Pregenerated sensors for FAM223A (Homo sapiens)
Ensembl gene IDs: ENSG00000279245Ensembl transcript IDs: ENST00000625031.1, ENST00000625204.1
Found 1 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).
| Type | Sensor | Details |
|---|---|---|
| CDS GCA 90 bp | TCTAAAGTGTACAATTCGATGGTTTTTAGTATATTCATAGATACGTaGAACCATCAGCATGACCAGCTTCAGGACATTCTCATCATCTCA | + |
|
Preference number: 5 (lower is better) Translates to: SKVYNSMVFSIFIDT*NHQHDQLQDILIIS Trigger: TGAGATGATGAGAATGTCCTGAAGCTGGTCATGCTGATGGTTGCACGTATCTATGAATATACTAAAAACCATCGAATTGTACACTTTAGA 38% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt. Matches the following 2 transcripts: ENST00000625031.1 ENST00000625204.1 |
||