAAACAGGTaGTGGGGTGGCCGGGCACAA +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCPDKNR*WGGRAQ
Trigger: TTGTGCCCGGCCACCCCACCACCTGTTTTTGTCTGG...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 72 bp GAGACTGGGTACCCACTTCAGAGGGTGAACATACAGTaGGAATTTCCATTCACTCCACAGTTAGAGAACAGT +
Preference number: 4 (lower is better)
Translates to: ETGYPLQRVNIQ*EFPFTPQLENS
Trigger: ACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCAGTCTC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 72 bp AAAGGGCAGGCTGCAGAGCAAGTTCAGATAAATCACTaGCTAGGTAAAATCCAACAGATGCTCCCTCGTCTT +
Preference number: 4 (lower is better)
Translates to: KGQAAEQVQINH*LGKIQQMLPRL
Trigger: AAGACGAGGGAGCATCTGTTGGATTTTACCTAGCAAGTGATTTATCTGAACTTGCTCTGCAGCCTGCCCTTT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTATTCCAAGAAGCAAGTaGACTTTGATAGAACAGGTC +
Preference number: 4 (lower is better)
Translates to: ISVGLKPVLITLLRQFKAIPRSK*TLIEQV
Trigger: GACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAAT...AGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATAT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: LFLIVIVTSSATVSSTSATSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...TGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGCTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKLQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTCTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLLQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATACACATGAACATTAAAGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: SPYLGSSRLAEIIHMNIKDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...TTTAATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp GAGACTTTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGACGGAAAGCATCATTaGTACGGCTCCGGGACATCC +
Preference number: 4 (lower is better)
Translates to: ETFRNFLLKGRSICSFMTDGKHH*YGSGTS
Trigger: GGATGTCCCGGAGCCGTATCAATGATGCTTTCCGTC...TGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAAAGTCTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATACATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAACTAAAACCTCCTCATaGGATTTTCTCTCTTATCAG +
Preference number: 4 (lower is better)
Translates to: HAILNPCSYTSSQALSLQTKTSS*DFLSYQ
Trigger: CTGATAAGAGAGAAAATCTCATGAGGAGGTTTTAGT...TTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACAAGATCACATCCACTaGATGACTTTCCCTAGACTA +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTQDHIH*MTFPRL
Trigger: TAGTCTAGGGAAAGTCATTCAGTGGATGTGATCTTG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTTGGTTCCTAACCTaGTGGTGTATACACTCTGTA +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTVWFLT*WCIHSV
Trigger: TACAGAGTGTATACACCATCAGGTTAGGAACCAAAC...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGATTCTTGCACTGTGCTaGACCAAGTTTATGAACTTC +
Preference number: 4 (lower is better)
Translates to: GYPLQRVNIQLEFPFTPQILALC*TKFMNF
Trigger: GAAGTTCATAAACTTGGTTCAGCACAGTGCAAGAAT...CTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATACCTGGTGGGCACAGTaGGGACTGTTCTGGAGAAAA +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDTWWAQ*GLFWRK
Trigger: TTTTCTCCAGAACAGTCCTCACTGTGCCCACCAGGT...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGCTGAGGTCAGGAGTTTaGGACCAGCCTGGCCAAATG +
Preference number: 4 (lower is better)
Translates to: NIQLEFPFTPQLENSRNELRSGV*DQPGQM
Trigger: CATTTGGCCAGGCTGGTCTCAAACTCCTGACCTCAG...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTTGTTTCTCTGGTCTGTaGGCTCCACAATGGACCTTT +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEACFSGL*APQWTF
Trigger: AAAGGTCCATTGTGGAGCTCACAGACCAGAGAAACA...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGTTGAGAGTGGGTTTATaGGGAGGAGAGATTGGACCT +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWLRVGL*GGEIGP
Trigger: AGGTCCAATCTCTCCTCCTCATAAACCCACTCTCAA...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAGCTCCCTCGTCTTGCTaGGCATTTTCTGACCTACCA +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSAPSSC*AFSDLP
Trigger: TGGTAGGTCAGAAAATGCTCAGCAAGACGAGGGAGC...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTATTTCAACACAGAATTaGCACTCGTTAACAGTCTTC +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSISTQN*HSLTVF
Trigger: GAAGACTGTTAACGAGTGTCAATTCTGTGTTGAAAT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAAGGGCACCATTACAATaGAGAGACACCCCAATTAAA +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIRAPLQ*RDTPIK
Trigger: TTTAATTGGGGTGTCTCTTCATTGTAATGGTGCCCT...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACATCATCTTAAATCCTTaGGTTTGGGGATCTGGGGCT +
Preference number: 4 (lower is better)
Translates to: TESNVNEDALSLAMLSLDIILNP*VWGSGA
Trigger: AGCCCCAGATCCCCAAACTCAAGGATTTAAGATGAT...GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGTAGCAGGTGTTACCTaGACATTTGTGAACATTTTA +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPVAGVT*TFVNIL
Trigger: TAAAATGTTCACAAATGTTCAGGTAACACCTGCTAC...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGACAAAACGTAAAGAAGCCCCAGCACATAAGTAAGCACAAGGAGTGTGTAAATTGCAGATTTAAGGCCTaGATGGCTGGAGTAGCAGGT +
Preference number: 4 (lower is better)
Translates to: RQNVKKPQHISKHKECVNCRFKA*MAGVAG
Trigger: ACCTGCTACTCCAGCCATTCAGGCCTTAAATCTGCA...ATTTACACACTCCTTGTGCTTACTTATGTGCTGGGGCTTCTTTACGTTTTGTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGTCCAAGGTTGTACATGGTTAGAGCAATGCAGGAATTCCATTTACAGGCCCCTTTGTGTTCAACCGTTTaGTCTTGTCTTCTGAGAGCA +
Preference number: 4 (lower is better)
Translates to: SPRLYMVRAMQEFHLQAPLCSTV*SCLLRA
Trigger: TGCTCTCAGAAGACAAGAGCAAACGGTTGAACACAA...AGGGGCCTGTAAATGGAATTCCTGCATTGCTCTAACCATGTACAACCTTGGACT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR GCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAATGGCCTCAGCTGCTTaGCGACCTCAGATCTCCAGC +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSMASAA*RPQISS
Trigger: GCTGGAGATCTGAGGTCGGCAAGCAGCTGAGGCCAT...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGTCCTCATAATGATTTaGTCTTGCCATCTCATTTTT +
Preference number: 4 (lower is better)
Translates to: QWGLNPSSSPYLGSSRLAVLIMI*SCHLIF
Trigger: AAAAATGAGATGGCAAGAGCAAATCATTATGAGGAC...AGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTG
44% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGGGCATTCATCAACTTTaGCCTCACATAGGCATGAAG +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKGIHQL*PHIGMK
Trigger: CTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCC...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTGGCATTCATCAACTTTaGCCTCACATAGGCATGAAG +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLGIHQL*PHIGMK
Trigger: CTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCC...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGCTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: ALVPELKQEISTKFPKYVLEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGCCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGNMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGACAAAACGTAAAGAAGCCCCAGCACATAAGTAAGCACAAGGAGTGTGTAAATAGTTTCTATCAGGCATaGTCTGGGAGTTCACGGAGG +
Preference number: 4 (lower is better)
Translates to: RQNVKKPQHISKHKECVNSFYQA*SGSSRR
Trigger: CCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACT...ATTTACACACTCCTTGTGCTTACTTATGTGCTGGGGCTTCTTTACGTTTTGTCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCAGTCATTGTAACATTATaGTGGTCACCACATAGAATG +
Preference number: 4 (lower is better)
Translates to: SQSLQLHQFPGTVLTSDPVIVTL*WSPHRM
Trigger: CATTCTATGTGGTGACCAGCATAATGTTACAATGAC...TGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGCCTGTTCCTCAATGGTaGACTGAGCAGCAGTTACAG +
Preference number: 4 (lower is better)
Translates to: ALVPELKQEISTKFPKYVPVPQW*TEQQLQ
Trigger: CTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGG...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp TATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAAGGTCTTCGGCTTCGTaGTTAAACTTGTCCAAAAAT +
Preference number: 4 (lower is better)
Translates to: YQWGLNPSSSPYLGSSRLRSSAS*LNLSKN
Trigger: ATTTTTGGACAAGTTTAACCACGAAGCCGAAGACCT...TAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TGCACCAACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: CTNLIQEALRGKRNQLPETFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...CTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTTGGTGCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp TGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTCTCTCAGATGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: CSCNRCTRSERFSSLSLRCSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...TCTGAGAGACAAAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTTCCAGTACTGTAGATaGTGCTCATTGTATTTAGAA +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASFQYCR*CSLYLE
Trigger: TTCTAAATACAATGAGCACCATCTACAGTACTGGAA...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CTTTCCTGCACCAAAGACTGTTTCCCCACTCAGAGGATGAGCTCATGCACAAGCTTCTTGTGGATTATCTaGGTTACAAACTTTTCCAGT +
Preference number: 4 (lower is better)
Translates to: LSCTKDCFPTQRMSSCTSFLWII*VTNFSS
Trigger: ACTGGAAAAGTTTGTAACCCAGATAATCCACAAGAA...GCTTGTGCATGAGCTCATCCTCTGAGTGGGGAAACAGTCTTTGGTGCAGGAAAG
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTAGTAACATCTATGTTTaGTTTCTGTCCAAAGGGAAC +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSSNIYV*FLSKGN
Trigger: GTTCCCTTTGGACAGAAACCAAACATAGATGTTACT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCTGTGCATCCCAGGCCTaGTCCACCATTGCATCAGTA +
Preference number: 4 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSCASQA*STIASV
Trigger: TACTGATGCAATGGTGGACCAGGCCTGGGATGCACA...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTCCCCAACAGCTTCATaGAATCCTTCATTAGCTCCA +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWESPTAS*NPSLAP
Trigger: TGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGA...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCAAAGAATTCTTGTTCTaGTCTTTCAGCCAGGTAAAT +
Preference number: 4 (lower is better)
Translates to: SVGLKPVLITLLRQFKASKEFLF*SFSQVN
Trigger: ATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTT...GCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp GTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGTGGAAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: VPELKQEISTKFPKYVSGRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...TCCACTCACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp TTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: LFLIVIVTSSATVSSTSAMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...TGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGGGGAGATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: FRNFLLKGRSICSFMTGEMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...CTCCCCTGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGATGCTGTGCTCACACTaGGGTAGTGACTGTGAGAAA +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQMLCSH*GSDCEK
Trigger: TTTCTCACAGTCACTACCCCAGTGTGAGCACAGCAT...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACATTGTAACATTATGCTaGTCACCACATAGAATGAGT +
Preference number: 4 (lower is better)
Translates to: CMPFSILAATPVPRHCPYIVTLC*SPHRMS
Trigger: ACTCATTCTATGTGGTGACCAGCATAATGTTACAAT...GTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCATGCA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTGATTGTAACATTATGCTaGTCACCACATAGAATGAGT +
Preference number: 4 (lower is better)
Translates to: TVEMSFYQACSGSSRRPLIVTLC*SPHRMS
Trigger: ACTCATTCTATGTGGTGACCAGCATAATGTTACAAT...CAGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAGTCCTTTGCCATGTCTaGGGAGGCTCTTTTGAAGGT +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRVLCHV*GGSFEG
Trigger: ACCTTCAAAAGAGCCTCCCCAGACATGGCAAAGGAC...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGAGTTTGAGACCAGCCTaGCCAAATGGTGAAACTGCA +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQSLRPA*PNGETA
Trigger: TGCAGTTTCACCATTTGGCCAGGCTGGTCTCAAACT...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACCAAGCTGGGTCTTTCTaGTCTCCCTCTCGAAGATTT +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENQAGSF*SPSRRF
Trigger: AAATCTTCGAGAGGGAGACCAGAAAGACCCAGCTTG...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAAGCTCATGCACAAGCTaGGTCTTTCTGGTCTCCCTC +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSSSCTS*VFLVSL
Trigger: GAGGGAGACCAGAAAGACCCAGCTTGTGCATGAGCT...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCCAAAGGGACAGAGAGTaGGCTGATACAGAGTTGTTT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFQRDRE*ADTELF
Trigger: AAACAACTCTGTATCAGCCCACTCTCTGTCCCTTTG...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGTCCAAGGTTGTACATGGTTAGAGCAATGCAGGAATTCCATTTACAGGCCCCTGTCCAAGGTTGTACATaGTTAGAGCAATGCAGGAAT +
Preference number: 4 (lower is better)
Translates to: SPRLYMVRAMQEFHLQAPVQGCT*LEQCRN
Trigger: ATTCCTGCATTGCTCTAACCATGTACAACCTTGGAC...AGGGGCCTGTAAATGGAATTCCTGCATTGCTCTAACCATGTACAACCTTGGACT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR CCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTGTCCAAGGTTGTACATaGTTAGAGCAATGCAGGAAT +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLVQGCT*LEQCRN
Trigger: ATTCCTGCATTGCTCTAACCATGTACAACCTTGGAC...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTACTTTTTCCCAAGAGTaGAGTTGGCTTCTTCCGATC +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLTFSQE*SWLLPI
Trigger: GATCGGAAGAAGCCAACTCCACTCTTGGGAAAAAGT...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
44% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTTCCTTACCATCAACATaGCCAAGACTGCTTTGTGGA +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLSLPST*PRLLCG
Trigger: TCCACAAAGCAGTCTTGGCCATGTTGATGGTAAGGA...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CAA 72 bp GTTTCATTTAATCCTTGCTTCCGTATAGCCCAGGGTTaGGCAAAGTTTGTCTGTAAATGGCTTTGTGGGCCA +
Preference number: 4 (lower is better)
Translates to: VSFNPCFRIAQG*AKFVCKWLCGP
Trigger: TGGCCCACAAAGCCATTTACAGACAAACTTTGCCAAACCCTGGGCTATACGGAAGCAAGGATTAAATGAAAC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 72 bp ACCAGCTTCCTGAGAGAAAGCAGCTTCTTGAATGCATaGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAA +
Preference number: 4 (lower is better)
Translates to: TSFLRESSFLNA*VPELKQEISTK
Trigger: TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCTTTCTCTCAGGAAGCTGGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAAATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
43% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTCTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEALQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTTGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: DSKHHCRQITIVLELSYCCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAACAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp GTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGTGGAAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: VPELKQEISTKFPKYVSGRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...TCCACTCACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTAC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATAGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIIGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCAGCATATGCAACAGATaGTCGGAACAGGTACATTTC +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFSICNR*SEQVHF
Trigger: GAAATGTACCTGTTCCGATCATCTGTTGCATATGCT...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCATTTAGATTATCCCTaGACAGCCTGTGAGACCAAA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYHLDYP*TACETK
Trigger: TTTGGTCTCACAGGCTGTTCAGGGATAATCTAAATG...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAACCTTGAAGAAAGCATaGTCGATTCCAAACATCACT +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSITLKKA*SIPNIT
Trigger: AGTGATGTTTGGAATCGATCATGCTTTCTTCAAGGT...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTAGACCTGTCACCTTaGAGAAAGCATGATCGATTC +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWELDLSP*RKHDRF
Trigger: GAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAA...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTCAAGCACCTTGGAAGTaGAAAAGCAATGTCCTCTAC +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAQAPWK*KSNVLY
Trigger: GTAGAGGACATTGCTTTTTCACTTCCAAGGTGCTTG...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACCCACTTCAGAGGGTaGACATACAGTTGGAATTTC +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWTHFRG*TYSWNF
Trigger: GAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGT...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGAAATCTAGCATTTATTaGGTGTCTGCTTTGTGCTCA +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKKSSIY*VSALCS
Trigger: TGAGCACAAAGCAGACACTCAATAAATGCTAGATTT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTACCTGGTGGGCACAGTaGGGACTGTTCTGGAGAAAA +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCTWWAQ*GLFWRK
Trigger: TTTTCTCCAGAACAGTCCTCACTGTGCCCACCAGGT...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTATCATCTTAAATCCTTaGGTTTGGGGATCTGGGGCT +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAIILNP*VWGSGA
Trigger: AGCCCCAGATCCCCAAACTCAAGGATTTAAGATGAT...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCATGCAGATTTAAGGCCTaGATGGCTGGAGTAGCAGGT +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSCRFKA*MAGVAG
Trigger: ACCTGCTACTCCAGCCATTCAGGCCTTAAATCTGCA...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAACATTGGTACCTGAGCTaGAGCAGGAAATCTCTACAA +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKHWYLS*SRKSLQ
Trigger: TTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATG...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGGAATGCATTGGTACCTaGGCTGAAGCAGGAAATCTC +
Preference number: 4 (lower is better)
Translates to: ALVPELKQEISTKFPKYVECIGT*AEAGNL
Trigger: GAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTC...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTTCTCTTATCAGCCTTTaGACTTGGGTTGGGCGCTCT +
Preference number: 4 (lower is better)
Translates to: DSKHHCRQITIVLELSYCSLISL*TWVGRS
Trigger: AGAGCGCCCAACCCAAGTTCAAAGGCTGATAAGAGA...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000680121.1
CDS-3UTR GCA 90 bp AGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCAGTACTGTAGATGGTaGTCATTGTATTTAGAATTG +
Preference number: 4 (lower is better)
Translates to: RTVEMSFYQACSGSSRRPQYCRW*SLYLEL
Trigger: CAATTCTAAATACAATGAGCACCATCTACAGTACTG...GGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCTATAATGGCCTCAGCTaGTTGCCGACCTCAGATCTC +
Preference number: 4 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSYNGLS*LPTSDL
Trigger: GAGATCTGAGGTCGGCAAGCAGCTGAGGCCATTATA...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp GAACAGCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCCTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: EQPLNCSIQCYYHMTANILEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...GATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGCTGTTC
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp AGTCCAAGGTTGTACATGGTTAGAGCAATGCAGGAATTCCATTTACAGGCCCCTAGGTTGTGCAGCATATaGCATATCATACTGGATATG +
Preference number: 4 (lower is better)
Translates to: SPRLYMVRAMQEFHLQAPRLCSI*HIILDM
Trigger: CATATCCAGTATGATATGGCATATGCTGCACAACCT...AGGGGCCTGTAAATGGAATTCCTGCATTGCTCTAACCATGTACAACCTTGGACT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR GCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENNMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEANMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTCAGGTATCTAAGAAATaGTGTGCTCACACTGGGGTA +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAQVSKK*CAHTGV
Trigger: TACCCCAGTGTGAGCACAGCATTTCTTAGATACCTG...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAGGACACTATGTCACATaGACATGGGTCCTTTGCCAT +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRGHYVT*TWVLCH
Trigger: ATGGCAAAGGACCCATGTGCATGTGACATAGTGTCC...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATATCAGCAGTCGGGTTTTaGCGAGATATTTTCTTGTCC +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIISAVGF*RDIFLS
Trigger: GGACAAGAAAATATCTCGGCAAAACCCGACTGCTGA...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR CCA 90 bp TCCTCTACCTCTGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: SSTSAAVIGVLGVNVSPLTFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...AAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCAGAGGTAGAGGA
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKCSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp AACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACGGAGGCCCCTTTCCAGTACTGTAGATaGTGCTCATTGTATTTAGAA +
Preference number: 4 (lower is better)
Translates to: NSRNEFLSGMLWEFTEAPFQYCR*CSLYLE
Trigger: TTCTAAATACAATGAGCACCATCTACAGTACTGGAA...AGGGGCCTCCGTGAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGTGGAGACATTGTAAAAGGGTGTCCAGGTGAGAACAGCACAAGCAAAGGTGTGAGTAACATCTATGTTTaGTTTCTGTCCAAAGGGAAC +
Preference number: 4 (lower is better)
Translates to: SGDIVKGCPGENSTSKGVSNIYV*FLSKGN
Trigger: GTTCCCTTTGGACAGAAACCAAACATAGATGTTACT...CACACCTTTGCTTGTGCTGTTCTCACCTGGACACCCTTTTACAATGTCTCCACT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGAGTAACATCTATGTTTaGTTTCTGTCCAAAGGGAAC +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKSNIYV*FLSKGN
Trigger: GTTCCCTTTGGACAGAAACCAAACATAGATGTTACT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCACAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR CCA 90 bp ATATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: ISVGLKPVLITLLRQFKAKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...AGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAGTAGTTGAGCAGTaGCCTTACATTCATGTTCTT +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGKVVEQ*PYIHVL
Trigger: AAGAACATGAATGTAAGGCCACTGCTCAACTACTTT...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCCATTCTCAATCCTTGCAGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTAAAGAATTCTTGTTCTaGTCTTTCAGCCAGGTAAAT +
Preference number: 4 (lower is better)
Translates to: CHSQSLQLHQFPGTVLTSKEFLF*SFSQVN
Trigger: ATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTT...ACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCTGCAAGGATTGAGAATGGCA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTATGGAAACAGGGGGCTaGTTAGGAGGTCCAAGTGTT +
Preference number: 4 (lower is better)
Translates to: DSKHHCRQITIVLELSYCMETGG*LGGPSV
Trigger: AACACTTGGACCTCCTAACCAGCCCCCTGTTTCCAT...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
43% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGAAAGATTTAAGAGACTaGGTACCCACTTCAGAGGGT +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEKDLRD*VPTSEG
Trigger: ACCCTCTGAAGTGGGTACCCAGTCTCTTAAATCTTT...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGA +
Preference number: 4 (lower is better)
Translates to: NIQLEFPFTPQLENSRNETSRDI*KARSPR
Trigger: TCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGT...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTAAGGCCCCATCTTTACCTAAATGTGGAGGGAGGAGGCTCTCAAATTAGGAAGAAACTGTCTATGAAATaGTTGCTTAGCCAAGGAGTA +
Preference number: 4 (lower is better)
Translates to: LRPHLYLNVEGGGSQIRKKLSMK*LLSQGV
Trigger: TACTCCTTGGCTAAGCAACCATTTCATAGACAGTTT...CTTCCTAATTTGAGAGCCTCCTCCCTCCACATTTAGGTAAAGATGGGGCCTTAG
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAACAATATGAAAATGAATaGGTGTGGCTGGGTTCCAAT +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQQYENE*VWLGSN
Trigger: ATTGGAACCCAGCCACACCCATTCATTTTCATATTG...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACACAATATGAAAATGAATaGGTGTGGCTGGGTTCCAAT +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTQYENE*VWLGSN
Trigger: ATTGGAACCCAGCCACACCCATTCATTTTCATATTG...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGAGCACCTGCCATTTCTaGCCTGATCACTATGTTTCT +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQSTCHF*PDHYVS
Trigger: AGAAACATAGTGATCAGGCCAGAAATGGCAGGTGCT...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATACCAAATCTCAAGACCTaGATACAAAATGTAGAGCTG +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIPNLKT*IQNVEL
Trigger: CAGCTCTACATTTTGTATCCAGGTCTTGAGATTTGG...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGATTCCAAGAAGCAAGTaGACTTTGATAGAACAGGTC +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKIPRSK*TLIEQV
Trigger: GACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAAT...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp TTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCACTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: LFLIVIVTSSATVSSTSALQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...TGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AAAGTATTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: KVLFLIVIVTSSATVSSTCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...GGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAATACTTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp GAGACTTTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACATGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: ETFRNFLLKGRSICSFMTCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...TGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAAAGTCTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATGTGGCTGCAGAAAGTaGCATGATTTCCCCAACAGC +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLCGCRK*HDFPNS
Trigger: GCTGTTGGGGAAATCATGTCACTTTCTGCAGCCACA...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AACCTAATACAAGAAGCGCTCAGAGGAAAGAGAAACCAGCTTCCTGAGAGAAAGTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: NLIQEALRGKRNQLPERKFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...CTTTCTCTCAGGAAGCTGGTTTCTCTTTCCTCTGAGCGCTTCTTGTATTAGGTT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTCTCTCAGAGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: CSCNRCTRSERFSSLSLRVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...TCTGAGAGACAAAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCACAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: LFLIVIVTSSATVSSTSAQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...TGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATAAGCATATGCAACAGATaGTCGGAACAGGTACATTTC +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIISICNR*SEQVHF
Trigger: GAAATGTACCTGTTCCGATCATCTGTTGCATATGCT...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACCACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGACCTTGAAGAAAGCATaGTCGATTCCAAACATCACT +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWETLKKA*SIPNIT
Trigger: AGTGATGTTTGGAATCGATCATGCTTTCTTCAAGGT...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGACAAAACGTAAAGAAGCCCCAGCACATAAGTAAGCACAAGGAGTGTGTAAATGGATGGTGCAGATGGTaGTGCGAAATGTTGATTGTA +
Preference number: 4 (lower is better)
Translates to: RQNVKKPQHISKHKECVNGWCRW*CEMLIV
Trigger: TACAATCAACATTTCGCATCACCATCTGCACCATCC...ATTTACACACTCCTTGTGCTTACTTATGTGCTGGGGCTTCTTTACGTTTTGTCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGTTGCTGAGCATTTTCTaGCCTACCAGAAGTCAAACA +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWLLSIF*PTRSQT
Trigger: TGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGCAA...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGCAGCTGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTTGTCTCTCAGACAGTTCAAGGCTAGCTaGGATAATACACATGAACAT +
Preference number: 4 (lower is better)
Translates to: CSCNRCTRSERFSSLSLRQFKAS*DNTHEH
Trigger: ATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTG...TCTGAGAGACAAAGAGGAGAAACGTTCACTCCTAGTACACCTATTACAGCTGCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp GTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATAGGTCAGTTCAAGGCTAGCTaGGATAATACACATGAACAT +
Preference number: 4 (lower is better)
Translates to: VIVTSSATVSSTSAAVIGQFKAS*DNTHEH
Trigger: ATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTG...ACCTATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGAC
42% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp GCTGAGCATTTTCTGACCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCCAGTACTGTAGATGGTaGTCATTGTATTTAGAATTG +
Preference number: 4 (lower is better)
Translates to: AEHFLTYQKSNTKSRGSGQYCRW*SLYLEL
Trigger: CAATTCTAAATACAATGAGCACCATCTACAGTACTG...GCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGGTCAGAAAATGCTCAGC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GAATTCCATTTACAGGCCCCTAATGGTTTCCTGGCTCATGTGAGAGAAGTCAGCGTCCTCATAATGATTTaGTCTTGCCATCTCATTTTT +
Preference number: 4 (lower is better)
Translates to: EFHLQAPNGFLAHVREVSVLIMI*SCHLIF
Trigger: AAAAATGAGATGGCAAGAGCAAATCATTATGAGGAC...GCTGACTTCTCTCACATGAGCCAGGAAACCATTAGGGGCCTGTAAATGGAATTC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679162.1
CDS-3UTR GCA 90 bp TTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGGCATTCATCAACTTTaGCCTCACATAGGCATGAAG +
Preference number: 4 (lower is better)
Translates to: LFLIVIVTSSATVSSTSAGIHQL*PHIGMK
Trigger: CTTCATGCCTATGTGAGGGCAAAGTTGATGAATGCC...TGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR GCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTGGCCTGGTCCACCATTaGATCAGTAACATCTATGTT +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSGLVHH*ISNIYV
Trigger: AACATAGATGTTACTGATGCAATGGTGGACCAGGCC...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGCTTGAATATTCTCTGTaGATCCCAGGCCTGGTCCAC +
Preference number: 4 (lower is better)
Translates to: NIQLEFPFTPQLENSRNELEYSL*IPGLVH
Trigger: GTGGACCAGGCCTGGGATGCACAGAGAATATTCAAG...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGTGGAAACATGGAACAGAGATaGGGGGTCACAGTATGTTTC +
Preference number: 4 (lower is better)
Translates to: VPELKQEISTKFPKYVSGNMEQR*GVTVCF
Trigger: GAAACATACTGTGACCCCGCATCTCTGTTCCATGTT...TCCACTCACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTAC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTCCTTTCAGAGGATGCTaGTACACAGGAGAAGGACCA +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCPFRGC*YTGEGP
Trigger: TGGTCCTTCTCCTGTGTAGCAGCATCCTCTGAAAGG...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACCCCAATTAAACCCTaGTGCTATTTTCCAGAGATC +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWTPIKP*CYFPEI
Trigger: GATCTCTGGAAAATAGCAGCAGGGTTTAATTGGGGT...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGCTACACCAGTTCCCAGGCACTGTCCTTACAAGTGATCCATCCATATTCCATAAAAACGATTGATTGTTaGCCAGTGAAGTTGGTAGAA +
Preference number: 4 (lower is better)
Translates to: SYTSSQALSLQVIHPYSIKTIDC*PVKLVE
Trigger: TTCTACCAACTTCACTGGGCAACAATCAATCGTTTT...TATGGAATATGGATGGATCACTTGTAAGGACAGTGCCTGGGAACTGGTGTAGCT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAAAAACGATTGATTGTTaGCCAGTGAAGTTGGTAGAA +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTKTIDC*PVKLVE
Trigger: TTCTACCAACTTCACTGGGCAACAATCAATCGTTTT...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAGGCTCTCACAAGCCTaGAACCTGGGAATTACTATT +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRRLSQA*NLGITI
Trigger: AATAGTAATTCCCAGGTTGCAGGCTTGTGAGAGCCT...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000677282.1
CDS-3UTR CCA 90 bp TCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATACACATGAACATTAAACCTGTTCCTCAATGGTaGACTGAGCAGCAGTTACAG +
Preference number: 4 (lower is better)
Translates to: SPYLGSSRLAEIIHMNIKPVPQW*TEQQLQ
Trigger: CTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGG...TTTAATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFTFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGGTGGTATCGGAGTGAGTTTTCCAGCACTGATTCTTTATCTCATGGGAGACTTACATTTGGGCAAGTGTaGACTGTTCCTTTAAAAAGG +
Preference number: 4 (lower is better)
Translates to: WWYRSEFSSTDSLSHGRLTFGQV*TVPLKR
Trigger: CCTTTTTAAAGGAACAGTCCACACTTGCCCAAATGT...AAGTCTCCCATGAGATAAAGAATCAGTGCTGGAAAACTCACTCCGATACCACCA
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGATGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRCSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGGGGAGTGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: FRNFLLKGRSICSFMTGECSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...CTCCCCTGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAAAGGGAGGCATCCAATTaGACTGATATAGGAAGGATA +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKREASN*TDIGRI
Trigger: TATCCTTCCTATATCAGTCCAATTGGATGCCTCCCT...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
42% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp TTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATAAGGGAGGCATCCAATTaGACTGATATAGGAAGGATA +
Preference number: 4 (lower is better)
Translates to: LNPSSSPYLGSSRLAEIIREASN*TDIGRI
Trigger: TATCCTTCCTATATCAGTCCAATTGGATGCCTCCCT...TATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TGGGTACCCACTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAAGTAACATCTATGTTTaGTTTCTGTCCAAAGGGAAC +
Preference number: 4 (lower is better)
Translates to: WVPTSEGEHTVGISIHSTSNIYV*FLSKGN
Trigger: GTTCCCTTTGGACAGAAACCAAACATAGATGTTACT...TGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGTACCCA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGTCCCCAACAGCTTCATaGAATCCTTCATTAGCTCCA +
Preference number: 4 (lower is better)
Translates to: ALVPELKQEISTKFPKYVSPTAS*NPSLAP
Trigger: TGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGA...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR CCA 90 bp GAGACTTTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACACAGTATGTTTCATCATaGGGCACAGGTTCCACCACC +
Preference number: 4 (lower is better)
Translates to: ETFRNFLLKGRSICSFMTQYVSS*GTGSTT
Trigger: GGTGGTGGAACCTGTGCCCCATGATGAAACATACTG...TGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAAAGTCTC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TATCAGTGGGGCTTAAACCCGTCCTCATCACCTTACTTAGGCAGTTCAAGGCTAAAAGAATTCTTGTTCTaGTCTTTCAGCCAGGTAAAT +
Preference number: 4 (lower is better)
Translates to: YQWGLNPSSSPYLGSSRLKEFLF*SFSQVN
Trigger: ATTTACCTGGCTGAAAGACCAGAACAAGAATTCTTT...TAGCCTTGAACTGCCTAAGTAAGGTGATGAGGACGGGTTTAAGCCCCACTGATA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGGGGAGCTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: FRNFLLKGRSICSFMTGELTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...CTCCCCTGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAAGATGCTCTCTCCTTaGCCATGTTGTCTTTGGACA +
Preference number: 4 (lower is better)
Translates to: RVNIQLEFPFTPQLENSRKMLSP*PCCLWT
Trigger: TGTCCAAAGACAACATGGCCAAGGAGAGAGCATCTT...TCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAACATCACGAGACATTTaGAAGGCCAGGAGCCCCAGA +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSTSRDI*KARSPR
Trigger: TCTGGGGCTCCTGGCCTTCCAAATGTCTCGTGATGT...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp ACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTTCTGTGTTACAGTTaGACACTATGTCACATGCAC +
Preference number: 4 (lower is better)
Translates to: TPQLENSRNEFLSGMLWEFLCYS*TLCHMH
Trigger: GTGCATGTGACATAGTGTCCAACTGTAACACAGAAA...CTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCCAATATGAAAATGAATaGGTGTGGCTGGGTTCCAAT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFQYENE*VWLGSN
Trigger: ATTGGAACCCAGCCACACCCATTCATTTTCATATTG...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGACAAAACGTAAAGAAGCCCCAGCACATAAGTAAGCACAAGGAGTGTGTAAATAGCACCTGCCATTTCTaGCCTGATCACTATGTTTCT +
Preference number: 4 (lower is better)
Translates to: RQNVKKPQHISKHKECVNSTCHF*PDHYVS
Trigger: AGAAACATAGTGATCAGGCCAGAAATGGCAGGTGCT...ATTTACACACTCCTTGTGCTTACTTATGTGCTGGGGCTTCTTTACGTTTTGTCT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATCCAAATCTCAAGACCTaGATACAAAATGTAGAGCTG +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYPNLKT*IQNVEL
Trigger: CAGCTCTACATTTTGTATCCAGGTCTTGAGATTTGG...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCCTTTGAACTTGGGTTaGGCGCTTTCTCAACATTCC +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDPLNLG*ALSQHS
Trigger: GGAATGTTGAGAAAGCGCCCAACCCAAGTTCAAAGG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678073.1
CDS-3UTR CCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTATGATTTGGTGGTGGTaGTATCGGAGTGAGTTTTCC +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSMIWWW*YRSEFS
Trigger: GGAAAACTCACTCCGATACCACCACCACCAAATCAT...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTTCTATCATGATTTGGTaGTGGTGGTATCGGAGTGAG +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSSIMIW*WWYRSE
Trigger: CTCACTCCGATACCACCACCACCAAATCATGATAGA...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTTTCAAAGCTATTCAGTaGGCTTTCTTCCCTGCTTCC +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSFKAIQ*AFFPAS
Trigger: GGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAA...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
42% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
3UTR CAA 72 bp ATCCTTGAGTTTGGGGATCTGGGGCTTCTGGCTAGTTaGATAACTGAAGTTTCTATTTCAGTCTGCTATCTT +
Preference number: 4 (lower is better)
Translates to: ILEFGDLGLLAS*ITEVSISVCYL
Trigger: AAGATAGCAGACTGAAATAGAAACTTCAGTTATCAAACTAGCCAGAAGCCCCAGATCCCCAAACTCAAGGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
3UTR CAA 72 bp TGTAATAGGTGTACTAGGAGTGAACGTTTCTCCTCTTaGTCTCTCAGAAGCCAGTTACAGGTAAAAGCTAAG +
Preference number: 4 (lower is better)
Translates to: CNRCTRSERFSS*SLRSQLQVKAK
Trigger: CTTAGCTTTTACCTGTAACTGGCTTCTGAGAGACAAAGAGGAGAAACGTTCACTCCTAGTACACCTATTACA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTATTCCAAGAAGCAAGTaGACTTTGATAGAACAGGTC +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAIPRSK*TLIEQV
Trigger: GACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAAT...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCATTCCATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: ASELFHPMLLSHDCKHHSISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...GGAATGATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGC
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAACTTCTCGGCCTCCTTaGATATTCTCTGTGCATCCC +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSTSRPP*IFSVHP
Trigger: GGGATGCACAGAGAATATTCAAGGAGGCCGAGAAGT...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCTGCAGAAAGTGACATaGTTTCCCCAACAGCTTCAT +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDLQKVT*FPQQLH
Trigger: ATGAAGCTGTTGGGGAAATCATGTCACTTTCTGCAG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCTCTGCAGCTGTAATATTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: IVIVTSSATVSSTSAAVIFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...TATTACAGCTGCAGAGGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGAT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AGCAGCTTCTTGAATGCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAAGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: SSFLNALVPELKQEISTKVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...TTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGCATTCAAGAAGCTGCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp GCATTGGTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: ALVPELKQEISTKFPKYVSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...CACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTACCAATGC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp AACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: NIQLEFPFTPQLENSRNERAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...CTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTAAGGGCTCAAAGTAGTTaGGCAGTGGCCTTACATTCA +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLRAQSS*AVALHS
Trigger: TGAATGTAAGGCCACTGCTCAACTACTTTGAGCCCT...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAGGCTTATCCTCACTTTaGTGCTTTGGTCTGCATATG +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSGLSSL*CFGLHM
Trigger: CATATGCAGACCAAAGCATCAAAGTGAGGATAAGCC...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGTGGAAGCATATGCAACAGATaGTCGGAACAGGTACATTTC +
Preference number: 4 (lower is better)
Translates to: VPELKQEISTKFPKYVSGSICNR*SEQVHF
Trigger: GAAATGTACCTGTTCCGATCATCTGTTGCATATGCT...TCCACTCACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR TCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTTCCCTGAACAGCCTGTaGGACCAAATACACACTTTC +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCSLNSL*DQIHTF
Trigger: GAAAGTGTGTATTTGGTCTCACAGGCTGTTCAGGGA...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATTGTCAGGGAGATGTTaGTCAAGCACCTTGGAAGTG +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLLSGRC*SSTLEV
Trigger: CACTTCCAAGGTGCTTGATCAACATCTCCCTGACAA...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCAAATCTAGCATTTATTaGGTGTCTGCTTTGTGCTCA +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFKSSIY*VSALCS
Trigger: TGAGCACAAAGCAGACACTCAATAAATGCTAGATTT...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAGGATGGTGCAGATGGTaGTGCGAAATGTTGATTGTA +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSGWCRW*CEMLIV
Trigger: TACAATCAACATTTCGCATCACCATCTGCACCATCC...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATGGATGGTGCAGATGGTaGTGCGAAATGTTGATTGTA +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDGWCRW*CEMLIV
Trigger: TACAATCAACATTTCGCATCACCATCTGCACCATCC...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATGTAGCAGGTGTTACCTaGACATTTGTGAACATTTTA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYVAGVT*TFVNIL
Trigger: TAAAATGTTCACAAATGTTCAGGTAACACCTGCTAC...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAATGTCCTCTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENNVLYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAGAGGACATT...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000471548.5
CDS-3UTR TCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCACAGAGCTCTCCTCAATaGAGCACTTGTAAAACGATC +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSQSSPQ*STCKTI
Trigger: GATCGTTTTACAAGTGCTTCATTGAGGAGAGCTCTG...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000677282.1
CDS-3UTR GCA 90 bp GTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGTGGATTGTGTTCAACCGTTTaGTCTTGTCTTCTGAGAGCA +
Preference number: 4 (lower is better)
Translates to: VPELKQEISTKFPKYVSGLCSTV*SCLLRA
Trigger: TGCTCTCAGAAGACAAGAGCAAACGGTTGAACACAA...TCCACTCACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp TGCATTTCATTGTTGTGTCTTTTCCTAGCCAGTAAGCCCATAAATAGTCACCAACCCAACAATCGTGAGTaGTTGTTTGAGCAGGAAGTT +
Preference number: 4 (lower is better)
Translates to: CISLLCLFLASKPINSHQPNNRE*LFEQEV
Trigger: AACTTCCTGCTCAAACAAGCACTCACGATTGTTGGG...TTGGTGACTATTTATGGGCTTACTGGCTAGGAAAAGACACAACAATGAAATGCA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR GCA 90 bp GTACCTGAGCTGAAGCAGGAAATCTCTACAAAATTTCCTAAGTATGTGAGTGGAGAGATGTCACATTTGTaGAGAGGGCCTTCATGTTTA +
Preference number: 4 (lower is better)
Translates to: VPELKQEISTKFPKYVSGEMSHL*RGPSCL
Trigger: TAAACATGAAGGCCCTCTGCACAAATGTGACATCTC...TCCACTCACATACTTAGGAAATTTTGTAGAGATTTCCTGCTTCAGCTCAGGTAC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678046.1
CDS-3UTR GCA 90 bp ACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACACAAGATCCAACACTTaGTCCAATGATATATCCTTG +
Preference number: 4 (lower is better)
Translates to: TESNVNEDALSLAMLSLDTRSNT*SNDISL
Trigger: CAAGGATATATCATTGGAGCAAGTGTTGGATCTTGT...GTCCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAAATTATATTGTATGTTaGCCCAAGCTGTGGGCCCAG +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSNYIVC*PKLWAQ
Trigger: CTGGGCCCACAGCTTGGGGCAACATACAATATAATT...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp CCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGGCATGCTCTGGGAGTTCTGCAGAAATTATTCTTaGACTGTGCTGAACCAAGTT +
Preference number: 4 (lower is better)
Translates to: PQLENSRNEFLSGMLWEFCRNYS*TVLNQV
Trigger: AACTTGGTTCAGCACAGTGCAAGAATAATTTCTGCA...GAACTCCCAGAGCATGCCTGATAGAAACTCATTTCTACTGTTCTCTAACTGTGG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GGTACCACTAGAGGTTTATCAGAAAACAAGTCCAGTGATGCTAGGAGGAGCCAAGATGAAATTGGTTCCTaGAGAAATTATTCTTGCACT +
Preference number: 4 (lower is better)
Translates to: GTTRGLSENKSSDARRSQDEIGS*RNYSCT
Trigger: AGTGCAAGAATAATTTCTGCAGGAACCAATTTCATC...TTGGCTCCTCCTAGCATCACTGGACTTGTTTTCTGATAAACCTCTAGTGGTACC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp TCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGCCAATTAAACCCTGCTaGTATTTTCCAGAGATCAGT +
Preference number: 4 (lower is better)
Translates to: SEGEHTVGISIHSTVREQPIKPC*YFPEIS
Trigger: ACTGATCTCTGGAAAATAGCAGCAGGGTTTAATTGG...CTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR GCA 90 bp GAGACTTTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACACAACATGGCCAAGACTaGTTTGTGGAAGTATCCTGG +
Preference number: 4 (lower is better)
Translates to: ETFRNFLLKGRSICSFMTQHGQD*FVEVSW
Trigger: CCAGGATACTTCCACAAAGCAGTCTTGGCCATGTTG...TGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAAAGTCTC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCACCTGTTCCTCAATGGTaGACTGAGCAGCAGTTACAG +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSPVPQW*TEQQLQ
Trigger: CTGTAACTGCTGCTCAGTCCACCATTGAGGAACAGG...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCATGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSCPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GAACAGCCTCTGAATTGTTCCATCCAATGTTATTATCACATGACTGCAAACATCTGTCCAAAAATGTCTTaGCCTGTTCCTCAATGGTGG +
Preference number: 4 (lower is better)
Translates to: EQPLNCSIQCYYHMTANICPKMS*PVPQWW
Trigger: CCACCATTGAGGAACAGGCCAAGACATTTTTGGACA...GATGTTTGCAGTCATGTGATAATAACATTGGATGGAACAATTCAGAGGCTGTTC
41% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCATGTAGTGGATACATTTaGGCAAGTGTGGACTGTTCC +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSCSGYI*ASVDCS
Trigger: GGAACAGTCCACACTTGCCCAAATGTATCCACTACA...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGACAAAACGTAAAGAAGCCCCAGCACATAAGTAAGCACAAGGAGTGTGTAAATAGGGAGGCATCCAATTaGACTGATATAGGAAGGATA +
Preference number: 4 (lower is better)
Translates to: RQNVKKPQHISKHKECVNREASN*TDIGRI
Trigger: TATCCTTCCTATATCAGTCCAATTGGATGCCTCCCT...ATTTACACACTCCTTGTGCTTACTTATGTGCTGGGGCTTCTTTACGTTTTGTCT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTCTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: DSKHHCRQITIVLELSYCLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGCATTTCATTGTTGTGTCTTTTCCTAGCCAGTAAGCCCATAAATAGTCACCAACTGGGTCCGTTAGCATaGAATTTTCCCAGAATCCTT +
Preference number: 4 (lower is better)
Translates to: CISLLCLFLASKPINSHQLGPLA*NFPRIL
Trigger: AAGGATTCTGGGAAAATTCCATGCTAACGGACCCAG...TTGGTGACTATTTATGGGCTTACTGGCTAGGAAAAGACACAACAATGAAATGCA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCATCCCCAACAGCTTCATaGAATCCTTCATTAGCTCCA +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSSPTAS*NPSLAP
Trigger: TGGAGCTAATGAAGGATTCCATGAAGCTGTTGGGGA...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AACAAAGTATTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTGCTTTGGTCTGCATATaGACTCCAGTCGGTACTCCA +
Preference number: 4 (lower is better)
Translates to: NKVLFLIVIVTSSATVSSALVCI*TPVGTP
Trigger: TGGAGTACCGACTGGAGTCCATATGCAGACCAAAGC...AGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAATACTTTGTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCACTCACTTTGATGCTTTaGTCTGCATATGGACTCCAG +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSLTLML*SAYGLQ
Trigger: CTGGAGTCCATATGCAGACCAAAGCATCAAAGTGAG...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCAAGGAGGTCCAAGTGTTaGCTGTATCCCCAGAAACTC +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSRRSKC*LYPQKL
Trigger: GAGTTTCTGGGGATACAGCCAACACTTGGACCTCCT...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTCCTTTGAACTTGGGTTaGGCGCTATTCAAAACTCAG +
Preference number: 4 (lower is better)
Translates to: DSKHHCRQITIVLELSYCPLNLG*ALFKTQ
Trigger: CTGAGTTTTGAATAGCGCCCAACCCAAGTTCAAAGG...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000427411.2
CDS-3UTR CCA 90 bp CCTACCAGAAGTCAAACACAAAGTCAAGAGGGTCTGGCAAAACTCACCTCATATAAACTGTCTATGAAATaGTTGCTTAGCCAAGGAGTA +
Preference number: 4 (lower is better)
Translates to: PTRSQTQSQEGLAKLTSYKLSMK*LLSQGV
Trigger: TACTCCTTGGCTAAGCAACCATTTCATAGACAGTTT...ATATGAGGTGAGTTTTGCCAGACCCTCTTGACTTTGTGTTTGACTTCTGGTAGG
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp CTTCAGAGGGTGAACATACAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACTTTCTGTGTTACAGTTaGACACTATGTCACATGCAC +
Preference number: 4 (lower is better)
Translates to: LQRVNIQLEFPFTPQLENFLCYS*TLCHMH
Trigger: GTGCATGTGACATAGTGTCCAACTGTAACACAGAAA...GTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTGTATGTTCACCCTCTGAAG
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTGAAGAAAGCATGTCAAGCACCTGCCATTTCTaGCCTGATCACTATGTTTCT +
Preference number: 4 (lower is better)
Translates to: CRQITIVLELSYCEESMSSTCHF*PDHYVS
Trigger: AGAAACATAGTGATCAGGCCAGAAATGGCAGGTGCT...TGACATGCTTTCTTCACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCAAAGGGACAGAGAGTaGGCTGATACAGAGTTGTTT +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDQRDRE*ADTELF
Trigger: AAACAACTCTGTATCAGCCCACTCTCTGTCCCTTTG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR CCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTATCATGATTTGGTGGTaGTGGTATCGGAGTGAGTTT +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSIMIWW*WYRSEF
Trigger: AAACTCACTCCGATACCACCACCACCAAATCATGAT...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGGGGAGATTCCAAGAAGCAAGTaGACTTTGATAGAACAGGTC +
Preference number: 4 (lower is better)
Translates to: FRNFLLKGRSICSFMTGEIPRSK*TLIEQV
Trigger: GACCTGTTCTATCAAAGTTCACTTGCTTCTTGGAAT...CTCCCCTGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTAGGCATCCAATTGGACTaGTATAGGAAGGATAGGCAT +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLGIQLD*YRKDRH
Trigger: ATGCCTATCCTTCCTATATCAGTCCAATTGGATGCC...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTAATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp AAAGTATTGTTTCTTATCGTCATTGTAACTAGTTCTGCAACTGTCTCCTCTACCATATCACCAAGCAAATaGGCAGGGAGGCATCCAATT +
Preference number: 4 (lower is better)
Translates to: KVLFLIVIVTSSATVSSTISPSK*AGRHPI
Trigger: AATTGGATGCCTCCCTGCTCATTTGCTTGGTGATAT...GGTAGAGGAGACAGTTGCAGAACTAGTTACAATGACGATAAGAAACAATACTTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTTTTTCCCAGAATCCTTaGGTCATATTAGGAAGACCA +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSFSQNP*VILGRP
Trigger: TGGTCTTCCTAATATGACTCAAGGATTCTGGGAAAA...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
40% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TTATCCCTTCAAAGCTATTCAGTGGGCTTTCTTCCCTGCTTCCAAATAAAGTCTTTCTTGAAAATCGGGTaGCAGAAGACCAATGGATTT +
Preference number: 4 (lower is better)
Translates to: LSLQSYSVGFLPCFQIKSFLKIG*QKTNGF
Trigger: AAATCCATTGGTCTTCTGTCACCCGATTTTCAAGAA...AGACTTTATTTGGAAGCAGGGAAGAAAGCCCACTGAATAGCTTTGAAGGGATAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp TTTAGGAATTTCCTACTGAAGGGCAGATCCATATGTAGTTTTATGACAGGGGAGGTTTCATTGTCTTCTTaGAAATCGGGTGACAGAAGA +
Preference number: 4 (lower is better)
Translates to: FRNFLLKGRSICSFMTGEVSLSS*KSGDRR
Trigger: TCTTCTGTCACCCGATTTTCAAGAAGACAATGAAAC...CTCCCCTGTCATAAAACTACATATGGATCTGCCCTTCAGTAGGAAATTCCTAAA
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000679278.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATAGCTTCTGTAGAGTTTaGGATGTCACATTTGTGCAG +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDSFCRV*DVTFVQ
Trigger: CTGCACAAATGTGACATCTCAAACTCTACAGAAGCT...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTCAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TCACCTTACTTAGGCAGTTCAAGGCTAGCTGAGATAATACACATGAACATTAAACAAGCCTCAGCATATTaGACAGTTTCTGTCCAGCTT +
Preference number: 4 (lower is better)
Translates to: SPYLGSSRLAEIIHMNIKQASAY*TVSVQL
Trigger: AAGCTGGACAGAAACTGTTCAATATGCTGAGGCTTG...TTTAATGTTCATGTGTATTATCTCAGCTAGCCTTGAACTGCCTAAGTAAGGTGA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000679162.1
ENST00000679212.1
CDS-3UTR TCA 90 bp AGATCTTGTGGCAACTACAAAGGATGTTTAGATAGCAGTAGCTTGACAGAAGATCACTGTCCTTACAAGTaGTCCATCCATATTCCATAC +
Preference number: 4 (lower is better)
Translates to: RSCGNYKGCLDSSSLTEDHCPYK*SIHIPY
Trigger: GTATGGAATATGGATGGATCACTTGTAAGGACAGTG...ATCTTCTGTCAAGCTACTGCTATCTAAACATCCTTTGTAGTTGCCACAAGATCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTTTAGACCTGTCACCTTaGAGAAAGCATGATCGATTC +
Preference number: 4 (lower is better)
Translates to: DSKHHCRQITIVLELSYCLDLSP*RKHDRF
Trigger: GAATCGATCATGCTTTCTTCAAGGTGACAGGTCTAA...ACAGTAACTCAGTTCAAGTACTATGGTGATTTGCCTACAGTGATGTTTGGAATC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp CAGTTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTAACCCACTTCAGAGGGTaGACATACAGTTGGAATTTC +
Preference number: 4 (lower is better)
Translates to: QLEFPFTPQLENSRNEFLTHFRG*TYSWNF
Trigger: GAAATTCCAACTGTATGTTCACCCTCTGAAGTGGGT...TAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAACTG
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000252519.8
ENST00000427411.2
ENST00000471548.5
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTAAATCTAGCATTTATTaGGTGTCTGCTTTGTGCTCA +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAKSSIY*VSALCS
Trigger: TGAGCACAAAGCAGACACTCAATAAATGCTAGATTT...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATACTGAAAGCAATGTCAATGAAGATGCTCTCTCCTTGGCCATGTTGTCTTTGGACTAAAACCTCCTCATaGGATTTTCTCTCTTATCAG +
Preference number: 4 (lower is better)
Translates to: ILKAMSMKMLSPWPCCLWTKTSS*DFLSYQ
Trigger: CTGATAAGAGAGAAAATCTCATGAGGAGGTTTTAGT...CCAAAGACAACATGGCCAAGGAGAGAGCATCTTCATTGACATTGCTTTCAGTAT
40% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000427411.2
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp TTGGAATTTCCATTCACTCCACAGTTAGAGAACAGTAGAAATGAGTTTCTATCATGTTTCTCTGGTCTGTaGGCTCCACAATGGACCTTT +
Preference number: 4 (lower is better)
Translates to: LEFPFTPQLENSRNEFLSCFSGL*APQWTF
Trigger: AAAGGTCCATTGTGGAGCTCACAGACCAGAGAAACA...TGATAGAAACTCATTTCTACTGTTCTCTAACTGTGGAGTGAATGGAAATTCCAA
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp ATCCATCCATATTCCATACAAGATCCAACACTTGCTCCAATGATATATCCTTGTGGAAGAATAGTTCATTaGGAGACACCAGAGAAGAGG +
Preference number: 4 (lower is better)
Translates to: IHPYSIQDPTLAPMIYPCGRIVH*ETPEKR
Trigger: CCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCC...ACAAGGATATATCATTGGAGCAAGTGTTGGATCTTGTATGGAATATGGATGGAT
40% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GGCTCTCAAATTAGGAAGAATAGTTCATTGAGAGACACCAGAGAAGAGGAAGCTATTTCAACACAGAATTaGCACTCGTTAACAGTCTTC +
Preference number: 4 (lower is better)
Translates to: GSQIRKNSSLRDTREEEAISTQN*HSLTVF
Trigger: GAAGACTGTTAACGAGTGTCAATTCTGTGTTGAAAT...AGCTTCCTCTTCTCTGGTGTCTCTCAATGAACTATTCTTCCTAATTTGAGAGCC
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000427411.2
ENST00000677282.1
ENST00000678073.1
ENST00000680121.1
CDS-3UTR TCA 90 bp GATTCCAAACATCACTGTAGGCAAATCACCATAGTACTTGAACTGAGTTACTGTAGGGCACCATTACAATaGAGAGACACCCCAATTAAA +