RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for AARS1 (Homo sapiens)

Ensembl gene IDs: ENSG00000090861

Ensembl transcript IDs: ENST00000261772.13, ENST00000564359.6, ENST00000565361.3, ENST00000566969.1, ENST00000569825.2, ENST00000674512.1, ENST00000674652.1, ENST00000674691.1, ENST00000674768.1, ENST00000674811.1, ENST00000674848.1, ENST00000674962.1, ENST00000674963.1, ENST00000675035.1, ENST00000675045.1, ENST00000675120.1, ENST00000675133.1, ENST00000675155.1, ENST00000675270.1, ENST00000675297.1, ENST00000675338.1, ENST00000675371.1, ENST00000675403.1, ENST00000675569.1, ENST00000675588.1, ENST00000675643.1, ENST00000675691.1, ENST00000675751.1, ENST00000675853.1, ENST00000675953.1, ENST00000675986.1, ENST00000676004.1, ENST00000676040.1, ENST00000676065.1, ENST00000676168.1, ENST00000676209.1, ENST00000676211.1, ENST00000676212.1, ENST00000676247.1

Found 4505 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR CCA 90 bp GCGCATGGGCTGTCGAGAGAGCGGCGGGAGGCACTACAGCGCCCCTaGAGGCCCGGAGGGAGAACGGCCCGGTCCCAGTTGTGCAGGGTA +
Preference number: 1 (lower is better)
Translates to: AHGLSRERREALQRP*RPGGRTARSQLCRV
Trigger: TACCCTGCACAACTGGGACCGGGCCGTTCTCCCTCCGGGCCTCCAGGGGCGCTGTAGTGCCTCCCGCCGCTCTCTCGACAGCCCATGCGC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR GCA 90 bp CCGAGGCGCAGCTGGGCGAAGGAAGTGGCCAGCTGCAGCGCCTCCTaGAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACATCC +
Preference number: 1 (lower is better)
Translates to: PRRSWAKEVASCSAS*RQPTFLPVACADTS
Trigger: GGATGTGTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR TCA 90 bp GACCTGGCTCAGGCCACGGTGCTGGAGCAGGGACCCTCACTAGTGTaGGCATTTGCAGCCCTCAGAAGGCCTGCCACCCACCCCTACCCC +
Preference number: 1 (lower is better)
Translates to: DLAQATVLEQGPSLV*AFAALRRPATHPYP
Trigger: GGGGTAGGGGTGGGTGGCAGGCCTTCTGAGGGCTGCAAATGCTCACACTAGTGAGGGTCCCTGCTCCAGCACCGTGGCCTGAGCCAGGTC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR GCA 90 bp CACATATCCACGCCCTGTGTTGTCAGGCCGGCCACCATCAGCCAGTaGCACAGTGATGGTCCGAGCGTGGTCAGCCAGCACCCGGTAGGC +
Preference number: 1 (lower is better)
Translates to: HISTPCVVRPATISQ*HSDGPSVVSQHPVG
Trigger: GCCTACCGGGTGCTGGCTGACCACGCTCGGACCATCACTGTGGCACTGGCTGATGGTGGCCGGCCTGACAACACAGGGCGTGGATATGTG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR CCA 90 bp CCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGAAGTaGCCAGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTG +
Preference number: 1 (lower is better)
Translates to: PLSSLHPRGAAGRRK*PAAAPPAGSQRSCL
Trigger: CAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR TCA 90 bp ACAGATGATTTCCTGAAGACGGGGCATGTTTCATGCACCAGGCCCTaGGGACGGAGGGAGGGAAGCCGCCCCTACCTCTCCAAGGTCAGC +
Preference number: 1 (lower is better)
Translates to: TDDFLKTGHVSCTRP*GRREGSRPYLSKVS
Trigger: GCTGACCTTGGAGAGGTAGGGGCGGCTTCCCTCCCTCCGTCCTCAGGGCCTGGTGCATGAAACATGCCCCGTCTTCAGGAAATCATCTGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR GCA 90 bp AGCCTTAGCCCATTCCCCAAATCCCTCCACCCCAGTGCCCATACATaGTTGGGAAGAGCTCTCCTGCTAGCAGCACTGGGAGCAGCAGGG +
Preference number: 1 (lower is better)
Translates to: SLSPFPKSLHPSAHT*LGRALLLAALGAAG
Trigger: CCCTGCTGCTCCCAGTGCTGCTAGCAGGAGAGCTCTTCCCAAGCATGTATGGGCACTGGGGTGGAGGGATTTGGGGAATGGGCTAAGGCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR CCA 90 bp CAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCT +
Preference number: 1 (lower is better)
Translates to: QGQDRSHQTQPVGPG*LSLLPGGNPGYRRP
Trigger: AGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR CCA 90 bp CAGGCCCAGAGGGGTCATCCAGCAACTCGGACACCGGGACCCCAATaGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAACACAG +
Preference number: 1 (lower is better)
Translates to: QAQRGHPATRTPGPQ*RRLAQGQDRSHQTQ
Trigger: CTGTGTTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGATGACCCCTCTGGGCCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR CCA 90 bp AGGAAAGCATGGTCCTGCAGGCAGGACTCGGGTTCCAACCTGGCTTaGCCTAGCACGTGCCATGAGCTTCCTCAATCACACGCCACGTGC +
Preference number: 1 (lower is better)
Translates to: RKAWSCRQDSGSNLA*PSTCHELPQSHATC
Trigger: GCACGTGGCGTGTGATTGAGGAAGCTCATGGCACGTGCTAGGCCAAGCCAGGTTGGAACCCGAGTCCTGCCTGCAGGACCATGCTTTCCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR CCA 90 bp CACATGCAGGGAGCTGCTGCTCCTCCCAATCTCAATCCCAGACCGTaGGCCCTTAGGCAACCACTTCGCTCAGAGCCACAGAGGCCACAT +
Preference number: 1 (lower is better)
Translates to: HMQGAAAPPNLNPRP*ALRQPLRSEPQRPH
Trigger: ATGTGGCCTCTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGGCCCACGGTCTGGGATTGAGATTGGGAGGAGCAGCAGCTCCCTGCATGTG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR GCA 90 bp TGGTCAGCTTCCCCAAGCACTGAGCGCAGGGCGAAGTTCAGAATGTaGGTAGCTGTGTGGTTGCTCATGATGGGTCTTCGTCGGGGCTCA +
Preference number: 1 (lower is better)
Translates to: WSASPSTERRAKFRM*VAVWLLMMGLRRGS
Trigger: TGAGCCCCGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCTGACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR GCA 90 bp CCTTGCCCACATCGTCCAGGTCATTATGTTTGCCCCCAGCCCGGATaGACTTCTGGGTATTGGCAGCTCTGCTCAGCTTTGCCATGGGGT +
Preference number: 1 (lower is better)
Translates to: PCPHRPGHYVCPQPG*TSGYWQLCSALPWG
Trigger: ACCCCATGGCAAAGCTGAGCAGAGCTGCCAATACCCAGAAGTGCATCCGGGCTGGGGGCAAACATAATGACCTGGACGATGTGGGCAAGG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR CCA 90 bp CACTGGGAGCAGCAGGGAATGTCCAGGGTCCAAGGACAGGATCCATaGGGTCCCTGCTACAAGGCTACAGGACAACAGAAGTCAGCCCAA +
Preference number: 1 (lower is better)
Translates to: HWEQQGMSRVQGQDP*GPCYKATGQQKSAQ
Trigger: TTGGGCTGACTTCTGTTGTCCTGTAGCCTTGTAGCAGGGACCCCATGGATCCTGTCCTTGGACCCTGGACATTCCCTGCTGCTCCCAGTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR TCA 90 bp AGCCAAGCAGTGTCTCCGGGAATGGTCTTGCTGTCTCCCAGGCTCTaGATTTTCCTGTCCAGGATGCGACGCCCTCTGCTGAGAGTCTTG +
Preference number: 1 (lower is better)
Translates to: SQAVSPGMVLLSPRL*IFLSRMRRPLLRVL
Trigger: CAAGACTCTCAGCAGAGGGCGTCGCATCCTGGACAGGAAAATTCAGAGCCTGGGAGACAGCAAGACCATTCCCGGAGACACTGCTTGGCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR GCA 90 bp CAGCAGGGAATGTCCAGGGTCCAAGGACAGGATCCATGGGGTCCCTaGTACAAGGCTACAGGACAACAGAAGTCAGCCCAAAGGCCCATT +
Preference number: 1 (lower is better)
Translates to: QQGMSRVQGQDPWGP*YKATGQQKSAQRPI
Trigger: AATGGGCCTTTGGGCTGACTTCTGTTGTCCTGTAGCCTTGTAGCAGGGACCCCATGGATCCTGTCCTTGGACCCTGGACATTCCCTGCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR GCA 90 bp GTTCCAGATCTCCAGCACATTAGGGTCGTCCTGGTTGACAAGATGTaGGGCGTCCCGACCACCAATCCGGTCGTAGTGGATCTCACTGCA +
Preference number: 1 (lower is better)
Translates to: VPDLQHIRVVLVDKM*GVPTTNPVVVDLTA
Trigger: TGCAGTGAGATCCACTACGACCGGATTGGTGGTCGGGACGCCGCACATCTTGTCAACCAGGACGACCCTAATGTGCTGGAGATCTGGAAC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR TCA 90 bp CCAAAGGCCCATTCCACCAAGAACCAGGGCCTGACTGACTACAGATaGTTTCCTGAAGACGGGGCATGTTTCATGCACCAGGCCCTGAGG +
Preference number: 1 (lower is better)
Translates to: PKAHSTKNQGLTDYR*FPEDGACFMHQALR
Trigger: CCTCAGGGCCTGGTGCATGAAACATGCCCCGTCTTCAGGAAATCATCTGTAGTCAGTCAGGCCCTGGTTCTTGGTGGAATGGGCCTTTGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR CCA 90 bp CATAGAAACAGGTCTTGTCCAGCACCACTCCACACTCCTGGCCTGTaGACACCTCTTCCACGAACATCTTCTCCCTGCGCAGAGCCATCA +
Preference number: 1 (lower is better)
Translates to: HRNRSCPAPLHTPGL*TPLPRTSSPCAEPS
Trigger: TGATGGCTCTGCGCAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGGAGTGTGGAGTGGTGCTGGACAAGACCTGTTTCTATG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR CCA 90 bp CCAGGTCATTATGTTTGCCCCCAGCCCGGATGCACTTCTGGGTATTaGCAGCTCTGCTCAGCTTTGCCATGGGGTGAGATGGGTCAATTG +
Preference number: 1 (lower is better)
Translates to: PGHYVCPQPGCTSGY*QLCSALPWGEMGQL
Trigger: CAATTGACCCATCTCACCCCATGGCAAAGCTGAGCAGAGCTGCCAATACCCAGAAGTGCATCCGGGCTGGGGGCAAACATAATGACCTGG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR GCA 90 bp TGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATaGGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCT +
Preference number: 1 (lower is better)
Translates to: WRAVIYRCERDDQQQ*GVSGSRPMALTWRA
Trigger: AGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR GCA 90 bp GATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAAAGCTCCTaGATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAAC +
Preference number: 1 (lower is better)
Translates to: DTLGNGFFRHDHKSS*MTRVPQVRSPTELN
Trigger: GTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR GCA 90 bp TTTGAGAGTCTCCCGCAATTCATCCTTCTGCCACTGGGGGATGACTaGAGTGGCCAGGGCCTGGAACCAATAGACGACCATCTCAATCTG +
Preference number: 1 (lower is better)
Translates to: FESLPQFILLPLGDD*SGQGLEPIDDHLNL
Trigger: CAGATTGAGATGGTCGTCTATTGGTTCCAGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR GCA 90 bp TATGTTTGCCCCCAGCCCGGATGCACTTCTGGGTATTGGCAGCTCTaGTCAGCTTTGCCATGGGGTGAGATGGGTCAATTGTGTTCAGGA +
Preference number: 1 (lower is better)
Translates to: YVCPQPGCTSGYWQL*SALPWGEMGQLCSG
Trigger: TCCTGAACACAATTGACCCATCTCACCCCATGGCAAAGCTGAGCAGAGCTGCCAATACCCAGAAGTGCATCCGGGCTGGGGGCAAACATA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR GCA 90 bp ACCAAGAGCCCAGCATCTCGAAGAAGGTGTGATGATAGACATCCTTaGCCACATCGTCCAGGTCATTATGTTTGCCCCCAGCCCGGATGC +
Preference number: 1 (lower is better)
Translates to: TKSPASRRRCDDRHP*PHRPGHYVCPQPGC
Trigger: GCATCCGGGCTGGGGGCAAACATAATGACCTGGACGATGTGGGCAAGGATGTCTATCATCACACCTTCTTCGAGATGCTGGGCTCTTGGT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR CCA 90 bp CCAAGCACTGAGCGCAGGGCGAAGTTCAGAATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTTCGTCGGGGCTCATCAATAAACAGC +
Preference number: 1 (lower is better)
Translates to: PSTERRAKFRMCVAV*LLMMGLRRGSSINS
Trigger: GCTGTTTATTGATGAGCCCCGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGCCCTGCGCTCAGTGCTTGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR CCA 90 bp TACCACCAGGCCCTTCTCTTCAGCAATCAGTCCAGTCAGATCCACTaGAAACCCATAGGTGTCATAGAGGAGCCAAGCAGTGTCTCCGGG +
Preference number: 1 (lower is better)
Translates to: YHQALLFSNQSSQIH*KPIGVIEEPSSVSG
Trigger: CCCGGAGACACTGCTTGGCTCCTCTATGACACCTATGGGTTTCCAGTGGATCTGACTGGACTGATTGCTGAAGAGAAGGGCCTGGTGGTA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR TCA 90 bp ATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTaGGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTCAGGGCC +
Preference number: 1 (lower is better)
Translates to: ILPASLSTVKSMAEV*GECILKSFKASFRA
Trigger: GGCCCTGAATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGAT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR TCA 90 bp GGCTTCTCTGCTTCCAACTACCTCCACCCCTCATCTACTGAATTATaGACGCCTTGCTCCAAGTCACCCCACCTATTTGGCCTCCACCTC +
Preference number: 1 (lower is better)
Translates to: GFSASNYLHPSSTEL*TPCSKSPHLFGLHL
Trigger: GAGGTGGAGGCCAAATAGGTGGGGTGACTTGGAGCAAGGCGTTCATAATTCAGTAGATGAGGGGTGGAGGTAGTTGGAAGCAGAGAAGCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR GCA 90 bp TGTGATGATAGACATCCTTGCCCACATCGTCCAGGTCATTATGTTTaGCCCCAGCCCGGATGCACTTCTGGGTATTGGCAGCTCTGCTCA +
Preference number: 1 (lower is better)
Translates to: CDDRHPCPHRPGHYV*PQPGCTSGYWQLCS
Trigger: TGAGCAGAGCTGCCAATACCCAGAAGTGCATCCGGGCTGGGGGCAAACATAATGACCTGGACGATGTGGGCAAGGATGTCTATCATCACA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR CCA 90 bp GTAAAGTCAAATCTGAGGCGGTCAGGAGCAACCAATGAGCCTTTCTaGTCAGCTTCCCCAAGCACTGAGCGCAGGGCGAAGTTCAGAATG +
Preference number: 1 (lower is better)
Translates to: VKSNLRRSGATNEPF*SASPSTERRAKFRM
Trigger: CATTCTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGACCGCCTCAGATTTGACTTTAC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR TCA 90 bp CAACAGAAGTCAGCCCAAAGGCCCATTCCACCAAGAACCAGGGCCTaGCTGACTACAGATGATTTCCTGAAGACGGGGCATGTTTCATGC +
Preference number: 1 (lower is better)
Translates to: QQKSAQRPIPPRTRA*LTTDDFLKTGHVSC
Trigger: GCATGAAACATGCCCCGTCTTCAGGAAATCATCTGTAGTCAGTCAGGCCCTGGTTCTTGGTGGAATGGGCCTTTGGGCTGACTTCTGTTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR CCA 90 bp TCCACTAACGTAGCAAAGAAGCCCCTGCTGGCATTGAGCTTTTCATaGGCGTATCGGACAGCTCGGCGGAGAATCCGTCTCAACACATAT +
Preference number: 1 (lower is better)
Translates to: STNVAKKPLLALSFS*AYRTARRRIRLNTY
Trigger: ATATGTGTTGAGACGGATTCTCCGCCGAGCTGTCCGATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCTTCTTTGCTACGTTAGTGGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR TCA 90 bp AGGGGCTCTTTAAAGGTCCCAAGATTCAAATGTTCTTGTAGCAGATaGAGAGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTC +
Preference number: 1 (lower is better)
Translates to: RGSLKVPRFKCSCSR*RALGWTDGSSGSLL
Trigger: GAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACATTTGAATCTTGGGACCTTTAAAGAGCCCCT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR TCA 90 bp CAAGAAAGGCTTCTCTGCTTCCAACTACCTCCACCCCTCATCTACTaGATTATGAACGCCTTGCTCCAAGTCACCCCACCTATTTGGCCT +
Preference number: 1 (lower is better)
Translates to: QERLLCFQLPPPLIY*IMNALLQVTPPIWP
Trigger: AGGCCAAATAGGTGGGGTGACTTGGAGCAAGGCGTTCATAATTCAGTAGATGAGGGGTGGAGGTAGTTGGAAGCAGAGAAGCCTTTCTTG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR GCA 90 bp GCTTGGCCTAGCACGTGCCATGAGCTTCCTCAATCACACGCCACGTaGAAAGTCAAGGGCATCAGTATGGGAATTTCCAACTATTTTGTT +
Preference number: 1 (lower is better)
Translates to: AWPSTCHELPQSHAT*KVKGISMGISNYFV
Trigger: AACAAAATAGTTGGAAATTCCCATACTGATGCCCTTGACTTTGCACGTGGCGTGTGATTGAGGAAGCTCATGGCACGTGCTAGGCCAAGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR CCA 90 bp GCCTCAATCATCTCATTAGCAATCTCTTCAGCCTTCTTGATCTGTTaGGTGGACATGGCTCCCTTGGCAGTAAAGTCAAATCTGAGGCGG +
Preference number: 1 (lower is better)
Translates to: ASIISLAISSAFLIC*VDMAPLAVKSNLRR
Trigger: CCGCCTCAGATTTGACTTTACTGCCAAGGGAGCCATGTCCACCCAACAGATCAAGAAGGCTGAAGAGATTGCTAATGAGATGATTGAGGC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR CCA 90 bp CTTCTGGGTATTGGCAGCTCTGCTCAGCTTTGCCATGGGGTGAGATaGGTCAATTGTGTTCAGGAAAATGGGTTTAAACGACTATGTGAG +
Preference number: 1 (lower is better)
Translates to: LLGIGSSAQLCHGVR*VNCVQENGFKRLCE
Trigger: CTCACATAGTCGTTTAAACCCATTTTCCTGAACACAATTGACCCATCTCACCCCATGGCAAAGCTGAGCAGAGCTGCCAATACCCAGAAG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR GCA 90 bp AGAGATCATGCGGCATTAAGTATTGCACGTGGTCCTTTTATTCTCTaGAGCAAAAACGATTCCTACTTGCTGACGCGGAAAGCTCAGGTC +
Preference number: 1 (lower is better)
Translates to: RDHAALSIARGPFIL*SKNDSYLLTRKAQV
Trigger: GACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGTTTTTGCTGCAGAGAATAAAAGGACCACGTGCAATACTTAATGCCGCATGATCTCT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR CAA 90 bp CTACAGCGCCCCTGGAGGCCCGGAGGGAGAACGGCCCGGTCCCAGTaGTGCAGGGTAGCCGGATCCATCCATCTTGCTGGAAGGGAGGGG +
Preference number: 2 (lower is better)
Translates to: LQRPWRPGGRTARSQ*CRVAGSIHLAGREG
Trigger: CCCCTCCCTTCCAGCAAGATGGATGGATCCGGCTACCCTGCACAACTGGGACCGGGCCGTTCTCCCTCCGGGCCTCCAGGGGCGCTGTAG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR CCA 90 bp TGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTGGCTGCCTGGGGACCCTGGCCCCTaGGTTGCCTTGGCTGAGGCG +
Preference number: 2 (lower is better)
Translates to: WLSLLPGGNPGYRRPWLPGDPGP*VALAEA
Trigger: CGCCTCAGCCAAGGCAACCCAGGGGCCAGGGTCCCC...AGGCAGCCAAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 4 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACTCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACGCTGGGCGAAGGAAGTaGCCAGCTGCAGCGCCTCCT +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADAGRRK*PAAAPP
Trigger: AGGAGGCGCTGCAGCTGGCCACTTCCTTCGCCCAGC...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGGGTCATCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: GVIQQLGHRDPNGDDSHRLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...CCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGATGACCCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGAGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: SSNSDTGTPMETTRTGSGGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...TCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: SSNSDTGTPMETTRTGSGSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...TCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGA
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADTARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGAAGTCAGGGAGCCAGCAGGCCCAGAGGGGTCATCCAGCAACTCGGACACCGGACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: RSQGASRPRGVIQQLGHRTARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...CCGGTGTCCGAGTTGCTGGATGACCCCTCTGGGCCTGCTGGCTCCCTGACTTCT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACATCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: AAPPAGSQRSCLWPVQTHLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...ATGTGTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCCCACTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: RRCVPPQNSTEVREPAGPLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...TGGGCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGAAGTCAGGGAGCCAGCAGGCCCAGAGGGGTCATCCAGCAACTCGGACACCGGAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: RSQGASRPRGVIQQLGHRSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...CCGGTGTCCGAGTTGCTGGATGACCCCTCTGGGCCTGCTGGCTCCCTGACTTCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: ALDGFRCCQGAILGIDGLSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...AAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGATCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTGGCCAGCCAGTGCCACAGTaGTGGTCCGAGCGTGGTCAG +
Preference number: 2 (lower is better)
Translates to: LDGFRCCQGAILGIDGLGQPVPQ*WSERGQ
Trigger: CTGACCACGCTCGGACCATCACTGTGGCACTGGCTG...GCCAAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR TCA 90 bp CATGGGCTGTCGAGAGAGCGGCGGGAGGCACTACAGCGCCCCTGGAGGCCCGGACCACCCCTCATCTACTaGATTATGAACGCCTTGCTC +
Preference number: 2 (lower is better)
Translates to: HGLSRERREALQRPWRPGPPLIY*IMNALL
Trigger: GAGCAAGGCGTTCATAATTCAGTAGATGAGGGGTGG...TCCGGGCCTCCAGGGGCGCTGTAGTGCCTCCCGCCGCTCTCTCGACAGCCCATG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR GCA 90 bp CTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCTCCGGATACCCCTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: LRAFWASAPVTATILRIPLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...GGGTATCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACGCCACCATCAGCCAGTaGCACAGTGATGGTCCGAGC +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADATISQ*HSDGPS
Trigger: GCTCGGACCATCACTGTGGCACTGGCTGATGGTGGC...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
63% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR CCA 90 bp GCTCTCTGCTTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: ALCFPEGLLGLGTCDSHNPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...ATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGCCCCTGGGTTGCCTTaGCTGAGGCGCCGCTCTCCA +
Preference number: 2 (lower is better)
Translates to: QQCGVSGSRPMALTWRAQAPGLP*LRRRSP
Trigger: TGGAGAGCGGCGCCTCAGCCAAGGCAACCCAGGGGC...CTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCAATCCCAGACCGTGGGCCCTTAGGCAACCACTTCGCTCAGAGCCACAGAGGCCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: SIPDRGPLGNHFAQSHRGLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...GCCTCTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGGCCCACGGTCTGGGATTGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAGGGGGAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: VSSNTARRPWMAFAAARGSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...CCCCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CCAGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACAAAAGCTCCTGCATaGCTCGAGTTCCGCAGGTGC +
Preference number: 2 (lower is better)
Translates to: PAAAPPAGSQRSCLWPVQTKAPA*LEFRRC
Trigger: GCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGT...CTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCTGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCTCCGGATAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: FPEGLLGLGTCDSHNPPDSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...ATCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTATTCAGGGCCTTGGCTaGGGCGCCGCTCTCCATCTC +
Preference number: 2 (lower is better)
Translates to: TRTPGPQWRRLAQGQDRSIQGLG*GAALHL
Trigger: GAGATGGAGAGCGGCGCCTCAGCCAAGGCCCTGAAT...AGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp GCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACATACCGTCCATCAAGCCTaGCACCTGCTGCACCCACTC +
Preference number: 2 (lower is better)
Translates to: AAPPAGSQRSCLWPVQTHTVHQA*HLLHPL
Trigger: GAGTGGGTGCAGCAGGTGTCAGGCTTGATGGACGGT...ATGTGTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGAGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: SSNSDTGTPMETTRTGSGDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...TCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTGGCTGCCTGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: WLSLLPGGNPGYRRPWLPDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...AGGCAGCCAAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACATCTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: AAPPAGSQRSCLWPVQTHLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...ATGTGTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: FRRCVPPQNSTEVREPAGTARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...GCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACATCACACCGGGACCCCAATaGAGACGACTCGCACAGGGT +
Preference number: 2 (lower is better)
Translates to: QRLLQAANVLACGLCRHITPGPQ*RRLAQG
Trigger: ACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGT...GATGTGTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: RASPRSAISLCTSLFGAVSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...GACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGGGGGACCCTGGCCCCTaGGTTGCCTTGGCTGAGGCG +
Preference number: 2 (lower is better)
Translates to: GNLTQARDLASLIVHREEGDPGP*VALAEA
Trigger: CGCCTCAGCCAAGGCAACCCAGGGGCCAGGGTCCCC...CTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: SSSAGAFPHRTQQKSGSQLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...CTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCTTCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: LGWTDGSSGSLLLPHSVLLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...AAGAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: ALGWTDGSSGSLLLPHSVSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...AACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CACGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: HDHKSSCMTRVPQVRSPTGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...TGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCGTG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCATCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: DRSHQTQPVGPGWLSLLPSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...TGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGATTCAGGGCCTTGGCTaGGGCGCCGCTCTCCATCTC +
Preference number: 2 (lower is better)
Translates to: QQCGVSGSRPMALTWRAQIQGLG*GAALHL
Trigger: GAGATGGAGAGCGGCGCCTCAGCCAAGGCCCTGAAT...CTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR TCA 90 bp CCAGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGCTTGACACAGGCACGTaGTCTTGCCAGCCTCATTGT +
Preference number: 2 (lower is better)
Translates to: PAAAPPAGSQRSCLWPVQLDTGT*SCQPHC
Trigger: ACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAG...CTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCTGG
61% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCTTGGGGAATCATCTGTaGCCTCCAGACCCCGTGCCC +
Preference number: 2 (lower is better)
Translates to: LLAGRMDPVGASSFPTQFLGNHL*PPDPVP
Trigger: GGGCACGGGGTCTGGAGGTCACAGATGATTCCCCAA...GAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GCTCTCTGCTTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: ALCFPEGLLGLGTCDSHNDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...ATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCCCAGAGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: QVRSPTELNRSQGASRPRDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...TCTGGGCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp ACCACTCCACACTCCTGGCCTGTGGACACCTCTTCCACGAACATCTTCTCCCTGCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: TTPHSWPVDTSSTNIFSLPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...CAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGGAGTGTGGAGTGGT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CCAGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGGTGCAGACACATCCTTaGCACCACCTTTACCGTCCA +
Preference number: 2 (lower is better)
Translates to: PAAAPPAGSQRSCLWPVQVQTHP*HHLYRP
Trigger: TGGACGGTAAAGGTGGTGGCAAGGATGTGTCTGCAC...CTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCTGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCCCCCAGGTCATTATGTTTaGCCCCAGCCCGGATGCACT +
Preference number: 2 (lower is better)
Translates to: PQVRSPTELNRSQGASRPPGHYV*PQPGCT
Trigger: AGTGCATCCGGGCTGGGGGCAAACATAATGACCTGG...GGGCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR-3UTR CCA 90 bp AATCTCAATCCCAGACCGTGGGCCCTTAGGCAACCACTTCGCTCAGAGCCACAGCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: NLNPRPWALRQPLRSEPQPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...CTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGGCCCACGGTCTGGGATTGAGATT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCTCCGGATTTCCTGAGGGCCTTCTaGGCCTCGGCACCTGTGACA +
Preference number: 2 (lower is better)
Translates to: FPEGLLGLGTCDSHNPPDFLRAF*ASAPVT
Trigger: TGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAA...ATCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCCTTCATTCAGGGCCTTaGCTGAGGCGCCGCTCTCCA +
Preference number: 2 (lower is better)
Translates to: FRRCVPPQNSTEVREPAGLHSGP*LRRRSP
Trigger: TGGAGAGCGGCGCCTCAGCCAAGGCCCTGAATGAAG...GCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp TGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCATCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: CERDDQQQCGVSGSRPMASPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...TGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGTCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: ERDDQQQCGVSGSRPMALSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...CAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GCCAGCAGGCCCAGAGGGGTCATCCAGCAACTCGGACACCGGGACCCCAATGGACCCTGTGATTTCAGCTaGGCCAGTTTCCTCTCCTCT +
Preference number: 2 (lower is better)
Translates to: ASRPRGVIQQLGHRDPNGPCDFS*ASFLSS
Trigger: AGAGGAGAGGAAACTGGCCCAGCTGAAATCACAGGG...TCCATTGGGGTCCCGGTGTCCGAGTTGCTGGATGACCCCTCTGGGCCTGCTGGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp GCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: ASVTINSNAGLVVLDRWHLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...GTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: RASPRSAISLCTSLFGAVLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...GACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: QGQDRSHQTQPVGPGWLSLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...CGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGAGGTGCGGTACGACGAGGCAGGAAAGCATGGTCCTGCAGGCAGGACTCGGGTACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: GGAVRRGRKAWSCRQDSGTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...ACCCGAGTCCTGCCTGCAGGACCATGCTTTCCTGCCTCGTCGTACCGCACCTCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR-3UTR TCA 90 bp GGGTCATCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: GSSSNSDTGTPMETTRTGTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGATGACCC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCTCTCTGCTTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: ALCFPEGLLGLGTCDSHNLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...ATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: LTQARDLASLIVHREEHGGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...GCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCTCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: LSKVSDLPLHILVWSSLSSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...GCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAGGGGGAGCCCCTGCTGGCATTaGGCTTTTCATGGGCGTATC +
Preference number: 2 (lower is better)
Translates to: VSSNTARRPWMAFAAARGSPCWH*AFHGRI
Trigger: GATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCT...CCCCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGAC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCTTCTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: LGWTDGSSGSLLLPHSVLLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...AAGAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTTGAAGAGCTTCAAGGCTTCATTCAGGGCCTGTGGGGAGGACCTGGCTCAGGCCTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: LEELQGFIQGLWGGPGSGLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...GCCTGAGCCAGGTCCTCCCCACAGGCCCTGAATGAAGCCTTGAAGCTCTTCAAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 4 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: ERDDQQQCGVSGSRPMALPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...CAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACCGCAATTCATCCTTCTaGCACTGGGGGATGACTGCA +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADRNSSF*HWGMTA
Trigger: TGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCG...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAGACCTCCAGACCCCGTaGCCGGAGCTCTTCGATAGC +
Preference number: 2 (lower is better)
Translates to: RSQKLLHDSSSAGAFPHRDLQTP*PELFDS
Trigger: GCTATCGAAGAGCTCCGGGCACGGGGTCTGGAGGTC...TCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GAGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGATCTGGGCCACAACTTaGTGGGATGTCAGGGTCCAG +
Preference number: 2 (lower is better)
Translates to: ELLAGRMDPVGASSFPTQIWATT*WDVRVQ
Trigger: CTGGACCCTGACATCCCAGCAAGTTGTGGCCCAGAT...CTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR CCA 90 bp GAAGTCAGGGAGCCAGCAGGCCCAGAGGGGTCATCCAGCAACTCGGACACCGGGACCAATGAGCCTTTCTaGTCAGCTTCCCCAAGCACT +
Preference number: 2 (lower is better)
Translates to: EVREPAGPEGSSSNSDTGTNEPF*SASPST
Trigger: AGTGCTTGGGGAAGCTGACCAGAAAGGCTCATTGGT...CCCGGTGTCCGAGTTGCTGGATGACCCCTCTGGGCCTGCTGGCTCCCTGACTTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: RDDQQQCGVSGSRPMALTPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...CGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTCAGCATAGAAACAGGTCTTGTCCAGCACCACTCCACACTCCTGGCCTGTGGACCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: LSIETGLVQHHSTLLACGPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...TCCACAGGCCAGGAGTGTGGAGTGGTGCTGGACAAGACCTGTTTCTATGCTGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: GPLQGQRSPSAHPCLEQSTARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...AGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACAGGATGACAAGAGGCTaGTTGGGGTTGCTGTCGATG +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADRMTRG*LGLLSM
Trigger: CATCGACAGCAACCCCAACCAGCCTCTTGTCATCCT...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCGCTGGGCGAAGGAAGTaGCCAGCTGCAGCGCCTCCT +
Preference number: 2 (lower is better)
Translates to: RHVILPASLSTVKSMAEVAGRRK*PAAAPP
Trigger: AGGAGGCGCTGCAGCTGGCCACTTCCTTCGCCCAGC...GACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCACGCCCCTGGGTTGCCTTaGCTGAGGCGCCGCTCTCCA +
Preference number: 2 (lower is better)
Translates to: KVSDLPLHILVWSSLSLHAPGLP*LRRRSP
Trigger: TGGAGAGCGGCGCCTCAGCCAAGGCAACCCAGGGGC...GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTCAGTGTGCCCAGGGCCTGTaGGGAGGACCCCAGCGCCGG +
Preference number: 2 (lower is better)
Translates to: HGRSLRGVHLEELQGFIQCAQGL*GGPQRR
Trigger: CCGGCGCTGGGGTCCTCCCCACAGGCCCTGGGCACA...CTGAATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTTGTGCCCAGGGCCTGTaGGGAGGACCCCAGCGCCGG +
Preference number: 2 (lower is better)
Translates to: RAVIYRCERDDQQQCGVSCAQGL*GGPQRR
Trigger: CCGGCGCTGGGGTCCTCCCCACAGGCCCTGGGCACA...ACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp ACGCGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATGCACTACAGCGCCCCTaGAGGCCCGGAGGGAGAACG +
Preference number: 2 (lower is better)
Translates to: TRKAQVWRAVIYRCERDDALQRP*RPGGRT
Trigger: CGTTCTCCCTCCGGGCCTCCAGGGGCGCTGTAGTGC...ATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCGCGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR TCA 90 bp CGACTCGCACAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGACTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: RLAQGQDRSHQTQPVGPGLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...TCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTGTGCGAGTCG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCTCTGCTTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCACAAAAGCTCCTGCATaGCTCGAGTTCCGCAGGTGC +
Preference number: 2 (lower is better)
Translates to: LSAFLRAFWASAPVTATITKAPA*LEFRRC
Trigger: GCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGT...GATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCGAAGTTCAGAATGTGCGTAGCTGTGTGGTTGCTCATGATGGGTCTTCGTCGGGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: AKFRMCVAVWLLMMGLRRGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...CCGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: RDDQQQCGVSGSRPMALTSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...CGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACTCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTATTCAGGGCCTTGGCTaGGGCGCCGCTCTCCATCTC +
Preference number: 2 (lower is better)
Translates to: LQGQRSPSAHPCLEQSEPIQGLG*GAALHL
Trigger: GAGATGGAGAGCGGCGCCTCAGCCAAGGCCCTGAAT...AGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR TCA 90 bp GCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTAGCATGGCAGAAGTCTaGGGGGAGTGCATCTTGAAG +
Preference number: 2 (lower is better)
Translates to: ALDGFRCCQGAILGIDGLSMAEV*GECILK
Trigger: CTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCT...AAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCAGCCCCTGCTGGCATTaGGCTTTTCATGGGCGTATC +
Preference number: 2 (lower is better)
Translates to: LLAGRMDPVGASSFPTQFSPCWH*AFHGRI
Trigger: GATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCT...GAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGGCAGAAATGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: GVSGSRPMALTWRAQGRNDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GAGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGCGCAATTCATCCTTCTaGCACTGGGGGATGACTGCA +
Preference number: 2 (lower is better)
Translates to: ELLAGRMDPVGASSFPTQRNSSF*HWGMTA
Trigger: TGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCG...CTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATTCTGGACATCGGCTTTaGTGGCTCGGTCCAAGTCAT +
Preference number: 2 (lower is better)
Translates to: PATRTPGPQWRRLAQGQDSGHRL*WLGPSH
Trigger: ATGACTTGGACCGAGCCAGCAAAGCCGATGTCCAGA...ATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACCCCCACCAGCTCCCTTaGCCTGTGATTTCAGCTGGG +
Preference number: 2 (lower is better)
Translates to: ASVTINSNAGLVVLDRWHPHQLP*PVISAG
Trigger: CCCAGCTGAAATCACAGGGCAAGGGAGCTGGTGGGG...GTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp TCTCCCAGGGACTGGACGACAACATCCACTAACGTAGCAAAGAAGCCCCTGCTGGACCTCCAGACCCCGTaGCCGGAGCTCTTCGATAGC +
Preference number: 2 (lower is better)
Translates to: SPRDWTTTSTNVAKKPLLDLQTP*PELFDS
Trigger: GCTATCGAAGAGCTCCGGGCACGGGGTCTGGAGGTC...CAGCAGGGGCTTCTTTGCTACGTTAGTGGATGTTGTCGTCCAGTCCCTGGGAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp CCTGGCCTGTGGACACCTCTTCCACGAACATCTTCTCCCTGCGCAGAGCCATCACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: PGLWTPLPRTSSPCAEPSPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TGATGGCTCTGCGCAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTGCCTTCTTGATCTGTTaGGTGGACATGGCTCCCTTG +
Preference number: 2 (lower is better)
Translates to: ALDGFRCCQGAILGIDGLAFLIC*VDMAPL
Trigger: CAAGGGAGCCATGTCCACCCAACAGATCAAGAAGGC...AAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAAACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: QKLLHDSSSAGAFPHRTQTARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...TTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTGGCTGCCTTCCTCCGGATACCCTTaGCAATGGCTTCTTCCGTCA +
Preference number: 2 (lower is better)
Translates to: WLSLLPGGNPGYRRPWLPSSGYP*QWLLPS
Trigger: TGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGA...AGGCAGCCAAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGAGGACATCGGCTTTGCTaGCTCGGTCCAAGTCATCCA +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGGHRLC*LGPSHP
Trigger: TGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCC...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GAGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGAGGATGACAAGAGGCTaGTTGGGGTTGCTGTCGATG +
Preference number: 2 (lower is better)
Translates to: ELLAGRMDPVGASSFPTQRMTRG*LGLLSM
Trigger: CATCGACAGCAACCCCAACCAGCCTCTTGTCATCCT...CTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCTC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTAGGATGACAAGAGGCTaGTTGGGGTTGCTGTCGATG +
Preference number: 2 (lower is better)
Translates to: ALDGFRCCQGAILGIDGLRMTRG*LGLLSM
Trigger: CATCGACAGCAACCCCAACCAGCCTCTTGTCATCCT...AAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCTTGGCAATGGCTTCTTCCGTCACGATCACAAAAGCTCCTGCATGACTCGAGTTCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: PWQWLLPSRSQKLLHDSSSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...ACTCGAGTCATGCAGGAGCTTTTGTGATCGTGACGGAAGAAGCCATTGCCAAGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGAGCATTGAGCTTTTCATaGGCGTATCGGACAGCTCGG +
Preference number: 2 (lower is better)
Translates to: SSNSDTGTPMETTRTGSGALSFS*AYRTAR
Trigger: CCGAGCTGTCCGATACGCCCATGAAAAGCTCAATGC...TCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp CCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGAGCATCTCCCAGGGACTaGACGACAACATCCACTAAC +
Preference number: 2 (lower is better)
Translates to: PVGPGWLSLLPGGNPGYRASPRD*TTTSTN
Trigger: GTTAGTGGATGTTGTCGTCCAGTCCCTGGGAGATGC...TCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp CAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTAACTTTCCCAGTGTATaGTCGGGCACCTGTGCCCTA +
Preference number: 2 (lower is better)
Translates to: QTQPVGPGWLSLLPGGNPNFPSV*SGTCAL
Trigger: TAGGGCACAGGTGCCCGACCATACACTGGGAAAGTT...AGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000675569.1
ENST00000676040.1
3UTR CAA 90 bp CTTAGCCCATTCCCCAAATCCCTCCACCCCAGTGCCCATACATGCTaGGGAAGAGCTCTCCTGCTAGCAGCACTGGGAGCAGCAGGGAAT +
Preference number: 2 (lower is better)
Translates to: LSPFPKSLHPSAHTC*GRALLLAALGAAGN
Trigger: ATTCCCTGCTGCTCCCAGTGCTGCTAGCAGGAGAGCTCTTCCCAAGCATGTATGGGCACTGGGGTGGAGGGATTTGGGGAATGGGCTAAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR TCA 90 bp ACAGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACACTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: TATILRIPLAMASSVTITLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...TGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCTGT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: TDAKGCQKSQPLLGRGIELDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...CTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCTCCGGATACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: FPEGLLGLGTCDSHNPPDTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...ATCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: QGQDRSHQTQPVGPGWLSLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...CGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATGTCAGGAGCAACCAATaGGCCTTTCTGGTCAGCTTC +
Preference number: 2 (lower is better)
Translates to: RTPGPQWRRLAQGQDRSHVRSNQ*AFLVSF
Trigger: GAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGAC...ATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGAGTCAGGAGCAACCAATaGGCCTTTCTGGTCAGCTTC +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGVRSNQ*AFLVSF
Trigger: GAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGAC...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACGCGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: TRKAQVWRAVIYRCERDDSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...ATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCGCGT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAATCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCACATTCAGGGCCTTGGCTaGGGCGCCGCTCTCCATCTC +
Preference number: 2 (lower is better)
Translates to: KVSDLPLHILVWSSLSLHIQGLG*GAALHL
Trigger: GAGATGGAGAGCGGCGCCTCAGCCAAGGCCCTGAAT...GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 9 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR TCA 90 bp CCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATGAGGGGAGTGCATCTTaGAGAGCTTCAAGGCTTCAT +
Preference number: 2 (lower is better)
Translates to: PATRTPGPQWRRLAQGQDEGSAS*RASRLH
Trigger: ATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTC...ATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGAGCATTCTGGGGAACTTaGCACAGGCACGTGATCTTG +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGAFWGT*HRHVIL
Trigger: CAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGC...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGACCGTCCATCAAGCCTaGCACCTGCTGCACCCACTC +
Preference number: 2 (lower is better)
Translates to: RDLASLIVHREEHGRSLRTVHQA*HLLHPL
Trigger: GAGTGGGTGCAGCAGGTGTCAGGCTTGATGGACGGT...CCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCACCGTCCATCAAGCCTaGCACCTGCTGCACCCACTC +
Preference number: 2 (lower is better)
Translates to: LSKVSDLPLHILVWSSLSTVHQA*HLLHPL
Trigger: GAGTGGGTGCAGCAGGTGTCAGGCTTGATGGACGGT...GCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCCCAGACTGTCTCCCAGGCTCTaGATTTTCCTGTCCAGGATG +
Preference number: 2 (lower is better)
Translates to: QVRSPTELNRSQGASRPRLSPRL*IFLSRM
Trigger: CATCCTGGACAGGAAAATTCAGAGCCTGGGAGACAG...TCTGGGCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATCTGGGTTGCCTTGGCTaGGGCGCCGCTCTCCATCTC +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDLGCLG*GAALHL
Trigger: GAGATGGAGAGCGGCGCCTCAGCCAAGGCAACCCAG...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGGGCTGGACTAGGTaGACACCACAGCAGCCAGCA +
Preference number: 2 (lower is better)
Translates to: RDDQQQCGVSGSRPMALTWGWTR*TPQQPA
Trigger: TGCTGGCTGCTGTGGTGTTCACCTAGTCCAGCCCCA...CGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR GCA 90 bp ATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: MTRVPQVRSPTELNRSQGDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...TCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCAT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACACATCGATCACAAAAGCTCCTaGATGACTCGAGTTCCGCAG +
Preference number: 2 (lower is better)
Translates to: QRLLQAANVLACGLCRHIDHKSS*MTRVPQ
Trigger: CTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATC...GATGTGTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: YRCERDDQQQCGVSGSRPPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...CGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CCTGCGCAGAGCCATCACCGTAGCCACTGTGTTCTCAAATACATAGCTACCACTCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: PAQSHHRSHCVLKYIATTPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...AGTGGTAGCTATGTATTTGAGAACACAGTGGCTACGGTGATGGCTCTGCGCAGG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CTTGAAGAGCTTCAAGGCTTCATTCAGGGCCTGTGGGGAGGACCTGGCTCAGGCATCCCTCCACCCCAGTaGCCATACATGCTTGGGAAG +
Preference number: 2 (lower is better)
Translates to: LEELQGFIQGLWGGPGSGIPPPQ*PYMLGK
Trigger: CTTCCCAAGCATGTATGGGCACTGGGGTGGAGGGAT...GCCTGAGCCAGGTCCTCCCCACAGGCCCTGAATGAAGCCTTGAAGCTCTTCAAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR GCA 90 bp ACGCGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATGCCCGGTCCCAGTTGTaGAGGGTAGCCGGATCCATC +
Preference number: 2 (lower is better)
Translates to: TRKAQVWRAVIYRCERDDARSQL*RVAGSI
Trigger: GATGGATCCGGCTACCCTGCACAACTGGGACCGGGC...ATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCGCGT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR CCA 90 bp GCACCTGTGACAGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: APVTATILRIPLAMASSVPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...GACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCTGTCACAGGTGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTACCAATGAGCCTTTCTaGTCAGCTTCCCCAAGCACT +
Preference number: 2 (lower is better)
Translates to: QTQPVGPGWLSLLPGGNPTNEPF*SASPST
Trigger: AGTGCTTGGGGAAGCTGACCAGAAAGGCTCATTGGT...AGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTTGATCTGTTGGGTGGACATGGCTCCCTTGGCAGTAAAGTCAAATCTGAGGCGCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: LDLLGGHGSLGSKVKSEAPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...CGCCTCAGATTTGACTTTACTGCCAAGGGAGCCATGTCCACCCAACAGATCAAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAACACCGGGACCCCAATaGAGACGACTCGCACAGGGT +
Preference number: 2 (lower is better)
Translates to: LGNLTQARDLASLIVHRETPGPQ*RRLAQG
Trigger: ACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGT...TTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTGTCCAGGATGCGACGCCCTCTGCTGAGAGTCTTGAGAAACTGCACCTCTTCTTTCCTGAGGGCCTTCTaGGCCTCGGCACCTGTGACA +
Preference number: 2 (lower is better)
Translates to: LSRMRRPLLRVLRNCTSSFLRAF*ASAPVT
Trigger: TGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAA...AGAAGAGGTGCAGTTTCTCAAGACTCTCAGCAGAGGGCGTCGCATCCTGGACAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGGCAGAAATTCATCCTTCTGCCACTaGGGGATGACTGCAGTGGCC +
Preference number: 2 (lower is better)
Translates to: GVSGSRPMALTWRAQGRNSSFCH*GMTAVA
Trigger: GGCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGA...ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCCTTAGGCAACCACTTCGCTCAGAGCCACAGAGGCCACATGTCAGCCACCAGAGGACATCGGCTTTGCTaGCTCGGTCCAAGTCATCCA +
Preference number: 2 (lower is better)
Translates to: PLGNHFAQSHRGHMSATRGHRLC*LGPSHP
Trigger: TGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCC...TCTGGTGGCTGACATGTGGCCTCTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACTCTAACACTCGTTTCTaGACATCGGCTTTGCTGGCT +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADSNTRF*TSALLA
Trigger: AGCCAGCAAAGCCGATGTCCAGAAACGAGTGTTAGA...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGCTTCATTCAGGGCCTTaGCTGAGGCGCCGCTCTCCA +
Preference number: 2 (lower is better)
Translates to: RDLASLIVHREEHGRSLRLHSGP*LRRRSP
Trigger: TGGAGAGCGGCGCCTCAGCCAAGGCCCTGAATGAAG...CCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR CCA 90 bp GAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTTCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: EHGRSLRGVHLEELQGFISPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...AATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGAGCATCTCCCAGGGACTaGACGACAACATCCACTAAC +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGASPRD*TTTSTN
Trigger: GTTAGTGGATGTTGTCGTCCAGTCCCTGGGAGATGC...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp CGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATGCATCTCCCAGGGACTaGACGACAACATCCACTAAC +
Preference number: 2 (lower is better)
Translates to: RTPGPQWRRLAQGQDRSHASPRD*TTTSTN
Trigger: GTTAGTGGATGTTGTCGTCCAGTCCCTGGGAGATGC...ATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GCTCTCTGCTTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATGTCCTTCACCATGTCTaGGTCCTTCTTCAGCTCAGG +
Preference number: 2 (lower is better)
Translates to: ALCFPEGLLGLGTCDSHNVLHHV*VLLQLR
Trigger: CCTGAGCTGAAGAAGGACCCAGACATGGTGAAGGAC...ATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp TCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGAAAATTTAAGGGGCACTaGGACATAGGACTGCTCCCA +
Preference number: 2 (lower is better)
Translates to: SSNSDTGTPMETTRTGSGKFKGH*DIGLLP
Trigger: TGGGAGCAGTCCTATGTCTCAGTGCCCCTTAAATTT...TCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GACTGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: DCSQVCSSYCWVRRGSLKLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...CTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCAGTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: KLRSGEPLSIDASVTINSLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...GCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: RRQRLSKEPAPIGKRDRDLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...ATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: AVIYRCERDDQQQCGVSGLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...ACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAACTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: LIVHREEHGRSLRGVHLELDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...TTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGCTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: DQQQCGVSGSRPMALTWRLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...CCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCACAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: KVSDLPLHILVWSSLSLHSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGGTCAGGAGCAACCAATaGGCCTTTCTGGTCAGCTTC +
Preference number: 2 (lower is better)
Translates to: SSSAGAFPHRTQQKSGSQVRSNQ*AFLVSF
Trigger: GAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGAC...CTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: SIDASVTINSNAGLVVLDGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...GTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTTCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: EHGRSLRGVHLEELQGFISATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...AATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACTCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: SIDASVTINSNAGLVVLDSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...GTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGCCTCATTGTCCACCGTaGAGAGCATGGCAGAAGTCT +
Preference number: 2 (lower is better)
Translates to: QQCGVSGSRPMALTWRAQPHCPP*RAWQKS
Trigger: AGACTTCTGCCATGCTCTTCACGGTGGACAATGAGG...CTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCACACCGTCCATCAAGCCTaGCACCTGCTGCACCCACTC +
Preference number: 2 (lower is better)
Translates to: KVSDLPLHILVWSSLSLHTVHQA*HLLHPL
Trigger: GAGTGGGTGCAGCAGGTGTCAGGCTTGATGGACGGT...GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCAGCCCCTGCTGGCATTaGGCTTTTCATGGGCGTATC +
Preference number: 2 (lower is better)
Translates to: WRRLAQGQDRSHQTQPVGSPCWH*AFHGRI
Trigger: GATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCT...GCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp AGATCTGGCCTCCTTGCTCAGCATAGAAACAGGTCTTGTCCAGCACCACTCCACTTGGGGAATCATCTGTaGCCTCCAGACCCCGTGCCC +
Preference number: 2 (lower is better)
Translates to: RSGLLAQHRNRSCPAPLHLGNHL*PPDPVP
Trigger: GGGCACGGGGTCTGGAGGTCACAGATGATTCCCCAA...GTGGAGTGGTGCTGGACAAGACCTGTTTCTATGCTGAGCAAGGAGGCCAGATCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp ATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCAGCCAGTGCCACAGTaGTGGTCCGAGCGTGGTCAG +
Preference number: 2 (lower is better)
Translates to: IVHREEHGRSLRGVHLEEQPVPQ*WSERGQ
Trigger: CTGACCACGCTCGGACCATCACTGTGGCACTGGCTG...CTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTCTTCACGGTGGACAAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR GCA 90 bp AGGGGTCATCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGACGATCAACAGCAATaGGGGGTTAGTGGTTCTAGA +
Preference number: 2 (lower is better)
Translates to: RGHPATRTPGPQWRRLAQDDQQQ*GVSGSR
Trigger: TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTC...CTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGATGACCCCT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp ATCCCAGACCGTGGGCCCTTAGGCAACCACTTCGCTCAGAGCCACAGAGGCCACGCCGTTATCTATAGATaGGAGCGTGACGATCAACAG +
Preference number: 2 (lower is better)
Translates to: IPDRGPLGNHFAQSHRGHAVIYR*ERDDQQ
Trigger: CTGTTGATCGTCACGCTCGCATCTATAGATAACGGC...GTGGCCTCTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGGCCCACGGTCTGGGAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CCGTGGGCCCTTAGGCAACCACTTCGCTCAGAGCCACAGAGGCCACATGTCAGCGCCGTTATCTATAGATaGGAGCGTGACGATCAACAG +
Preference number: 2 (lower is better)
Translates to: PWALRQPLRSEPQRPHVSAVIYR*ERDDQQ
Trigger: CTGTTGATCGTCACGCTCGCATCTATAGATAACGGC...GCTGACATGTGGCCTCTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGGCCCACGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCGCGAAGTTCAGAATGTaGGTAGCTGTGTGGTTGCTC +
Preference number: 2 (lower is better)
Translates to: LLAGRMDPVGASSFPTQFAKFRM*VAVWLL
Trigger: GAGCAACCACACAGCTACGCACATTCTGAACTTCGC...GAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp ACAGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: TATILRIPLAMASSVTITDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...TGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCTGT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATTTTCTTCAAGCTCTCTaGTTTCCTGAGGGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: PATRTPGPQWRRLAQGQDFLQAL*FPEGLL
Trigger: CAGAAGGCCCTCAGGAAAGCAGAGAGCTTGAAGAAA...ATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp ACAAGAGGCTGGTTGGGGTTGCTGTCGATGAACTGCTTCGTCTTCTCTAACACTCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: TRGWLGLLSMNCFVFSNTPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...AGTGTTAGAGAAGACGAAGCAGTTCATCGACAGCAACCCCAACCAGCCTCTTGT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTGTCCAGGATGCGACGCCCTCTGCTGAGAGTCTTGAGAAACTGCACCTCTTCTATCAAGCCTGACACCTaGTGCACCCACTCGCTGGCT +
Preference number: 2 (lower is better)
Translates to: LSRMRRPLLRVLRNCTSSIKPDT*CTHSLA
Trigger: AGCCAGCGAGTGGGTGCAGCAGGTGTCAGGCTTGAT...AGAAGAGGTGCAGTTTCTCAAGACTCTCAGCAGAGGGCGTCGCATCCTGGACAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCTTCTTCAGCTCAGGAAATaGATCTCCCAGGGACTGGAC +
Preference number: 2 (lower is better)
Translates to: LGWTDGSSGSLLLPHSVLLQLRK*ISQGLD
Trigger: GTCCAGTCCCTGGGAGATGCATTTCCTGAGCTGAAG...AAGAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GAGCAACCAATGAGCCTTTCTGGTCAGCTTCCCCAAGCACTGAGCGCAGGGCGACTTCAGCTCAGGAAATaGATCTCCCAGGGACTGGAC +
Preference number: 2 (lower is better)
Translates to: EQPMSLSGQLPQALSAGRLQLRK*ISQGLD
Trigger: GTCCAGTCCCTGGGAGATGCATTTCCTGAGCTGAAG...TCGCCCTGCGCTCAGTGCTTGGGGAAGCTGACCAGAAAGGCTCATTGGTTGCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GAGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGCCATCCTACCTTGGCTaGCTCAATCATCTCATTAGC +
Preference number: 2 (lower is better)
Translates to: ELLAGRMDPVGASSFPTQPSYLG*LNHLIS
Trigger: GCTAATGAGATGATTGAGGCAGCCAAGGTAGGATGG...CTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR-3UTR GCA 90 bp GACTGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGACCCTGGCCCAGGTATaGCTCCCACATGCAGGGAGC +
Preference number: 2 (lower is better)
Translates to: DCSQVCSSYCWVRRGSLKTLAQV*LPHAGS
Trigger: GCTCCCTGCATGTGGGAGGCATACCTGGGCCAGGGT...CTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCAGTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCAACCCTGGCCCAGGTATaGCTCCCACATGCAGGGAGC +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPTLAQV*LPHAGS
Trigger: GCTCCCTGCATGTGGGAGGCATACCTGGGCCAGGGT...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: ERDDQQQCGVSGSRPMALPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...CAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: CERDDQQQCGVSGSRPMAPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: RHVILPASLSTVKSMAEVPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...GACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: LTQARDLASLIVHREEHGPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...GCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: ALDGFRCCQGAILGIDGLRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...AAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCCCAATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTT +
Preference number: 2 (lower is better)
Translates to: RRCVPPQNSTEVREPAGPMCVAV*LLMMGL
Trigger: AAGACCCATCATGAGCAACCACACAGCTACGCACAT...TGGGCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGGCCTTCTTGATCTGTTaGGTGGACATGGCTCCCTTG +
Preference number: 2 (lower is better)
Translates to: SSSAGAFPHRTQQKSGSQAFLIC*VDMAPL
Trigger: CAAGGGAGCCATGTCCACCCAACAGATCAAGAAGGC...CTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGCCCGTAGGCCCTGGATaGCTTTCGCTGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: LFYRRQRLSKEPAPIGKRPVGPG*LSLLPG
Trigger: CCCTGGCAGCAGCGAAAGCCATCCAGGGCCTACGGG...CCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCCAGGATGACAAGAGGCTGGTTGGGGTTGCTGTCGATGAACTGCTTCGTCTTCACACCGGGACCCCAATaGAGACGACTCGCACAGGGT +
Preference number: 2 (lower is better)
Translates to: SRMTRGWLGLLSMNCFVFTPGPQ*RRLAQG
Trigger: ACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGT...GAAGACGAAGCAGTTCATCGACAGCAACCCCAACCAGCCTCTTGTCATCCTGGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCGTCACGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCTCCTCCGGATACCCTTaGCAATGGCTTCTTCCGTCA +
Preference number: 2 (lower is better)
Translates to: PSRSQKLLHDSSSAGAFPSSGYP*QWLLPS
Trigger: TGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGA...GGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCGTGACGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCTGCACATCCTTGTTTaGAGCAGTCTGAGCCTTCAC +
Preference number: 2 (lower is better)
Translates to: VPQVRSPTELNRSQGASRLHILV*SSLSLH
Trigger: GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAG...CCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAAC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGTCATCCTTCTGCCACTaGGGGATGACTGCAGTGGCC +
Preference number: 2 (lower is better)
Translates to: GNLTQARDLASLIVHREESSFCH*GMTAVA
Trigger: GGCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGA...CTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGTCATCCTTCTGCCACTaGGGGATGACTGCAGTGGCC +
Preference number: 2 (lower is better)
Translates to: ERDDQQQCGVSGSRPMALSSFCH*GMTAVA
Trigger: GGCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGA...CAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCTTCATTCAGGGCCTTaGCTGAGGCGCCGCTCTCCA +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHLHSGP*LRRRSP
Trigger: TGGAGAGCGGCGCCTCAGCCAAGGCCCTGAATGAAG...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR CCA 90 bp GAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGGCTGCACCCACTCGCTaGCTTTTAAGCCCCGATTGG +
Preference number: 2 (lower is better)
Translates to: ERDDQQQCGVSGSRPMALAAPTR*LLSPDW
Trigger: CCAATCGGGGCTTAAAAGCCAGCGAGTGGGTGCAGC...CAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CACAGCATTTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGTCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: HSIYSTDAKGCQKSQPLLSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...CAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAAATGCTGTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR CCA 90 bp ATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGATCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: IYRCERDDQQQCGVSGSRSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGCAGTGTCTCCGGGAATaGTCTTGCTGTCTCCCAGGC +
Preference number: 2 (lower is better)
Translates to: RDLASLIVHREEHGRSLRQCLRE*SCCLPG
Trigger: GCCTGGGAGACAGCAAGACCATTCCCGGAGACACTG...CCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp TTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCTCCGGATTCGCCCATCCTACCTTaGCTGCCTCAATCATCTCAT +
Preference number: 2 (lower is better)
Translates to: FPEGLLGLGTCDSHNPPDSPILP*LPQSSH
Trigger: ATGAGATGATTGAGGCAGCCAAGGTAGGATGGGCGA...ATCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR-3UTR TCA 90 bp AGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTAAATTTAAGGGGCACTaGGACATAGGACTGCTCCCA +
Preference number: 2 (lower is better)
Translates to: SSWLDGWIQWEPPPSPLSKFKGH*DIGLLP
Trigger: TGGGAGCAGTCCTATGTCTCAGTGCCCCTTAAATTT...ACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: PLSIDASVTINSNAGLVVLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...AACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACCACTCCACACTCCTGGCCTGTGGACACCTCTTCCACGAACATCTTCTCCCTGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: TTPHSWPVDTSSTNIFSLTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGGAGTGTGGAGTGGT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp CATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: HDSSSAGAFPHRTQQKSGTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAAAGCTCCTGCACTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: LRIPLAMASSVTITKAPALCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...TGCAGGAGCTTTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACAGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACACTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: TATILRIPLAMASSVTITLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...TGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCTGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: CSQVCSSYCWVRRGSLKVSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...GACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCATTTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: AFILQTPKAVKRASPYWEGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...TTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAAATGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp CATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTCAGAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: HGRSLRGVHLEELQGFIQSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...CTGAATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: LFYRRQRLSKEPAPIGKRSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...CCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCCCTGGATGGCTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTCCTTCTTTAGGGATTTaGGAGTCTCCCGCAATTCAT +
Preference number: 2 (lower is better)
Translates to: ALDGFRCCQGAILGIDGLPSLGI*ESPAIH
Trigger: ATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGG...AAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAGGGC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCAGCAACTCGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGACCTTCTTTAGGGATTTaGGAGTCTCCCGCAATTCAT +
Preference number: 2 (lower is better)
Translates to: SSNSDTGTPMETTRTGSGPSLGI*ESPAIH
Trigger: ATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGG...TCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCGAGTTGCTGGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCGCATTCTGGGGAACTTaGCACAGGCACGTGATCTTG +
Preference number: 2 (lower is better)
Translates to: WRRLAQGQDRSHQTQPVGAFWGT*HRHVIL
Trigger: CAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGC...GCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAAGCATTCTGGGGAACTTaGCACAGGCACGTGATCTTG +
Preference number: 2 (lower is better)
Translates to: HRDPNGDDSHRVRIGLIKAFWGT*HRHVIL
Trigger: CAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGC...TTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CCTGTCCAGGATGCGACGCCCTCTGCTGAGAGTCTTGAGAAACTGCACCTCTTCCTGTCTCCCAGGCTCTaGATTTTCCTGTCCAGGATG +
Preference number: 2 (lower is better)
Translates to: PVQDATPSAESLEKLHLFLSPRL*IFLSRM
Trigger: CATCCTGGACAGGAAAATTCAGAGCCTGGGAGACAG...GAAGAGGTGCAGTTTCTCAAGACTCTCAGCAGAGGGCGTCGCATCCTGGACAGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAATGGGGCTGGACTAGGTaGACACCACAGCAGCCAGCA +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQWGWTR*TPQQPA
Trigger: TGCTGGCTGCTGTGGTGTTCACCTAGTCCAGCCCCA...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR GCA 90 bp GCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACGTGTGTTCCAGTTACTaGTGGGTTAGGAGGGGCTCT +
Preference number: 2 (lower is better)
Translates to: ASVTINSNAGLVVLDRWHVCSSY*WVRRGS
Trigger: AGAGCCCCTCCTAACCCAGCAGTAACTGGAACACAC...GTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCGACGATCAACAGCAATaGGGGGTTAGTGGTTCTAGA +
Preference number: 2 (lower is better)
Translates to: FRRCVPPQNSTEVREPAGDDQQQ*GVSGSR
Trigger: TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTC...GCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTTGAAGAGCTTCAAGGCTTCATTCAGGGCCTGTGGGGAGGACCTGGCTCAGGCGCGAAGTTCAGAATGTaGGTAGCTGTGTGGTTGCTC +
Preference number: 2 (lower is better)
Translates to: LEELQGFIQGLWGGPGSGAKFRM*VAVWLL
Trigger: GAGCAACCACACAGCTACGCACATTCTGAACTTCGC...GCCTGAGCCAGGTCCTCCCCACAGGCCCTGAATGAAGCCTTGAAGCTCTTCAAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCGAAGTTCAGAATGTaGGTAGCTGTGTGGTTGCTC +
Preference number: 2 (lower is better)
Translates to: SSAGAFPHRTQQKSGSQQAKFRM*VAVWLL
Trigger: GAGCAACCACACAGCTACGCACATTCTGAACTTCGC...CTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGAATAGACGGCCTTGGCTaGCTCAATCATCTCATTAGC +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGIDGLG*LNHLIS
Trigger: GCTAATGAGATGATTGAGGCAGCCAAGGCCGTCTAT...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCACTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCCTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: KLRSGEPLSIDASVTINSLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...GCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GTCTTGTCCAGCACCACTCCACACTCCTGGCCTGTGGACACCTCTTCCACGAACTCAGCGATCTCCCTCTaGACATCCTTGTTTGGAGCA +
Preference number: 2 (lower is better)
Translates to: VLSSTTPHSWPVDTSSTNSAISL*TSLFGA
Trigger: TGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGA...GTTCGTGGAAGAGGTGTCCACAGGCCAGGAGTGTGGAGTGGTGCTGGACAAGAC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp TTGCTGTCGATGAACTGCTTCGTCTTCTCTAACACTCGTTTCTGGACATCGGCTCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: LLSMNCFVFSNTRFWTSAPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...AGCCGATGTCCAGAAACGAGTGTTAGAGAAGACGAAGCAGTTCATCGACAGCAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GGTATAGACGGCCTTGGCTGCCTCAATCATCTCATTAGCAATCTCTTCAGCCTTCCACTGGGGGATGACTaGAGTGGCCAGGGCCTCTCC +
Preference number: 2 (lower is better)
Translates to: GIDGLGCLNHLISNLFSLPLGDD*SGQGLS
Trigger: GGAGAGGCCCTGGCCACTGCAGTCATCCCCCAGTGG...AAGGCTGAAGAGATTGCTAATGAGATGATTGAGGCAGCCAAGGCCGTCTATACC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 10 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGGCAGAAATCGCAATTCATCCTTCTaGCACTGGGGGATGACTGCA +
Preference number: 2 (lower is better)
Translates to: GVSGSRPMALTWRAQGRNRNSSF*HWGMTA
Trigger: TGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCG...ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAACGCAATTCATCCTTCTaGCACTGGGGGATGACTGCA +
Preference number: 2 (lower is better)
Translates to: HRDPNGDDSHRVRIGLIKRNSSF*HWGMTA
Trigger: TGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCG...TTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGAAGCCTGACACCTGCTaGACCCACTCGCTGGCTTTT +
Preference number: 2 (lower is better)
Translates to: RDLASLIVHREEHGRSLRKPDTC*THSLAF
Trigger: AAAAGCCAGCGAGTGGGTGCAGCAGGTGTCAGGCTT...CCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCAAAGCCTGACACCTGCTaGACCCACTCGCTGGCTTTT +
Preference number: 2 (lower is better)
Translates to: CERDDQQQCGVSGSRPMAKPDTC*THSLAF
Trigger: AAAAGCCAGCGAGTGGGTGCAGCAGGTGTCAGGCTT...TGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCATGGGCGTATCGGACAGCTCGGCGGAGAATCCGTCTCAACACATATCCACGCCTTCAGCTCAGGAAATaGATCTCCCAGGGACTGGAC +
Preference number: 2 (lower is better)
Translates to: SWAYRTARRRIRLNTYPRLQLRK*ISQGLD
Trigger: GTCCAGTCCCTGGGAGATGCATTTCCTGAGCTGAAG...GCGTGGATATGTGTTGAGACGGATTCTCCGCCGAGCTGTCCGATACGCCCATGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR GCA 90 bp CCTTGGCAATGGCTTCTTCCGTCACGATCACAAAAGCTCCTGCATGACTCGAGTGCCACCATCAGCCAGTaGCACAGTGATGGTCCGAGC +
Preference number: 2 (lower is better)
Translates to: PWQWLLPSRSQKLLHDSSATISQ*HSDGPS
Trigger: GCTCGGACCATCACTGTGGCACTGGCTGATGGTGGC...ACTCGAGTCATGCAGGAGCTTTTGTGATCGTGACGGAAGAAGCCATTGCCAAGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR GCA 90 bp GGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCCACATGCAGGGAGCTaGTGCTCCTCCCAATCTCAA +
Preference number: 2 (lower is better)
Translates to: GNLTQARDLASLIVHREEPHAGS*CSSQSQ
Trigger: TTGAGATTGGGAGGAGCAGCAGCTCCCTGCATGTGG...CTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCGGTATGCCTCCCACATaGAGGGAGCTGCTGCTCCTC +
Preference number: 2 (lower is better)
Translates to: KLRSGEPLSIDASVTINSGMPPT*RELLLL
Trigger: GAGGAGCAGCAGCTCCCTGCATGTGGGAGGCATACC...GCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: SGEPLSIDASVTINSNAGPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...CCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: DAKGCQKSQPLLGRGIEIPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...GATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTCTCTGCTTTCCTGAGGGCCTTCTGGGCCTCGGCACCTGTGACAGCCACAATCCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: LSAFLRAFWASAPVTATIRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...GATTGTGGCTGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTCCTCCTTCCCCACTCAGTTCTTTACATCCCCGAGGCGCAGCTGGGCGAAGGACGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: LLLPHSVLYIPEAQLGEGRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...TCCTTCGCCCAGCTGCGCCTCGGGGATGTAAAGAACTGAGTGGGGAAGGAGGAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: SSWLDGWIQWEPPPSPLSRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...ACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTTTCGCTGCTGCCAGGGGGCAATCCTGGGTATAGACGGCCTTGGCTGCCTCAACGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: LSLLPGGNPGYRRPWLPQRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...TTGAGGCAGCCAAGGCCGTCTATACCCAGGATTGCCCCCTGGCAGCAGCGAAAG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGGACACCGGGACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTT +
Preference number: 2 (lower is better)
Translates to: RTPGPQWRRLAQGQDRSHMCVAV*LLMMGL
Trigger: AAGACCCATCATGAGCAACCACACAGCTACGCACAT...ATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGTCCG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGCCTGTGGACACCTCTTCCACGAACATCTTCTCCCTGCGCAGAGCCATCACCGATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTT +
Preference number: 2 (lower is better)
Translates to: GLWTPLPRTSSPCAEPSPMCVAV*LLMMGL
Trigger: AAGACCCATCATGAGCAACCACACAGCTACGCACAT...CGGTGATGGCTCTGCGCAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp CAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGACCAATGAGCCTTTCTaGTCAGCTTCCCCAAGCACT +
Preference number: 2 (lower is better)
Translates to: QQCGVSGSRPMALTWRAQTNEPF*SASPST
Trigger: AGTGCTTGGGGAAGCTGACCAGAAAGGCTCATTGGT...CTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGGCCTTCTTGATCTGTTaGGTGGACATGGCTCCCTTG +
Preference number: 2 (lower is better)
Translates to: HDSSSAGAFPHRTQQKSGAFLIC*VDMAPL
Trigger: CAAGGGAGCCATGTCCACCCAACAGATCAAGAAGGC...CCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCGTCACGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCGGGTATAGACGGCCTTaGCTGCCTCAATCATCTCAT +
Preference number: 2 (lower is better)
Translates to: PSRSQKLLHDSSSAGAFPGYRRP*LPQSSH
Trigger: ATGAGATGATTGAGGCAGCCAAGGCCGTCTATACCC...GGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCGTGACGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCCACTGGGGGATGACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: FFRDLRVSRNSSFCHWGMTARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...CATCCCCCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTACAGCCCGTAGGCCCTaGATGGCTTTCGCTGCTGCC +
Preference number: 2 (lower is better)
Translates to: EHGRSLRGVHLEELQGFITARRP*MAFAAA
Trigger: GGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGT...AATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCTGGCCTGTGGACACCTCTTCCACGAACATCTTCTCCCTGCGCAGAGCCATCAGGATACCCTTGGCAATaGCTTCTTCCGTCACGATCA +
Preference number: 2 (lower is better)
Translates to: PGLWTPLPRTSSPCAEPSGYPWQ*LLPSRS
Trigger: TGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCC...TGATGGCTCTGCGCAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp AAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCTTCCTGAGGGCCTTCTaGGCCTCGGCACCTGTGACA +
Preference number: 2 (lower is better)
Translates to: KLRSGEPLSIDASVTINSFLRAF*ASAPVT
Trigger: TGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAA...GCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATTCATCCTTCTGCCACTaGGGGATGACTGCAGTGGCC +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHSSFCH*GMTAVA
Trigger: GGCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGA...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGGGACATCGGCTTTGCTaGCTCGGTCCAAGTCATCCA +
Preference number: 2 (lower is better)
Translates to: RDLASLIVHREEHGRSLRGHRLC*LGPSHP
Trigger: TGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCC...CCTCAGACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCGGACATCGGCTTTGCTaGCTCGGTCCAAGTCATCCA +
Preference number: 2 (lower is better)
Translates to: RHVILPASLSTVKSMAEVGHRLC*LGPSHP
Trigger: TGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCC...GACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGGCTCTAACACTCGTTTCTaGACATCGGCTTTGCTGGCT +
Preference number: 2 (lower is better)
Translates to: FRRCVPPQNSTEVREPAGSNTRF*TSALLA
Trigger: AGCCAGCAAAGCCGATGTCCAGAAACGAGTGTTAGA...GCCTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CAAATCCCTCCACCCCAGTGCCCATACATGCTTGGGAAGAGCTCTCCTGCTAGCAGGATGACAAGAGGCTaGTTGGGGTTGCTGTCGATG +
Preference number: 2 (lower is better)
Translates to: QIPPPQCPYMLGKSSPASRMTRG*LGLLSM
Trigger: CATCGACAGCAACCCCAACCAGCCTCTTGTCATCCT...GCTAGCAGGAGAGCTCTTCCCAAGCATGTATGGGCACTGGGGTGGAGGGATTTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR CCA 90 bp GGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGGCAGAAATAGGATGACAAGAGGCTaGTTGGGGTTGCTGTCGATG +
Preference number: 2 (lower is better)
Translates to: GVSGSRPMALTWRAQGRNRMTRG*LGLLSM
Trigger: CATCGACAGCAACCCCAACCAGCCTCTTGTCATCCT...ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GACTGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGCTTCATTCAGGGCCTTaGCTGAGGCGCCGCTCTCCA +
Preference number: 2 (lower is better)
Translates to: DCSQVCSSYCWVRRGSLKLHSGP*LRRRSP
Trigger: TGGAGAGCGGCGCCTCAGCCAAGGCCCTGAATGAAG...CTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCAGTC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR CCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATGCTGCACCCACTCGCTaGCTTTTAAGCCCCGATTGG +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHAAPTR*LLSPDW
Trigger: CCAATCGGGGCTTAAAAGCCAGCGAGTGGGTGCAGC...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp ATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGAGCTGGGCGAAGGAAGTaGCCAGCTGCAGCGCCTCCT +
Preference number: 2 (lower is better)
Translates to: IYRCERDDQQQCGVSGSRAGRRK*PAAAPP
Trigger: AGGAGGCGCTGCAGCTGGCCACTTCCTTCGCCCAGC...TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTATCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: LSIDASVTINSNAGLVVLSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...TAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCATCCATGACCTTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCTCCCCGAGGCGCAGCTaGGCGAAGGAAGTGGCCAGC +
Preference number: 2 (lower is better)
Translates to: SSMTFFRDLRVSRNSSFCSPRRS*AKEVAS
Trigger: GCTGGCCACTTCCTTCGCCCAGCTGCGCCTCGGGGA...GCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGGTCATGGATGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GTGGTTGCTCATGATGGGTCTTCGTCGGGGCTCATCAATAAACAGCCAGACCTGCAGTGTCTCCGGGAATaGTCTTGCTGTCTCCCAGGC +
Preference number: 2 (lower is better)
Translates to: VVAHDGSSSGLINKQPDLQCLRE*SCCLPG
Trigger: GCCTGGGAGACAGCAAGACCATTCCCGGAGACACTG...CAGGTCTGGCTGTTTATTGATGAGCCCCGACGAAGACCCATCATGAGCAACCAC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp TTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGCACTACAGCGCCCCTaGAGGCCCGGAGGGAGAACG +
Preference number: 2 (lower is better)
Translates to: LSIDASVTINSNAGLVVLALQRP*RPGGRT
Trigger: CGTTCTCCCTCCGGGCCTCCAGGGGCGCTGTAGTGC...TAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR CCA 90 bp TCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGTGCACTTCTGGGTATTaGCAGCTCTGCTCAGCTTTG +
Preference number: 2 (lower is better)
Translates to: SSSAGAFPHRTQQKSGSQCTSGY*QLCSAL
Trigger: CAAAGCTGAGCAGAGCTGCCAATACCCAGAAGTGCA...CTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR-3UTR CCA 90 bp AGGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCAACTTTCCCAGTGTATaGTCGGGCACCTGTGCCCTT +
Preference number: 2 (lower is better)
Translates to: RASPRSAISLCTSLFGAVNFPSV*SGTCAL
Trigger: AAGGGCACAGGTGCCCGACCATACACTGGGAAAGTT...GACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCCT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR CAA 90 bp AGCACTGAGCGCAGGGCGAAGTTCAGAATGTGCGTAGCTGTGTGGTaGCTCATGATGGGTCTTCGTCGGGGCTCATCAATAAACAGCCAG +
Preference number: 2 (lower is better)
Translates to: STERRAKFRMCVAVW*LMMGLRRGSSINSQ
Trigger: CTGGCTGTTTATTGATGAGCCCCGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGCCCTGCGCTCAGTGCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR CAA 90 bp TGGACGACAACATCCACTAACGTAGCAAAGAAGCCCCTGCTGGCATaGAGCTTTTCATGGGCGTATCGGACAGCTCGGCGGAGAATCCGT +
Preference number: 2 (lower is better)
Translates to: WTTTSTNVAKKPLLA*SFSWAYRTARRRIR
Trigger: ACGGATTCTCCGCCGAGCTGTCCGATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCTTCTTTGCTACGTTAGTGGATGTTGTCGTCCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp CCTATTGGGAAGAGGGATAGAGATCATGCGGCATTAAGTATTGCACGTGGTCCTCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: PIGKRDRDHAALSIARGPLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...AGGACCACGTGCAATACTTAATGCCGCATGATCTCTATCCCTCTTCCCAATAGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ATCCTGGGTATAGACGGCCTTGGCTGCCTCAATCATCTCATTAGCAATCTCTTCCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: ILGIDGLGCLNHLISNLFLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...GAAGAGATTGCTAATGAGATGATTGAGGCAGCCAAGGCCGTCTATACCCAGGAT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCAACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: CERDDQQQCGVSGSRPMATIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...TGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCAGCATAGAAACAGGTCTTGTCCAGCACCACTCCACACTCCTGGCCTGTGGAACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: LSIETGLVQHHSTLLACGTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...TCCACAGGCCAGGAGTGTGGAGTGGTGCTGGACAAGACCTGTTTCTATGCTGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp TCCAGCACCACTCCACACTCCTGGCCTGTGGACACCTCTTCCACGAACATCTTCATAAACAGCCAGACCTaGTCCCCCACTTTCAGGTCA +
Preference number: 2 (lower is better)
Translates to: SSTTPHSWPVDTSSTNIFINSQT*SPTFRS
Trigger: TGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTAT...GAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGGAGTGTGGAGTGGTGCTGGA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp TGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCATAAACAGCCAGACCTaGTCCCCCACTTTCAGGTCA +
Preference number: 2 (lower is better)
Translates to: WRRLAQGQDRSHQTQPVGINSQT*SPTFRS
Trigger: TGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTAT...GCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 10 transcripts:
ENST00000674652.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAATAAACAGCCAGACCTaGTCCCCCACTTTCAGGTCA +
Preference number: 2 (lower is better)
Translates to: RSQKLLHDSSSAGAFPHRINSQT*SPTFRS
Trigger: TGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTAT...TCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 10 transcripts:
ENST00000674652.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTATAAACAGCCAGACCTaGTCCCCCACTTTCAGGTCA +
Preference number: 2 (lower is better)
Translates to: GPLQGQRSPSAHPCLEQSINSQT*SPTFRS
Trigger: TGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTAT...AGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 9 transcripts:
ENST00000674652.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCACTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGCTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: QRLSKEPAPIGKRDRDHALCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...CGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACAGCCAGACCTGATCCCCCACTTTCAGGTCACCGTAGATGGTTCCAATGTGTACTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: TARPDPPLSGHRRWFQCVLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...TACACATTGGAACCATCTACGGTGACCTGAAAGTGGGGGATCAGGTCTGGCTGT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 10 transcripts:
ENST00000674652.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTCTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: WRAVIYRCERDDQQQCGVLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...AACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATCTGTGTGGTTGCTCATaGTGGGTCTTCGTCGGGGCT +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDLCGCS*WVFVGA
Trigger: AGCCCCGACGAAGACCCATCATGAGCAACCACACAG...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGGCAGAAATTCTCTTCAGCCTTCTTaGTCTGTTGGGTGGACATGG +
Preference number: 2 (lower is better)
Translates to: GVSGSRPMALTWRAQGRNSLQPS*SVGWTW
Trigger: CCATGTCCACCCAACAGATCAAGAAGGCTGAAGAGA...ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CACGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCCACATCTCTTCAGCCTTCTTaGTCTGTTGGGTGGACATGG +
Preference number: 2 (lower is better)
Translates to: HDHKSSCMTRVPQVRSPTSLQPS*SVGWTW
Trigger: CCATGTCCACCCAACAGATCAAGAAGGCTGAAGAGA...TGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCGTG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCATCCATGACCTTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCTCTGCCACTGGGGGATaGCTGCAGTGGCCAGGGCCT +
Preference number: 2 (lower is better)
Translates to: SSMTFFRDLRVSRNSSFCSATGG*LQWPGP
Trigger: AGGCCCTGGCCACTGCAGTCATCCCCCAGTGGCAGA...GCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGGTCATGGATGA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAGAAGTCAGCATGGCAGAAGTCTaGGGGGAGTGCATCTTGAAG +
Preference number: 2 (lower is better)
Translates to: RHVILPASLSTVKSMAEVSMAEV*GECILK
Trigger: CTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCT...GACTTCTGCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTCCTCATTGTCCACCGTaGAGAGCATGGCAGAAGTCT +
Preference number: 2 (lower is better)
Translates to: LQGQRSPSAHPCLEQSEPPHCPP*RAWQKS
Trigger: AGACTTCTGCCATGCTCTTCACGGTGGACAATGAGG...AGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACACCGTCCATCAAGCCTaGCACCTGCTGCACCCACTC +
Preference number: 2 (lower is better)
Translates to: SIDASVTINSNAGLVVLDTVHQA*HLLHPL
Trigger: GAGTGGGTGCAGCAGGTGTCAGGCTTGATGGACGGT...GTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AATCTCAATCCCAGACCGTGGGCCCTTAGGCAACCACTTCGCTCAGAGCCACAGTACCCTCCTCGGACCTaGGCATTCTTCACTGTAAAC +
Preference number: 2 (lower is better)
Translates to: NLNPRPWALRQPLRSEPQYPPRT*AFFTVN
Trigger: GTTTACAGTGAAGAATGCTCAGGTCCGAGGAGGGTA...CTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGGCCCACGGTCTGGGATTGAGATT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000675297.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATGGACCCTCACTAGTGTaGGCATTTGCAGCCCTCAGA +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHGPSLV*AFAALR
Trigger: TCTGAGGGCTGCAAATGCTCACACTAGTGAGGGTCC...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCACCCCTCATCTACTGAATTATGAACGCCTTGCTCCAAGTCACCCCACCTATACCTCCACAGACGTTTaGGGCAGCCCTAGGGGCTGT +
Preference number: 2 (lower is better)
Translates to: STPHLLNYERLAPSHPTYTSTDV*GSPRGC
Trigger: ACAGCCCCTAGGGCTGCCTCAAACGTCTGTGGAGGT...ATAGGTGGGGTGACTTGGAGCAAGGCGTTCATAATTCAGTAGATGAGGGGTGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR GCA 90 bp CGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGGTGTGTTCCAGTTACTaGTGGGTTAGGAGGGGCTCT +
Preference number: 2 (lower is better)
Translates to: RDDQQQCGVSGSRPMALTVCSSY*WVRRGS
Trigger: AGAGCCCCTCCTAACCCAGCAGTAACTGGAACACAC...CGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGACGGTCCTTTTATTCTCTaGAGCAAAAACGATTCCTAC +
Preference number: 2 (lower is better)
Translates to: SCSASCRQPTFLPVACADGPFIL*SKNDSY
Trigger: GTAGGAATCGTTTTTGCTGCAGAGAATAAAAGGACC...GTCTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CCGTCACGATCACAAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCATAGACGGCCTTGGCTaGCTCAATCATCTCATTAGC +
Preference number: 2 (lower is better)
Translates to: PSRSQKLLHDSSSAGAFPIDGLG*LNHLIS
Trigger: GCTAATGAGATGATTGAGGCAGCCAAGGCCGTCTAT...GGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATCGTGACGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TTCGTCATAGATCTGGCCTCCTTGCTCAGCATAGAAACAGGTCTTGTCCAGCACGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: FVIDLASLLSIETGLVQHDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...GTGCTGGACAAGACCTGTTTCTATGCTGAGCAAGGAGGCCAGATCTATGACGAA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CCTGGCCTGTGGACACCTCTTCCACGAACATCTTCTCCCTGCGCAGAGCCATCATTTCTTCAAGCTCTCTaGTTTCCTGAGGGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: PGLWTPLPRTSSPCAEPSFLQAL*FPEGLL
Trigger: CAGAAGGCCCTCAGGAAAGCAGAGAGCTTGAAGAAA...TGATGGCTCTGCGCAGGGAGAAGATGTTCGTGGAAGAGGTGTCCACAGGCCAGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCTCTGGACATCGGCTTTaGTGGCTCGGTCCAAGTCAT +
Preference number: 2 (lower is better)
Translates to: LSKVSDLPLHILVWSSLSSGHRL*WLGPSH
Trigger: ATGACTTGGACCGAGCCAGCAAAGCCGATGTCCAGA...GCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGTCTGGACATCGGCTTTaGTGGCTCGGTCCAAGTCAT +
Preference number: 2 (lower is better)
Translates to: GNLTQARDLASLIVHREESGHRL*WLGPSH
Trigger: ATGACTTGGACCGAGCCAGCAAAGCCGATGTCCAGA...CTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCAATCAAGCCTGACACCTaGTGCACCCACTCGCTGGCT +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPIKPDT*CTHSLA
Trigger: AGCCAGCGAGTGGGTGCAGCAGGTGTCAGGCTTGAT...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCTTCATTCCCCACCAGCTCCCTTaGCCTGTGATTTCAGCTGGG +
Preference number: 2 (lower is better)
Translates to: EHGRSLRGVHLEELQGFIPHQLP*PVISAG
Trigger: CCCAGCTGAAATCACAGGGCAAGGGAGCTGGTGGGG...AATGAAGCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp TTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGCCCCACCAGCTCCCTTaGCCTGTGATTTCAGCTGGG +
Preference number: 2 (lower is better)
Translates to: LFYRRQRLSKEPAPIGKRPHQLP*PVISAG
Trigger: CCCAGCTGAAATCACAGGGCAAGGGAGCTGGTGGGG...CCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATCCCCACCAGCTCCCTTaGCCTGTGATTTCAGCTGGG +
Preference number: 2 (lower is better)
Translates to: LRSGEPLSIDASVTINSNPHQLP*PVISAG
Trigger: CCCAGCTGAAATCACAGGGCAAGGGAGCTGGTGGGG...ATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp ATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGAGACCTCCAGACCCCGTaGCCGGAGCTCTTCGATAGC +
Preference number: 2 (lower is better)
Translates to: IYRCERDDQQQCGVSGSRDLQTP*PELFDS
Trigger: GCTATCGAAGAGCTCCGGGCACGGGGTCTGGAGGTC...TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGAT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp AGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGCCACCATCAGCCAGTaGCACAGTGATGGTCCGAGC +
Preference number: 2 (lower is better)
Translates to: RAVIYRCERDDQQQCGVSATISQ*HSDGPS
Trigger: GCTCGGACCATCACTGTGGCACTGGCTGATGGTGGC...ACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR CCA 90 bp GCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: AQVWRAVIYRCERDDQQQPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: CSQVCSSYCWVRRGSLKVPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...GACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: STDAKGCQKSQPLLGRGIPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGCCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: RSGEPLSIDASVTINSNAPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...CGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: SHNPPDTLGNGFFRHDHKPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAGCCAGCAGCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: SSAGAFPHRTQQKSGSQQRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...CTGCTGGCTCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCTTCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: LGWTDGSSGSLLLPHSVLRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...AAGAACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCAGCTGCAGCGCCTCCTGCAGGCAGCCAACGTTCTTGCCTGTGGCCTGTGCAGATTAAGTATTGCACGTaGTCCTTTTATTCTCTGCAG +
Preference number: 2 (lower is better)
Translates to: PAAAPPAGSQRSCLWPVQIKYCT*SFYSLQ
Trigger: CTGCAGAGAATAAAAGGACCACGTGCAATACTTAAT...CTGCACAGGCCACAGGCAAGAACGTTGGCTGCCTGCAGGAGGCGCTGCAGCTGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTACACCGGGACCCCAATaGAGACGACTCGCACAGGGT +
Preference number: 2 (lower is better)
Translates to: PLSIDASVTINSNAGLVVTPGPQ*RRLAQG
Trigger: ACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGT...AACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCCTCCGGATACCCTTaGCAATGGCTTCTTCCGTCA +
Preference number: 2 (lower is better)
Translates to: LQGQRSPSAHPCLEQSEPSSGYP*QWLLPS
Trigger: TGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGA...AGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCATCCTCCGGATACCCTTaGCAATGGCTTCTTCCGTCA +
Preference number: 2 (lower is better)
Translates to: CERDDQQQCGVSGSRPMASSGYP*QWLLPS
Trigger: TGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGA...TGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGGTTGCTGTCGATGAACTGCTTCGTCTTCTCTAACACTCGTTTCTGGACATCGTTCCTGAGGGCCTTCTaGGCCTCGGCACCTGTGACA +
Preference number: 2 (lower is better)
Translates to: GLLSMNCFVFSNTRFWTSFLRAF*ASAPVT
Trigger: TGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAA...CGATGTCCAGAAACGAGTGTTAGAGAAGACGAAGCAGTTCATCGACAGCAACCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCCACTGGGGGATGTTCCTGAGGGCCTTCTaGGCCTCGGCACCTGTGACA +
Preference number: 2 (lower is better)
Translates to: FFRDLRVSRNSSFCHWGMFLRAF*ASAPVT
Trigger: TGTCACAGGTGCCGAGGCCCAGAAGGCCCTCAGGAA...CATCCCCCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGTCATCCTTCTGCCACTaGGGGATGACTGCAGTGGCC +
Preference number: 2 (lower is better)
Translates to: YRCERDDQQQCGVSGSRPSSFCH*GMTAVA
Trigger: GGCCACTGCAGTCATCCCCCAGTGGCAGAAGGATGA...CGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCCAGGATGACAAGAGGCTGGTTGGGGTTGCTGTCGATGAACTGCTTCGTCTTCGGACATCGGCTTTGCTaGCTCGGTCCAAGTCATCCA +
Preference number: 2 (lower is better)
Translates to: SRMTRGWLGLLSMNCFVFGHRLC*LGPSHP
Trigger: TGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCC...GAAGACGAAGCAGTTCATCGACAGCAACCCCAACCAGCCTCTTGTCATCCTGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAAGCTGCACCCACTCGCTaGCTTTTAAGCCCCGATTGG +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQAAPTR*LLSPDW
Trigger: CCAATCGGGGCTTAAAAGCCAGCGAGTGGGTGCAGC...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAACAGTGTCTCCGGGAATaGTCTTGCTGTCTCCCAGGC +
Preference number: 2 (lower is better)
Translates to: SHNPPDTLGNGFFRHDHKQCLRE*SCCLPG
Trigger: GCCTGGGAGACAGCAAGACCATTCCCGGAGACACTG...TTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp TTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCCCCTGTGATTTCAGCTaGGCCAGTTTCCTCTCCTCT +
Preference number: 2 (lower is better)
Translates to: LTQARDLASLIVHREEHGPCDFS*ASFLSS
Trigger: AGAGGAGAGGAAACTGGCCCAGCTGAAATCACAGGG...GCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GACCCCAATGGAGACGACTCGCACAGGGTCAGGATAGGTCTCATCAAACACAGCCCCTGTGATTTCAGCTaGGCCAGTTTCCTCTCCTCT +
Preference number: 2 (lower is better)
Translates to: DPNGDDSHRVRIGLIKHSPCDFS*ASFLSS
Trigger: AGAGGAGAGGAAACTGGCCCAGCTGAAATCACAGGG...GCTGTGTTTGATGAGACCTATCCTGACCCTGTGCGAGTCGTCTCCATTGGGGTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp AAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCACCAAGGACAGGATCCATaGGGTCCCTGCTACAAGGCT +
Preference number: 2 (lower is better)
Translates to: KVSDLPLHILVWSSLSLHQGQDP*GPCYKA
Trigger: AGCCTTGTAGCAGGGACCCCATGGATCCTGTCCTTG...GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR CCA 90 bp TGTCCTGGAAAGGAAAGCAAGGAAAGCTTTGAGACCAGTCCCTTTAGGAGCAGCGGAGCAGCAGAAAGCTaGGCTCCCAAATCAGGCCCG +
Preference number: 2 (lower is better)
Translates to: CPGKESKESFETSPFRSSGAAES*APKSGP
Trigger: CGGGCCTGATTTGGGAGCCCAGCTTTCTGCTGCTCC...GCTGCTCCTAAAGGGACTGGTCTCAAAGCTTTCCTTGCTTTCCTTTCCAGGACA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR CCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCAGTCACCCCACCTATTTaGCCTCCACCTCCACAGACG +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPVTPPI*PPPPQT
Trigger: CGTCTGTGGAGGTGGAGGCCAAATAGGTGGGGTGAC...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR CCA 90 bp CTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGGAATGCCAAACTCTTaGGTGAGGAGTTCCAGAGCC +
Preference number: 2 (lower is better)
Translates to: LGNLTQARDLASLIVHREGMPNS*VRSSRA
Trigger: GGCTCTGGAACTCCTCACCCAAGAGTTTGGCATTCC...TTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR CAA 90 bp GTCATCCACCTTCACCAGGTAGCCTTCGTCATAGATCTGGCCTCCTaGCTCAGCATAGAAACAGGTCTTGTCCAGCACCACTCCACACTC +
Preference number: 2 (lower is better)
Translates to: VIHLHQVAFVIDLAS*LSIETGLVQHHSTL
Trigger: GAGTGTGGAGTGGTGCTGGACAAGACCTGTTTCTATGCTGAGCAAGGAGGCCAGATCTATGACGAAGGCTACCTGGTGAAGGTGGATGAC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR CAA 90 bp AGTGCCTCAGTAGGGATGGCAACAGAGTTCGGCGTAAATGAGTTATaGTACGCGAAGGACACAGAGCAGCGCCTGGCACACAGTAAGTGC +
Preference number: 2 (lower is better)
Translates to: SASVGMATEFGVNEL*YAKDTEQRLAHSKC
Trigger: GCACTTACTGTGTGCCAGGCGCTGCTCTGTGTCCTTCGCGTACAATAACTCATTTACGCCGAACTCTGTTGCCATCCCTACTGAGGCACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR-3UTR TCA 90 bp CTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTGTTCTTGTAGCAGATaGAGAGCTCTTGGCTGGACG +
Preference number: 2 (lower is better)
Translates to: LQGQRSPSAHPCLEQSEPCSCSR*RALGWT
Trigger: CGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACA...AGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGGGTTAGTGGTTCTAGACCGATGGCACTGACGTGGAGGGCTCAGGGCAGAAATAAATTTAAGGGGCACTaGGACATAGGACTGCTCCCA +
Preference number: 2 (lower is better)
Translates to: GVSGSRPMALTWRAQGRNKFKGH*DIGLLP
Trigger: TGGGAGCAGTCCTATGTCTCAGTGCCCCTTAAATTT...ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAGAACCACTAACCCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: TDAKGCQKSQPLLGRGIETIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: DAKGCQKSQPLLGRGIEITIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...GATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCACTTTGGCGTCAGGAGCAACCAATaGGCCTTTCTGGTCAGCTTC +
Preference number: 2 (lower is better)
Translates to: SDLPLHILVWSSLSLHFGVRSNQ*AFLVSF
Trigger: GAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGAC...GCCAAAGTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CTCAGCATAGAAACAGGTCTTGTCCAGCACCACTCCACACTCCTGGCCTGTGGATCTCTTCAGCCTTCTTaGTCTGTTGGGTGGACATGG +
Preference number: 2 (lower is better)
Translates to: LSIETGLVQHHSTLLACGSLQPS*SVGWTW
Trigger: CCATGTCCACCCAACAGATCAAGAAGGCTGAAGAGA...TCCACAGGCCAGGAGTGTGGAGTGGTGCTGGACAAGACCTGTTTCTATGCTGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp TGTGTGGTTGCTCATGATGGGTCTTCGTCGGGGCTCATCAATAAACAGCCAGACACAAAAGCTCCTGCATaGCTCGAGTTCCGCAGGTGC +
Preference number: 2 (lower is better)
Translates to: CVVAHDGSSSGLINKQPDTKAPA*LEFRRC
Trigger: GCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGT...GTCTGGCTGTTTATTGATGAGCCCCGACGAAGACCCATCATGAGCAACCACACA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ATTGGGAAGAGGGATAGAGATCATGCGGCATTAAGTATTGCACGTGGTCCTTTTGGGCCTCGGCACCTGTaGCAGCCACAATCCTCCGGA +
Preference number: 2 (lower is better)
Translates to: IGKRDRDHAALSIARGPFGPRHL*QPQSSG
Trigger: TCCGGAGGATTGTGGCTGTCACAGGTGCCGAGGCCC...AAAAGGACCACGTGCAATACTTAATGCCGCATGATCTCTATCCCTCTTCCCAAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAAGCTCTCTGCTTTCCTaGGGGCCTTCTGGGCCTCGG +
Preference number: 2 (lower is better)
Translates to: LSIDASVTINSNAGLVVLSSLLS*GPSGPR
Trigger: CCGAGGCCCAGAAGGCCCTCAGGAAAGCAGAGAGCT...TAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CCCTTAGGCAACCACTTCGCTCAGAGCCACAGAGGCCACATGTCAGCCACCAGACCTTCTTTAGGGATTTaGGAGTCTCCCGCAATTCAT +
Preference number: 2 (lower is better)
Translates to: PLGNHFAQSHRGHMSATRPSLGI*ESPAIH
Trigger: ATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGG...TCTGGTGGCTGACATGTGGCCTCTGTGGCTCTGAGCGAAGTGGTTGCCTAAGGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GATCCACTGGAAACCCATAGGTGTCATAGAGGAGCCAAGCAGTGTCTCCGGGAAAGCATGGCAGAAGTCTaGGGGGAGTGCATCTTGAAG +
Preference number: 2 (lower is better)
Translates to: DPLETHRCHRGAKQCLRESMAEV*GECILK
Trigger: CTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCT...TTCCCGGAGACACTGCTTGGCTCCTCTATGACACCTATGGGTTTCCAGTGGATC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp ACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGCCTCATTGTCCACCGTaGAGAGCATGGCAGAAGTCT +
Preference number: 2 (lower is better)
Translates to: TDAKGCQKSQPLLGRGIEPHCPP*RAWQKS
Trigger: AGACTTCTGCCATGCTCTTCACGGTGGACAATGAGG...CTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CACAGCATTTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGTTGGGGAATCATCTGTaGCCTCCAGACCCCGTGCCC +
Preference number: 2 (lower is better)
Translates to: HSIYSTDAKGCQKSQPLLLGNHL*PPDPVP
Trigger: GGGCACGGGGTCTGGAGGTCACAGATGATTCCCCAA...CAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAAATGCTGTG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 5 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp GAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGTACCCTCCTCGGACCTaGGCATTCTTCACTGTAAAC +
Preference number: 2 (lower is better)
Translates to: ERDDQQQCGVSGSRPMALYPPRT*AFFTVN
Trigger: GTTTACAGTGAAGAATGCTCAGGTCCGAGGAGGGTA...CAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 9 transcripts:
ENST00000674652.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAGACGATCAACAGCAATaGGGGGTTAGTGGTTCTAGA +
Preference number: 2 (lower is better)
Translates to: DRSHQTQPVGPGWLSLLPDDQQQ*GVSGSR
Trigger: TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTC...TGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGGACGATCAACAGCAATaGGGGGTTAGTGGTTCTAGA +
Preference number: 2 (lower is better)
Translates to: QGQDRSHQTQPVGPGWLSDDQQQ*GVSGSR
Trigger: TCTAGAACCACTAACCCCGCATTGCTGTTGATCGTC...CGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGGCCGTTATCTATAGATaGGAGCGTGACGATCAACAG +
Preference number: 2 (lower is better)
Translates to: HDSSSAGAFPHRTQQKSGAVIYR*ERDDQQ
Trigger: CTGTTGATCGTCACGCTCGCATCTATAGATAACGGC...CCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GAGCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGGGTCCTTTTATTCTCTaGAGCAAAAACGATTCCTAC +
Preference number: 2 (lower is better)
Translates to: ELLAGRMDPVGASSFPTQGPFIL*SKNDSY
Trigger: GTAGGAATCGTTTTTGCTGCAGAGAATAAAAGGACC...CTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGCTC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGGCGAAGTTCAGAATGTaGGTAGCTGTGTGGTTGCTC +
Preference number: 2 (lower is better)
Translates to: DASVTINSNAGLVVLDRWAKFRM*VAVWLL
Trigger: GAGCAACCACACAGCTACGCACATTCTGAACTTCGC...CCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp ATGACCTTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCCACTGGGATGGCTTTCGCTGCTaGCAGGGGGCAATCCTGGGT +
Preference number: 2 (lower is better)
Translates to: MTFFRDLRVSRNSSFCHWDGFRC*QGAILG
Trigger: ACCCAGGATTGCCCCCTGGCAGCAGCGAAAGCCATC...CCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGGTCAT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTTTCTTCAAGCTCTCTaGTTTCCTGAGGGCCTTCTG +
Preference number: 2 (lower is better)
Translates to: ASVTINSNAGLVVLDRWHFLQAL*FPEGLL
Trigger: CAGAAGGCCCTCAGGAAAGCAGAGAGCTTGAAGAAA...GTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTGAGCCTTCAGCGATCTCCCTCTaGACATCCTTGTTTGGAGCA +
Preference number: 2 (lower is better)
Translates to: LQGQRSPSAHPCLEQSEPSAISL*TSLFGA
Trigger: TGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGA...AGGCTCAGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGCGCAATTCATCCTTCTaGCACTGGGGGATGACTGCA +
Preference number: 2 (lower is better)
Translates to: SGEPLSIDASVTINSNAGRNSSF*HWGMTA
Trigger: TGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCG...CCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp ACGCGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCGCAATTCATCCTTCTaGCACTGGGGGATGACTGCA +
Preference number: 2 (lower is better)
Translates to: TRKAQVWRAVIYRCERDDRNSSF*HWGMTA
Trigger: TGCAGTCATCCCCCAGTGGCAGAAGGATGAATTGCG...ATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCGCGT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACTCTGGACATCGGCTTTaGTGGCTCGGTCCAAGTCAT +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHSGHRL*WLGPSH
Trigger: ATGACTTGGACCGAGCCAGCAAAGCCGATGTCCAGA...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATGTGCAGACACATCCTTaGCACCACCTTTACCGTCCA +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHVQTHP*HHLYRP
Trigger: TGGACGGTAAAGGTGGTGGCAAGGATGTGTCTGCAC...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCCAGGATGACAAGAGGCTGGTTGGGGTTGCTGTCGATGAACTGCTTCGTCTTCCTTCAGCTCAGGAAATaGATCTCCCAGGGACTGGAC +
Preference number: 2 (lower is better)
Translates to: SRMTRGWLGLLSMNCFVFLQLRK*ISQGLD
Trigger: GTCCAGTCCCTGGGAGATGCATTTCCTGAGCTGAAG...GAAGACGAAGCAGTTCATCGACAGCAACCCCAACCAGCCTCTTGTCATCCTGGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GCGAAGTTCAGAATGTGCGTAGCTGTGTGGTTGCTCATGATGGGTCTTCGTCGGCTTCAGCTCAGGAAATaGATCTCCCAGGGACTGGAC +
Preference number: 2 (lower is better)
Translates to: AKFRMCVAVWLLMMGLRRLQLRK*ISQGLD
Trigger: GTCCAGTCCCTGGGAGATGCATTTCCTGAGCTGAAG...CCGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCTTCAGCTCAGGAAATaGATCTCCCAGGGACTGGAC +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHLQLRK*ISQGLD
Trigger: GTCCAGTCCCTGGGAGATGCATTTCCTGAGCTGAAG...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp GCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTCTGTTTTATCTTCACTaGTGTCATCCACCTTCACCA +
Preference number: 2 (lower is better)
Translates to: ALGWTDGSSGSLLLPHSVLFYLH*CHPPSP
Trigger: TGGTGAAGGTGGATGACAGCAGTGAAGATAAAACAG...AACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp TTCTACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATCATGCAGGGAGCTGCTaGTCCTCCCAATCTCAATCC +
Preference number: 2 (lower is better)
Translates to: FYRRQRLSKEPAPIGKRDHAGSC*SSQSQS
Trigger: GGATTGAGATTGGGAGGAGCAGCAGCTCCCTGCATG...ATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACATGCAGGGAGCTGCTaGTCCTCCCAATCTCAATCC +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQHAGSC*SSQSQS
Trigger: GGATTGAGATTGGGAGGAGCAGCAGCTCCCTGCATG...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCACCCAGTGCCCATACATaGTTGGGAAGAGCTCTCCTG +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPPSAHT*LGRALL
Trigger: CAGGAGAGCTCTTCCCAAGCATGTATGGGCACTGGG...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR GCA 90 bp GGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAAAGCTCCTGCATGACGGGTATTGGCAGCTCTaGTCAGCTTTGCCATGGGGT +
Preference number: 2 (lower is better)
Translates to: GYPWQWLLPSRSQKLLHDGYWQL*SALPWG
Trigger: ACCCCATGGCAAAGCTGAGCAGAGCTGCCAATACCC...GTCATGCAGGAGCTTTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR-3UTR GCA 90 bp GCTCTTGGCTGGACGGATGGATCCAGTGGGAGCCTCCTCCTTCCCCACTCAGTTTTGGACATCTTATTCTaGAGCACAGATACCAGTCGT +
Preference number: 2 (lower is better)
Translates to: ALGWTDGSSGSLLLPHSVLDILF*STDTSR
Trigger: ACGACTGGTATCTGTGCTGCAGAATAAGATGTCCAA...AACTGAGTGGGGAAGGAGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGAGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000676004.1
3UTR-3UTR CCA 90 bp TCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACTCTTGGCTGGACGGATaGATCCAGTGGGAGCCTCCT +
Preference number: 2 (lower is better)
Translates to: SIDASVTINSNAGLVVLDSWLDG*IQWEPP
Trigger: AGGAGGCTCCCACTGGATCCATCCGTCCAGCCAAGA...GTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp CAGCAGGAGCCACAGCATTTATTCTACAGACGCCAAAGGCTGTCAAAAGAGCCACCGATGGCACTGACGTaGAGGGCTCAGGGCAGAAAT +
Preference number: 2 (lower is better)
Translates to: QQEPQHLFYRRQRLSKEPPMALT*RAQGRN
Trigger: ATTTCTGCCCTGAGCCCTCCACGTCAGTGCCATCGG...TGGCTCTTTTGACAGCCTTTGGCGTCTGTAGAATAAATGCTGTGGCTCCTGCTG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000674691.1
ENST00000674963.1
ENST00000675643.1
3UTR-3UTR CCA 90 bp CATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: HDSSSAGAFPHRTQQKSGRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...CCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATG
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACCGGAAAGCTCAGGTCTaGAGAGCCGTTATCTATAGA +
Preference number: 2 (lower is better)
Translates to: ASVTINSNAGLVVLDRWHRKAQV*RAVIYR
Trigger: TCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG...GTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGCTGCTGCCAATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTT +
Preference number: 2 (lower is better)
Translates to: DRSHQTQPVGPGWLSLLPMCVAV*LLMMGL
Trigger: AAGACCCATCATGAGCAACCACACAGCTACGCACAT...TGGCAGCAGCGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCATGGGCGTATCGGACAGCTCGGCGGAGAATCCGTCTCAACACATATCCACGCATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTT +
Preference number: 2 (lower is better)
Translates to: SWAYRTARRRIRLNTYPRMCVAV*LLMMGL
Trigger: AAGACCCATCATGAGCAACCACACAGCTACGCACAT...GCGTGGATATGTGTTGAGACGGATTCTCCGCCGAGCTGTCCGATACGCCCATGA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
3UTR-3UTR CCA 90 bp CAGGGTCAGGATAGGTCTCATCAAACACAGCCCGTAGGCCCTGGATGGCTTTCGATGTGCGTAGCTGTGTaGTTGCTCATGATGGGTCTT +
Preference number: 2 (lower is better)
Translates to: QGQDRSHQTQPVGPGWLSMCVAV*LLMMGL
Trigger: AAGACCCATCATGAGCAACCACACAGCTACGCACAT...CGAAAGCCATCCAGGGCCTACGGGCTGTGTTTGATGAGACCTATCCTGACCCTG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp ATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACAGAAGTCAGGGAACCAATGAGCCTTTCTaGTCAGCTTCCCCAAGCACT +
Preference number: 2 (lower is better)
Translates to: MTRVPQVRSPTELNRSQGTNEPF*SASPST
Trigger: AGTGCTTGGGGAAGCTGACCAGAAAGGCTCATTGGT...TCCCTGACTTCTGTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCAT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATGCCTTCTTGATCTGTTaGGTGGACATGGCTCCCTTG +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHAFLIC*VDMAPL
Trigger: CAAGGGAGCCATGTCCACCCAACAGATCAAGAAGGC...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TTGCTGTCGATGAACTGCTTCGTCTTCTCTAACACTCGTTTCTGGACATCGGCTACACCGGGACCCCAATaGAGACGACTCGCACAGGGT +
Preference number: 2 (lower is better)
Translates to: LLSMNCFVFSNTRFWTSATPGPQ*RRLAQG
Trigger: ACCCTGTGCGAGTCGTCTCCATTGGGGTCCCGGTGT...AGCCGATGTCCAGAAACGAGTGTTAGAGAAGACGAAGCAGTTCATCGACAGCAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TCCAGGATGACAAGAGGCTGGTTGGGGTTGCTGTCGATGAACTGCTTCGTCTTCTCCTCCGGATACCCTTaGCAATGGCTTCTTCCGTCA +
Preference number: 2 (lower is better)
Translates to: SRMTRGWLGLLSMNCFVFSSGYP*QWLLPS
Trigger: TGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGA...GAAGACGAAGCAGTTCATCGACAGCAACCCCAACCAGCCTCTTGTCATCCTGGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCTGCACATCCTTGTTTaGAGCAGTCTGAGCCTTCAC +
Preference number: 2 (lower is better)
Translates to: GNLTQARDLASLIVHREELHILV*SSLSLH
Trigger: GTGAAGGCTCAGACTGCTCCAAACAAGGATGTGCAG...CTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp AAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCGGACATCGGCTTTGCTaGCTCGGTCCAAGTCATCCA +
Preference number: 2 (lower is better)
Translates to: KLRSGEPLSIDASVTINSGHRLC*LGPSHP
Trigger: TGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCC...GCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACAGGATGACAAGAGGCTaGTTGGGGTTGCTGTCGATG +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHRMTRG*LGLLSM
Trigger: CATCGACAGCAACCCCAACCAGCCTCTTGTCATCCT...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp ATTGGGAAGAGGGATAGAGATCATGCGGCATTAAGTATTGCACGTGGTCCTTTTGCTGGGCGAAGGAAGTaGCCAGCTGCAGCGCCTCCT +
Preference number: 2 (lower is better)
Translates to: IGKRDRDHAALSIARGPFAGRRK*PAAAPP
Trigger: AGGAGGCGCTGCAGCTGGCCACTTCCTTCGCCCAGC...AAAAGGACCACGTGCAATACTTAATGCCGCATGATCTCTATCCCTCTTCCCAAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp GACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCGCATTGAGCTTTTCATaGGCGTATCGGACAGCTCGG +
Preference number: 2 (lower is better)
Translates to: DAKGCQKSQPLLGRGIEIALSFS*AYRTAR
Trigger: CCGAGCTGTCCGATACGCCCATGAAAAGCTCAATGC...GATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GGCGAAGTTCAGAATGTGCGTAGCTGTGTGGTTGCTCATGATGGGTCTTCGTCGCCCTGTGATTTCAGCTaGGCCAGTTTCCTCTCCTCT +
Preference number: 2 (lower is better)
Translates to: GEVQNVRSCVVAHDGSSSPCDFS*ASFLSS
Trigger: AGAGGAGAGGAAACTGGCCCAGCTGAAATCACAGGG...CGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGCC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR CCA 90 bp GGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGGCATGCACTGCTAAGACTGTaGACAGACAGTGACGGTGTG +
Preference number: 2 (lower is better)
Translates to: GCQKSQPLLGRGIEIMRHALLRL*TDSDGV
Trigger: CACACCGTCACTGTCTGTCCACAGTCTTAGCAGTGC...ATGCCGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR-3UTR CCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACTGGTTCTCCCAAGGTaGGGTGGGACAAATGCCTCT +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQLVLPR*GGTNAS
Trigger: AGAGGCATTTGTCCCACCCCACCTTGGGAGAACCAG...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000674652.1
3UTR-3UTR CCA 90 bp ATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTCAATCCCAGACCGTaGGCCCTTAGGCAACCACTT +
Preference number: 2 (lower is better)
Translates to: IVHREEHGRSLRGVHLEELNPRP*ALRQPL
Trigger: AAGTGGTTGCCTAAGGGCCCACGGTCTGGGATTGAG...CTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTCTTCACGGTGGACAAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000674768.1
ENST00000675297.1
ENST00000675371.1
ENST00000675751.1
ENST00000676247.1
3UTR-3UTR CCA 90 bp TATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGCGGTCCTTACCAGGCTaGGAACAGCCTGTGATAAGC +
Preference number: 2 (lower is better)
Translates to: YRCERDDQQQCGVSGSRPRSLPG*EQPVIS
Trigger: GCTTATCACAGGCTGTTCCCAGCCTGGTAAGGACCG...CGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000675297.1
3UTR-3UTR TCA 90 bp GACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCTGTTCTTGTAGCAGATaGAGAGCTCTTGGCTGGACG +
Preference number: 2 (lower is better)
Translates to: DAKGCQKSQPLLGRGIEICSCSR*RALGWT
Trigger: CGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACA...GATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGTGTTCTTGTAGCAGATaGAGAGCTCTTGGCTGGACG +
Preference number: 2 (lower is better)
Translates to: TDAKGCQKSQPLLGRGIECSCSR*RALGWT
Trigger: CGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACA...CTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACCGTGAAGAGCATGGCAAATTTAAGGGGCACTaGGACATAGGACTGCTCCCA +
Preference number: 2 (lower is better)
Translates to: LTQARDLASLIVHREEHGKFKGH*DIGLLP
Trigger: TGGGAGCAGTCCTATGTCTCAGTGCCCCTTAAATTT...GCCATGCTCTTCACGGTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGAAATTTAAGGGGCACTaGGACATAGGACTGCTCCCA +
Preference number: 2 (lower is better)
Translates to: RDDQQQCGVSGSRPMALTKFKGH*DIGLLP
Trigger: TGGGAGCAGTCCTATGTCTCAGTGCCCCTTAAATTT...CGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAAGATTCAAATGTTCTTGTAGCAGATGAAGAGCTCTTGGCTGGACGGATGGATCTAGACCGATGGCACTaGCGTGGAGGGCTCAGGGCA +
Preference number: 2 (lower is better)
Translates to: QDSNVLVADEELLAGRMDLDRWH*RGGLRA
Trigger: TGCCCTGAGCCCTCCACGTCAGTGCCATCGGTCTAG...ATCCATCCGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACATTTGAATCTTG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGGAAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAAACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: RKAQVWRAVIYRCERDDQTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...TTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTTCCG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCTAACACTCGTTTCTGGACATCGGCTTTGCTGGCTCGGTCCAAGTCATCCATGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: SNTRFWTSALLARSKSSMTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CATGGATGACTTGGACCGAGCCAGCAAAGCCGATGTCCAGAAACGAGTGTTAGA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGATCATGCGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: QRLSKEPAPIGKRDRDHATIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CGCATGATCTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GACTGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGACGATTCCTACTTGCTaGCGCGGAAAGCTCAGGTCT +
Preference number: 2 (lower is better)
Translates to: DCSQVCSSYCWVRRGSLKTIPTC*RGKLRS
Trigger: AGACCTGAGCTTTCCGCGTCAGCAAGTAGGAATCGT...CTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCAGTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp CGTGAAGAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGCTTCAAGGCATAAACAGCCAGACCTaGTCCCCCACTTTCAGGTCA +
Preference number: 2 (lower is better)
Translates to: REEHGRSLRGVHLEELQGINSQT*SPTFRS
Trigger: TGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTAT...GCCTTGAAGCTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTCTTCACG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 10 transcripts:
ENST00000674652.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCGAAGTTCAGAATGTGCGTAGCTGTGTGGTTGCTCATGATGGGTCTTCGTCGGATAAACAGCCAGACCTaGTCCCCCACTTTCAGGTCA +
Preference number: 2 (lower is better)
Translates to: AKFRMCVAVWLLMMGLRRINSQT*SPTFRS
Trigger: TGACCTGAAAGTGGGGGATCAGGTCTGGCTGTTTAT...CCGACGAAGACCCATCATGAGCAACCACACAGCTACGCACATTCTGAACTTCGC
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 10 transcripts:
ENST00000674652.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GCTGCCTCAATCATCTCATTAGCAATCTCTTCAGCCTTCTTGATCTGTTGGGTGAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: AASIISLAISSAFLICWVSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...CACCCAACAGATCAAGAAGGCTGAAGAGATTGCTAATGAGATGATTGAGGCAGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: LSIDASVTINSNAGLVVLSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...TAGAACCACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCCAAGATTCAAATGTTCTTGTAGCAGATGAAGAGCTCTTGGCTGGACGGATGAGCTTCCCCAAGCACTaGGCGCAGGGCGAAGTTCAG +
Preference number: 2 (lower is better)
Translates to: SQDSNVLVADEELLAGRMSFPKH*AQGEVQ
Trigger: CTGAACTTCGCCCTGCGCTCAGTGCTTGGGGAAGCT...CATCCGTCCAGCCAAGAGCTCTTCATCTGCTACAAGAACATTTGAATCTTGGGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCAGTCAGGAGCAACCAATaGGCCTTTCTGGTCAGCTTC +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPVRSNQ*AFLVSF
Trigger: GAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGAC...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAAAGCTCCTGCATGACGTCAGGAGCAACCAATaGGCCTTTCTGGTCAGCTTC +
Preference number: 2 (lower is better)
Translates to: GYPWQWLLPSRSQKLLHDVRSNQ*AFLVSF
Trigger: GAAGCTGACCAGAAAGGCTCATTGGTTGCTCCTGAC...GTCATGCAGGAGCTTTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTCTCTTCAGCCTTCTTaGTCTGTTGGGTGGACATGG +
Preference number: 2 (lower is better)
Translates to: SGEPLSIDASVTINSNAGSLQPS*SVGWTW
Trigger: CCATGTCCACCCAACAGATCAAGAAGGCTGAAGAGA...CCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp TTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCCACTGGGGGATGACAAAAGCTCCTGCATaGCTCGAGTTCCGCAGGTGC +
Preference number: 2 (lower is better)
Translates to: FFRDLRVSRNSSFCHWGMTKAPA*LEFRRC
Trigger: GCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGT...CATCCCCCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AAAGCTCAGGTCTGGAGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGACAAAAGCTCCTGCATaGCTCGAGTTCCGCAGGTGC +
Preference number: 2 (lower is better)
Translates to: KAQVWRAVIYRCERDDQQTKAPA*LEFRRC
Trigger: GCACCTGCGGAACTCGAGTCATGCAGGAGCTTTTGT...CTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCTCCAGACCTGAGCTTT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp GGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCTCCTTCTTTAGGGATTTaGGAGTCTCCCGCAATTCAT +
Preference number: 2 (lower is better)
Translates to: GPLQGQRSPSAHPCLEQSPSLGI*ESPAIH
Trigger: ATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGG...AGACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGGGCCTCTCCAAGGTCAGCGATCTCCCTCTGCACATCCTTGTTTGGAGCAGTCCCTTCTTTAGGGATTTaGGAGTCTCCCGCAATTCAT +
Preference number: 2 (lower is better)
Translates to: RASPRSAISLCTSLFGAVPSLGI*ESPAIH
Trigger: ATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGG...GACTGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGACCTTGGAGAGGCCCT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ACAGACGCCAAAGGCTGTCAAAAGAGCCAGCCCCTATTGGGAAGAGGGATAGAGTGGGGTTGCTGTCGATaGACTGCTTCGTCTTCTCTA +
Preference number: 2 (lower is better)
Translates to: TDAKGCQKSQPLLGRGIEWGCCR*TASSSL
Trigger: TAGAGAAGACGAAGCAGTTCATCGACAGCAACCCCA...CTCTATCCCTCTTCCCAATAGGGGCTGGCTCTTTTGACAGCCTTTGGCGTCTGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ATTGGGAAGAGGGATAGAGATCATGCGGCATTAAGTATTGCACGTGGTCCTTTTATTCAGGGCCTTGGCTaGGGCGCCGCTCTCCATCTC +
Preference number: 2 (lower is better)
Translates to: IGKRDRDHAALSIARGPFIQGLG*GAALHL
Trigger: GAGATGGAGAGCGGCGCCTCAGCCAAGGCCCTGAAT...AAAAGGACCACGTGCAATACTTAATGCCGCATGATCTCTATCCCTCTTCCCAAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 11 transcripts:
ENST00000674652.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675569.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
3UTR-3UTR TCA 90 bp TCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCCCACCTCATTGTCCACCGTaGAGAGCATGGCAGAAGTCT +
Preference number: 2 (lower is better)
Translates to: SQVCSSYCWVRRGSLKVPPHCPP*RAWQKS
Trigger: AGACTTCTGCCATGCTCTTCACGGTGGACAATGAGG...TGGGACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp ATTGTCCACCGTGAAGAGCATGGCAGAAGTCTGAGGGGAGTGCATCTTGAAGAGGCATTCTGGGGAACTTaGCACAGGCACGTGATCTTG +
Preference number: 2 (lower is better)
Translates to: IVHREEHGRSLRGVHLEEAFWGT*HRHVIL
Trigger: CAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGC...CTCTTCAAGATGCACTCCCCTCAGACTTCTGCCATGCTCTTCACGGTGGACAAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR TCA 90 bp AGAGCCGTTATCTATAGATGCGAGCGTGACGATCAACAGCAATGCGGGGTTAGTAGCCCCTGCTGGCATTaGGCTTTTCATGGGCGTATC +
Preference number: 2 (lower is better)
Translates to: RAVIYRCERDDQQQCGVSSPCWH*AFHGRI
Trigger: GATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCT...ACTAACCCCGCATTGCTGTTGATCGTCACGCTCGCATCTATAGATAACGGCTCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp TTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCCACTGGGGGATGAGCCCCTGCTGGCATTaGGCTTTTCATGGGCGTATC +
Preference number: 2 (lower is better)
Translates to: FFRDLRVSRNSSFCHWGMSPCWH*AFHGRI
Trigger: GATACGCCCATGAAAAGCTCAATGCCAGCAGGGGCT...CATCCCCCAGTGGCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR TCA 90 bp AGCCACAATCCTCCGGATACCCTTGGCAATGGCTTCTTCCGTCACGATCACAAACTGTCTCCCAGGCTCTaGATTTTCCTGTCCAGGATG +
Preference number: 2 (lower is better)
Translates to: SHNPPDTLGNGFFRHDHKLSPRL*IFLSRM
Trigger: CATCCTGGACAGGAAAATTCAGAGCCTGGGAGACAG...TTTGTGATCGTGACGGAAGAAGCCATTGCCAAGGGTATCCGGAGGATTGTGGCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000674652.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676211.1
3UTR-3UTR GCA 90 bp CGTGACGATCAACAGCAATGCGGGGTTAGTGGTTCTAGACCGATGGCACTGACGGCCGTTATCTATAGATaGGAGCGTGACGATCAACAG +
Preference number: 2 (lower is better)
Translates to: RDDQQQCGVSGSRPMALTAVIYR*ERDDQQ
Trigger: CTGTTGATCGTCACGCTCGCATCTATAGATAACGGC...CGTCAGTGCCATCGGTCTAGAACCACTAACCCCGCATTGCTGTTGATCGTCACG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 27 transcripts:
ENST00000261772.13
ENST00000565361.3
ENST00000674512.1
ENST00000674652.1
ENST00000674691.1
ENST00000674768.1
ENST00000674811.1
ENST00000674963.1
ENST00000675035.1
ENST00000675045.1
ENST00000675120.1
ENST00000675133.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675643.1
ENST00000675691.1
ENST00000675751.1
ENST00000675853.1
ENST00000675953.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp AAAAGCTCCTGCATGACTCGAGTTCCGCAGGTGCGTTCCCCCACAGAACTCAACATAGACGGCCTTGGCTaGCTCAATCATCTCATTAGC +
Preference number: 2 (lower is better)
Translates to: KSSCMTRVPQVRSPTELNIDGLG*LNHLIS
Trigger: GCTAATGAGATGATTGAGGCAGCCAAGGCCGTCTAT...GTTGAGTTCTGTGGGGGAACGCACCTGCGGAACTCGAGTCATGCAGGAGCTTTT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 11 transcripts:
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TCATCCATGACCTTCTTTAGGGATTTGAGAGTCTCCCGCAATTCATCCTTCTGCCTGGATGGCTTTCGCTaGTGCCAGGGGGCAATCCTG +
Preference number: 2 (lower is better)
Translates to: SSMTFFRDLRVSRNSSFCLDGFR*CQGAIL
Trigger: CAGGATTGCCCCCTGGCAGCAGCGAAAGCCATCCAG...GCAGAAGGATGAATTGCGGGAGACTCTCAAATCCCTAAAGAAGGTCATGGATGA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACGATCACAAAAGCTCCTaGATGACTCGAGTTCCGCAG +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHDHKSS*MTRVPQ
Trigger: CTGCGGAACTCGAGTCATGCAGGAGCTTTTGTGATC...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 12 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TGCATTCTGGGGAACTTGACACAGGCACGTGATCTTGCCAGCCTCATTGTCCACTCAGCGATCTCCCTCTaGACATCCTTGTTTGGAGCA +
Preference number: 2 (lower is better)
Translates to: CILGNLTQARDLASLIVHSAISL*TSLFGA
Trigger: TGCTCCAAACAAGGATGTGCAGAGGGAGATCGCTGA...GTGGACAATGAGGCTGGCAAGATCACGTGCCTGTGTCAAGTTCCCCAGAATGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 13 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675120.1
ENST00000675297.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp TGCTCCCAAGTGTGTTCCAGTTACTGCTGGGTTAGGAGGGGCTCTTTAAAGGTCTCTGGACATCGGCTTTaGTGGCTCGGTCCAAGTCAT +
Preference number: 2 (lower is better)
Translates to: CSQVCSSYCWVRRGSLKVSGHRL*WLGPSH
Trigger: ATGACTTGGACCGAGCCAGCAAAGCCGATGTCCAGA...GACCTTTAAAGAGCCCCTCCTAACCCAGCAGTAACTGGAACACACTTGGGAGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000674652.1
ENST00000674768.1
ENST00000674811.1
ENST00000675035.1
ENST00000675120.1
ENST00000675297.1
ENST00000675371.1
ENST00000675569.1
ENST00000675751.1
ENST00000676004.1
ENST00000676040.1
ENST00000676168.1
ENST00000676209.1
ENST00000676211.1
ENST00000676212.1
ENST00000676247.1
3UTR-3UTR GCA 90 bp CTTGATCTGTTGGGTGGACATGGCTCCCTTGGCAGTAAAGTCAAATCTGAGGCGGTGCAGACACATCCTTaGCACCACCTTTACCGTCCA +
Preference number: 2 (lower is better)
Translates to: LDLLGGHGSLGSKVKSEAVQTHP*HHLYRP
Trigger: TGGACGGTAAAGGTGGTGGCAAGGATGTGTCTGCAC...CGCCTCAGATTTG