RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for CDH4 (Homo sapiens)

Ensembl gene IDs: ENSG00000179242

Ensembl transcript IDs: ENST00000543233.2, ENST00000611855.4, ENST00000614565.5, ENST00000625686.1, ENST00000628489.2, ENST00000629889.2

Found 1217 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp GTGGGAGGCGGCCAATGTCGCCCAGCCCTCCTGGGTAGCGGCGGCTaGTGGCGGGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATC +
Preference number: 1 (lower is better)
Translates to: VGGGQCRPALLGSGG*WRDWGLLVLGPGNI
Trigger: GATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCCCGCCAGCAGCCGCCGCTACCCAGGAGGGCTGGGCGACATTGGCCGCCTCCCAC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp GGAGGCGGCCAATGTCGCCCAGCCCTCCTGGGTAGCGGCGGCTGCTaGCGGGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGC +
Preference number: 1 (lower is better)
Translates to: GGGQCRPALLGSGGC*RDWGLLVLGPGNIS
Trigger: GCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCCCGCCAGCAGCCGCCGCTACCCAGGAGGGCTGGGCGACATTGGCCGCCTCC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp GCACTAAGGACACAGCCGCAGGGAGTCGGGAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCG +
Preference number: 1 (lower is better)
Translates to: ALRTQPQGVGKTGRL*SVLLLRRPSTALTS
Trigger: CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGACTCCCTGCGGCTGTGTCCTTAGTGC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR GCA 90 bp GTGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTaGCCCCGACGAGGGTCCATAGGAGAGGAGAGGCACCGTCTGCAG +
Preference number: 1 (lower is better)
Translates to: VPASRTAASLDPAAA*PRRGSIGEERHRLQ
Trigger: CTGCAGACGGTGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCAC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp GTGCTGGCACCGCCCTGCCCGACACCAGGTCCTGCCCAGGGTCCCTaGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTG +
Preference number: 1 (lower is better)
Translates to: VLAPPCPTPGPAQGP*YLTSFLGKPVVTGL
Trigger: CAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACCAGGGACCCTGGGCAGGACCTGGTGTCGGGCAGGGCGGTGCCAGCAC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp ATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTaGCCCTTGACCTCTGTTGGTCCATCTCCTGGACTGGCTGTCTGC +
Preference number: 1 (lower is better)
Translates to: IAQLRTRGPRCGLAS*PLTSVGPSPGLAVC
Trigger: GCAGACAGCCAGTCCAGGAGATGGACCAACAGAGGTCAAGGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTAT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 90 bp CGCATTCCAATTGTACAGAGAGGTGGTCCCCCGCTGGGCCTGTTGTaGGGTACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGT +
Preference number: 1 (lower is better)
Translates to: RIPIVQRGGPPLGLL*GTVPPTDPRRHELG
Trigger: ACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGTACCTCACAACAGGCCCAGCGGGGGACCACCTCTCTGTACAATTGGAATGCG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp ACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTaGACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGG +
Preference number: 1 (lower is better)
Translates to: TALFSCQGGSLVPAI*TALRMVGAVESVLG
Trigger: CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp GGTGTGTTCTGGTCACCACGCCCAACCGTAACTGCCCTCTTCAGCTaGCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGG +
Preference number: 1 (lower is better)
Translates to: GVFWSPRPTVTALFS*QGGSLVPAICTALR
Trigger: CCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGTGGTGACCAGAACACACC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp TCGCAGGCTGCTGGGTGTGTTCTGGTCACCACGCCCAACCGTAACTaGCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTG +
Preference number: 1 (lower is better)
Translates to: SQAAGCVLVTTPNRN*PLQLPGRVLGSCHL
Trigger: CAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGTGGTGACCAGAACACACCCAGCAGCCTGCGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp GAGCGCTGTCCCAGGGGTGCCGGGACACAGACCCTCTCACTGTCCTaGAGAACCAATTCCTTCCCCCTGTCTGGCTTGAGTCAACCCAGC +
Preference number: 1 (lower is better)
Translates to: ERCPRGAGTQTLSLS*RTNSFPLSGLSQPS
Trigger: GCTGGGTTGACTCAAGCCAGACAGGGGGAAGGAATTGGTTCTGCAGGACAGTGAGAGGGTCTGTGTCCCGGCACCCCTGGGACAGCGCTC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp CCCATGGGGTCTGGTCGCCAGGGTTGGAGGGCTGGAGCCAGATGCTaGCTGGTTTGGACAACTCACTCTTCTGGACCAAAGGCAGAGGGG +
Preference number: 1 (lower is better)
Translates to: PMGSGRQGWRAGARC*LVWTTHSSGPKAEG
Trigger: CCCCTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGACCCCATGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp CCGTTGATGGCACCCCATGGGGTCTGGTCGCCAGGGTTGGAGGGCTaGAGCCAGATGCTGGCTGGTTTGGACAACTCACTCTTCTGGACC +
Preference number: 1 (lower is better)
Translates to: PLMAPHGVWSPGLEG*SQMLAGLDNSLFWT
Trigger: GGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGACCCCATGGGGTGCCATCAACGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 90 bp CCAAGGCGCCCAGACACAGCCATGCCAGAGGGAGAATGCACCCTCTaGGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGTCCCA +
Preference number: 1 (lower is better)
Translates to: PRRPDTAMPEGECTL*VFSCSEHRQPSAVP
Trigger: TGGGACAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTCCCTCTGGCATGGCTGTGTCTGGGCGCCTTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp CACCCCATGGGGTCTGGTCGCCAGGGTTGGAGGGCTGGAGCCAGATaGTGGCTGGTTTGGACAACTCACTCTTCTGGACCAAAGGCAGAG +
Preference number: 1 (lower is better)
Translates to: HPMGSGRQGWRAGAR*WLVWTTHSSGPKAE
Trigger: CTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGACCCCATGGGGTG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp CAGTCTCCCCCATTTCTGAATGATGCCTTCAGAGCTGGGACTAGCTaGGGTTGGAGGCCGCTCGGGATGGGAAGGTGGGGACGGTCTGTC +
Preference number: 1 (lower is better)
Translates to: QSPPFLNDAFRAGTS*GWRPLGMGRWGRSV
Trigger: GACAGACCGTCCCCACCTTCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCCAGCTCTGAAGGCATCATTCAGAAATGGGGGAGACTG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp TCTGGTCGCCAGGGTTGGAGGGCTGGAGCCAGATGCTGGCTGGTTTaGACAACTCACTCTTCTGGACCAAAGGCAGAGGGGACCTGGTGG +
Preference number: 1 (lower is better)
Translates to: SGRQGWRAGARCWLV*TTHSSGPKAEGTWW
Trigger: CCACCAGGTCCCCTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp CCTGGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTaGGAGAGACAGAAAGCTGACCAAGCACGAGGCTTCCCCACGTGG +
Preference number: 1 (lower is better)
Translates to: PGTSPPSSGSQLSLA*ERQKADQARGFPTW
Trigger: CCACGTGGGGAAGCCTCGTGCTTGGTCAGCTTTCTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACCAGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp AACCGTAACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTaGCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGT +
Preference number: 1 (lower is better)
Translates to: NRNCPLQLPGRVLGS*HLHSPPDGWSCREC
Trigger: ACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACGGTT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp AGGGATGGGCACAGGAAGCCCTATGAACATCCCTCCAGCTGGCACTaGAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTG +
Preference number: 1 (lower is better)
Translates to: RDGHRKPYEHPSSWH*SFRLRDLGKRNGGL
Trigger: CAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTGCCCATCCCT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp GAGGGCTGGAGCCAGATGCTGGCTGGTTTGGACAACTCACTCTTCTaGACCAAAGGCAGAGGGGACCTGGTGGCACTCAGGGTGACAGGT +
Preference number: 1 (lower is better)
Translates to: EGWSQMLAGLDNSLF*TKGRGDLVALRVTG
Trigger: ACCTGTCACCCTGAGTGCCACCAGGTCCCCTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp TGGAGCAGGGATGGGCACAGGAAGCCCTATGAACATCCCTCCAGCTaGCACTGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGG +
Preference number: 1 (lower is better)
Translates to: WSRDGHRKPYEHPSS*HCSFRLRDLGKRNG
Trigger: CCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTGCCCATCCCTGCTCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp TTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGTCCCAGGGGTaGCGGGACACAGACCCTCTCACTGTCCTGCAGAACCAATTCCTT +
Preference number: 1 (lower is better)
Translates to: FSHAVSTGSRALSQG*RDTDPLTVLQNQFL
Trigger: AAGGAATTGGTTCTGCAGGACAGTGAGAGGGTCTGTGTCCCGGCACCCCTGGGACAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp AATTCCCTAAAGGAACCAAACCATGCCCTCGCACCTGGCCAGCATTaGCCTCCCGGCCTCCAGTGGGAGTCCCCTGATTATAGGCAGTCG +
Preference number: 1 (lower is better)
Translates to: NSLKEPNHALAPGQH*PPGLQWESPDYRQS
Trigger: CGACTGCCTATAATCAGGGGACTCCCACTGGAGGCCGGGAGGCCAATGCTGGCCAGGTGCGAGGGCATGGTTTGGTTCCTTTAGGGAATT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 90 bp AGGGTCAGAAAGGACAGGTTGGAGACTGAGACCCCAGCTCAACTCTaGAGGCTGCACAGGGGCAGCTGTGAGTTTGGTTTGGACAAGGAC +
Preference number: 1 (lower is better)
Translates to: RVRKDRLETETPAQL*RLHRGSCEFGLDKD
Trigger: GTCCTTGTCCAAACCAAACTCACAGCTGCCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTCTGACCCT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp GAAAGGACAGGTTGGAGACTGAGACCCCAGCTCAACTCTGAAGGCTaGACAGGGGCAGCTGTGAGTTTGGTTTGGACAAGGACCCTGACA +
Preference number: 1 (lower is better)
Translates to: ERTGWRLRPQLNSEG*TGAAVSLVWTRTLT
Trigger: TGTCAGGGTCCTTGTCCAAACCAAACTCACAGCTGCCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp GGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTaGCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCA +
Preference number: 1 (lower is better)
Translates to: GNPRRPRNFRERSSC*PGSRAIVTLRTIHA
Trigger: TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 90 bp CCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTaGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATACTC +
Preference number: 1 (lower is better)
Translates to: PKEASKFQRKEFMLP*LPGHSHTSNNPRIL
Trigger: GAGTATGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 90 bp AGTTTGGTTTGGACAAGGACCCTGACATCCAACGGGAACATGCCGTaGGCCTGGCACAGATGTGTGCACTCAAGGCCAAAGCTGTTCAGA +
Preference number: 1 (lower is better)
Translates to: SLVWTRTLTSNGNMP*AWHRCVHSRPKLFR
Trigger: TCTGAACAGCTTTGGCCTTGAGTGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTTGTCCAAACCAAACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp TTTCTCCTGTTTGCAAAACAAAAATTCCCTAAAGGAACCAAACCATaGCCTCGCACCTGGCCAGCATTGGCCTCCCGGCCTCCAGTGGGA +
Preference number: 1 (lower is better)
Translates to: FLLFAKQKFPKGTKP*PRTWPALASRPPVG
Trigger: TCCCACTGGAGGCCGGGAGGCCAATGCTGGCCAGGTGCGAGGGCATGGTTTGGTTCCTTTAGGGAATTTTTGTTTTGCAAACAGGAGAAA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 90 bp TGCTCTGACACGTTGGTGGCAGGAGGCCTAGCATTTTGGATGTGCTaGAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGC +
Preference number: 1 (lower is better)
Translates to: CSDTLVAGGLAFWMC*KTLQRETCWARNWG
Trigger: GCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATCCAAAATGCTAGGCCTCCTGCCACCAACGTGTCAGAGCA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 90 bp CGTATCTACAAGCTTAAGGAAGAGAGACGTTCGACACTGATTGTATaGTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGG +
Preference number: 1 (lower is better)
Translates to: RIYKLKEERRSTLIV*LANANSSSEVELGR
Trigger: CCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAATCAGTGTCGAACGTCTCTCTTCCTTAAGCTTGTAGATACG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGGCCTCTGCTCAGTCCTaGTCCTCCGGCGTCCGAGCA +
Preference number: 2 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQASAQS*SSGVRA
Trigger: TGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGC...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR-3UTR CCA 90 bp CCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGAGGCCTGGGTTGACTaGGGGTGGAGCCCCTTCAGG +
Preference number: 2 (lower is better)
Translates to: PASRTAASLDPAAACPRREAWVD*GWSPFR
Trigger: CCTGAAGGGGCTCCACCCCCAGTCAACCCAGGCCTC...TCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGG
69% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGGTGGCAGGTGCAGGGTaGGGCTCCGGGAGGGCTCCC +
Preference number: 2 (lower is better)
Translates to: CLHSTAQNSGTPVRPGQLVAGAG*GSGRAP
Trigger: GGGAGCCCTCCCGGAGCCCCACCCTGCACCTGCCAC...CAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACA
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CAA 90 bp CCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGTTaGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAG +
Preference number: 2 (lower is better)
Translates to: PALEIAVPASRTAAS*DPAAACPRRGSIGE
Trigger: CTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAGGAAGGGCCATAGGCTaGGGTGGGGGCCGGGGCCCC +
Preference number: 2 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAGRAIG*GGGRGP
Trigger: GGGGCCCCGGCCCCCACCTCAGCCTATGGCCCTTCC...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCCTTGCTGTCCTTCAGTaGCAGCCAGCGCGGTGCTGG +
Preference number: 2 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFLAVLQ*QPARCW
Trigger: CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAG...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGTCCCTGAGGGAGGCCTaGGTTGACTGGGGGTGGAGC +
Preference number: 2 (lower is better)
Translates to: PAICTALRMVGAVESVLGSLREA*VDWGWS
Trigger: GCTCCACCCCCAGTCAACCCAGGCCTCCCTCAGGGA...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCGAACCCCGCCCTCCCTaGGCAGCCATGGGAGGGTCA +
Preference number: 2 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGEPRPP*AAMGGS
Trigger: TGACCCTCCCATGGCTGCCCAGGGAGGGCGGGGTTC...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGTGGTGGCACTCAGGGTaGCAGGTGTCCCTGAGGGAG +
Preference number: 2 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEWWHSG*QVSLRE
Trigger: CTCCCTCAGGGACACCTGTCACCCTGAGTGCCACCA...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGGAGTGTCCTGGGGTTTaGATTGATGCCTGTCGCGGG +
Preference number: 2 (lower is better)
Translates to: SLDPAAACPRRGSIGEERECPGV*IDACRG
Trigger: CCCGCGACAGGCATCAATTCAAACCCCAGGACACTC...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 2 (lower is better)
Translates to: KTECLLLSFSASQRGAGQKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR-3UTR GCA 90 bp TGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCCCAGGGCTGGAGCCAGATaGTGGCTGGTTTGGACAACT +
Preference number: 2 (lower is better)
Translates to: CIAQLRTRGPRCGLASCPRAGAR*WLVWTT
Trigger: AGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCT...GGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCTCGGGATGGGAAGGTaGGGACGGTCTGTCTGCTTT +
Preference number: 2 (lower is better)
Translates to: SLDPAAACPRRGSIGEERLGMGR*GRSVCF
Trigger: AAAGCAGACAGACCGTCCCCACCTTCCCATCCCGAG...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACACCCCGAGACACTCCCTaGCCCCAGTGGCAGGTGCAG +
Preference number: 2 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTPRDTP*PQWQVQ
Trigger: CTGCACCTGCCACTGGGGTCAGGGAGTGTCTCGGGG...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCGCACAGGAAGCCCTATaGACATCCCTCCAGCTGGCA +
Preference number: 2 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFAQEAL*TSLQLA
Trigger: TGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTGC...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CGTAACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACGCCTCTGCTCAGTCCTaGTCCTCCGGCGTCCGAGCA +
Preference number: 2 (lower is better)
Translates to: RNCPLQLPGRVLGSCHLHASAQS*SSGVRA
Trigger: TGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGC...GTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGTTTGGACCCGGCCGCTaGCTGCCCCCGACGAGGGTC +
Preference number: 2 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALFGPGR*LPPTRV
Trigger: GACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAACTGGGGTCTCCTGGTaGTGGGTCCTGGGAACATCA +
Preference number: 2 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGTGVSW*WVLGTS
Trigger: TGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 2 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR-3UTR CCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 2 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGACTCGGGATGGGAAGGTaGGGACGGTCTGTCTGCTTT +
Preference number: 2 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGLGMGR*GRSVCF
Trigger: AAAGCAGACAGACCGTCCCCACCTTCCCATCCCGAG...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGAGAGCTGGGACTAGCTaGGGTTGGAGGCCGCTCGGG +
Preference number: 2 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQRAGTS*GWRPLG
Trigger: CCCGAGCGGCCTCCAACCCCAGCTAGTCCCAGCTCT...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGGCTGGAGCCAGATGCTaGCTGGTTTGGACAACTCAC +
Preference number: 2 (lower is better)
Translates to: SLDPAAACPRRGSIGEERAGARC*LVWTTH
Trigger: GTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGC...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACAGCCTTCTGCTGGGGCTaGAGGGCTAAGCCTCCCAGC +
Preference number: 2 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTAFCWG*RAKPPS
Trigger: GCTGGGAGGCTTAGCCCTTCAGCCCCAGCAGAAGGC...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGTGGTGGCACTCAGGGTaGCAGGTGTCCCTGAGGGAG +
Preference number: 2 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQWWHSG*QVSLRE
Trigger: CTCCCTCAGGGACACCTGTCACCCTGAGTGCCACCA...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCAACGGGAACATGCCGTaGGCCTGGCACAGATGTGTG +
Preference number: 2 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASNGNMP*AWHRCV
Trigger: CACACATCTGTGCCAGGCTCACGGCATGTTCCCGTT...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGAGCACAGGGGCAGCTGTaGGTTTGGTTTGGACAAGGA +
Preference number: 2 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRAQGQL*VWFGQG
Trigger: TCCTTGTCCAAACCAAACTCACAGCTGCCCCTGTGC...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCAGTTGGACATTGCTCTaGCACGTTGGTGGCAGGAGG +
Preference number: 2 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFSWTLL*HVGGRR
Trigger: CCTCCTGCCACCAACGTGTCAGAGCAATGTCCAACT...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACGCACAGCCCTCCGGATaGTTGGAGCTGTCGAGAGTG +
Preference number: 2 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNAQPSG*LELSRV
Trigger: CACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGC...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACGCCAGGGAGGGTCCTTaGTTCCTGCCATCTGCACAG +
Preference number: 2 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNAREGP*FLPSAQ
Trigger: CTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CAA 90 bp GTCTGGTCGCCAGGGTTGGAGGGCTGGAGCCAGATGCTGGCTGGTTaGGACAACTCACTCTTCTGGACCAAAGGCAGAGGGGACCTGGTG +
Preference number: 2 (lower is better)
Translates to: VWSPGLEGWSQMLAG*DNSLFWTKGRGDLV
Trigger: CACCAGGTCCCCTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGGGAAGGGCCATAGGCTaGGGTGGGGGCCGGGGCCCC +
Preference number: 2 (lower is better)
Translates to: DVLKDTTKRNLLGQKLGLGRAIG*GGGRGP
Trigger: GGGGCCCCGGCCCCCACCTCAGCCTATGGCCCTTCC...CAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAGGGACTAGCTGGGGTTaGAGGCCGCTCGGGATGGGA +
Preference number: 2 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAGTSWG*RPLGMG
Trigger: TCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCC...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CGTAACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACGTTGATGGCACCCCATaGGGTCTGGTCGCCAGGGTT +
Preference number: 2 (lower is better)
Translates to: RNCPLQLPGRVLGSCHLHVDGTP*GLVARV
Trigger: AACCCTGGCGACCAGACCCCATGGGGTGCCATCAAC...GTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCGTCGCCCAGCCCTCCTaGGTAGCGGCGGCTGCTGGC +
Preference number: 2 (lower is better)
Translates to: CAERHYKEKPAGPEIGAAVAQPS*VAAAAG
Trigger: GCCAGCAGCCGCCGCTACCCAGGAGGGCTGGGCGAC...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCACCCCAGCTCAACTCTaGAGGCTGCACAGGGGCAGC +
Preference number: 2 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCTPAQL*RLHRGS
Trigger: GCTGCCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGT...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCTGTGCTGGCACCGCCCTaGCCGACACCAGGTCCTGCC +
Preference number: 2 (lower is better)
Translates to: PQTTTEISSPSTTRPAIPVLAPP*PTPGPA
Trigger: GGCAGGACCTGGTGTCGGGCAGGGCGGTGCCAGCAC...AGGTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTGGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACCTGCTGGGTGTGTTCTaGTCACCACGCCCAACCGTA +
Preference number: 2 (lower is better)
Translates to: LVPHLLPREASCHWPGRDLLGVF*SPRPTV
Trigger: TACGGTTGGGCGTGGTGACCAGAACACACCCAGCAG...GTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACCAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGACTGTGGCCCTAGGCTaGGGGCTGCCTGCTGACCAA +
Preference number: 2 (lower is better)
Translates to: LQRETCWARNWGCPGPEETVALG*GLPADQ
Trigger: TTGGTCAGCAGGCAGCCCCCAGCCTAGGGCCACAGT...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CAA 90 bp TATGAACATCCCTCCAGCTGGCACTGCAGCTTCCGCCTGCGTGATTaGGGCAAAAGGAACGGGGGCTTGGCAGTGACAAGAGGCTGTGGG +
Preference number: 2 (lower is better)
Translates to: YEHPSSWHCSFRLRD*GKRNGGLAVTRGCG
Trigger: CCCACAGCCTCTTGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTCATA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTTCCCCCATTTCTGAATaGTGCCTTCAGAGCTGGGAC +
Preference number: 2 (lower is better)
Translates to: QGGSLVPAICTALRMVGASPISE*CLQSWD
Trigger: GTCCCAGCTCTGAAGGCATCATTCAGAAATGGGGGA...AGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATAGGTGACAGGTGTCCCTaGGGGAGGCCTGGGTTGACT +
Preference number: 2 (lower is better)
Translates to: FMLPWLPGHSHTSNNPRIGDRCP*GRPGLT
Trigger: AGTCAACCCAGGCCTCCCTCAGGGACACCTGTCACC...TATGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCAGCACGTGGCACAGTaGACCCCGCCCTCCCTGGGC +
Preference number: 2 (lower is better)
Translates to: DVLKDTTKRNLLGQKLGLQHVAQ*TPPSLG
Trigger: GCCCAGGGAGGGCGGGGTTCACTGTGCCACGTGCTG...CAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGGCCTCTGCTCAGTCCTaGTCCTCCGGCGTCCGAGCA +
Preference number: 2 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPAASAQS*SSGVRA
Trigger: TGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGC...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR-3UTR GCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAAGGGTCCTTGGTTCCTaGCATCTGCACAGCCCTCCG +
Preference number: 2 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHARVLGS*HLHSPP
Trigger: CGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCT...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACGACCCGGCCGCTGCCTaGCCCCGACGAGGGTCCATA +
Preference number: 2 (lower is better)
Translates to: FPKQQQRFPVLPLPAQLYDPAAA*PRRGSI
Trigger: TATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTC...GTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCCCTGGCACAGATGTGTaGACTCAAGGCCAAAGCTGT +
Preference number: 2 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGPGTDV*TQGQSC
Trigger: ACAGCTTTGGCCTTGAGTGCACACATCTGTGCCAGG...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 2 (lower is better)
Translates to: RHELGHVCLGDSVLILLVGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGTCCCTGAGGGAGGCCTaGGTTGACTGGGGGTGGAGC +
Preference number: 2 (lower is better)
Translates to: RHELGHVCLGDSVLILLVSLREA*VDWGWS
Trigger: GCTCCACCCCCAGTCAACCCAGGCCTCCCTCAGGGA...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTGGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACGCTGGAGCCAGATGCTaGCTGGTTTGGACAACTCAC +
Preference number: 2 (lower is better)
Translates to: LVPHLLPREASCHWPGRDAGARC*LVWTTH
Trigger: GTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGC...GTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACCAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCTGCCTTCTGCTGGGGCTaGAGGGCTAAGCCTCCCAGC +
Preference number: 2 (lower is better)
Translates to: PQTTTEISSPSTTRPAIPAFCWG*RAKPPS
Trigger: GCTGGGAGGCTTAGCCCTTCAGCCCCAGCAGAAGGC...AGGTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp AGCCATGGGAGGGTCAGAAAGGACAGGTTGGAGACTGAGACCCCAGCTCAACTCAACGGGAACATGCCGTaGGCCTGGCACAGATGTGTG +
Preference number: 2 (lower is better)
Translates to: SHGRVRKDRLETETPAQLNGNMP*AWHRCV
Trigger: CACACATCTGTGCCAGGCTCACGGCATGTTCCCGTT...GAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTCTGACCCTCCCATGGCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGACTGCCCTCTTCAGCTaGCAGGGAGGGTCCTTGGTT +
Preference number: 2 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALTALFS*QGGSLV
Trigger: AACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGT...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATAACGCCCAACCGTAACTaGCCTCTTCAGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: FMLPWLPGHSHTSNNPRITPNRN*PLQLPG
Trigger: CCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGT...TATGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp ATTGTATGCTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGGTGCCTGGGTAGCGGCGGCTaGTGGCGGGACTGGGGTCTC +
Preference number: 2 (lower is better)
Translates to: IVCLANANSSSEVELGRCLGSGG*WRDWGL
Trigger: GAGACCCCAGTCCCGCCAGCAGCCGCCGCTACCCAG...GCACCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGCCCTCCAGCTGGCACTaGAGCTTCCGCCTGCGTGAT +
Preference number: 2 (lower is better)
Translates to: RHELGHVCLGDSVLILLVPSSWH*SFRLRD
Trigger: ATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGG...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 2 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTRALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCTGGACAGCAGCAAGTTTaGACCCGGCCGCTGCCTGCC +
Preference number: 2 (lower is better)
Translates to: PQTTTEISSPSTTRPAIPGQQQV*TRPLPA
Trigger: GGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCC...AGGTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AGCCATGGGAGGGTCAGAAAGGACAGGTTGGAGACTGAGACCCCAGCTCAACTCTTCCTTCCCCCTGTCTaGCTTGAGTCAACCCAGCCC +
Preference number: 2 (lower is better)
Translates to: SHGRVRKDRLETETPAQLFLPPV*LESTQP
Trigger: GGGCTGGGTTGACTCAAGCCAGACAGGGGGAAGGAA...GAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTCTGACCCTCCCATGGCT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGTTCCTTCCCCCTGTCTaGCTTGAGTCAACCCAGCCC +
Preference number: 2 (lower is better)
Translates to: LQRETCWARNWGCPGPEEFLPPV*LESTQP
Trigger: GGGCTGGGTTGACTCAAGCCAGACAGGGGGAAGGAA...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCCCCCTTGACCTCTGTTaGTCCATCTCCTGGACTGGC +
Preference number: 2 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCPLDLC*SISWTG
Trigger: GCCAGTCCAGGAGATGGACCAACAGAGGTCAAGGGG...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCGGTAGCGGCGGCTGCTaGCGGGACTGGGGTCTCCTG +
Preference number: 2 (lower is better)
Translates to: PRDAQICRCEYIILQYLSGSGGC*RDWGLL
Trigger: CAGGAGACCCCAGTCCCGCCAGCAGCCGCCGCTACC...GGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACAACTGTGGCCCTAGGCTaGGGGCTGCCTGCTGACCAA +
Preference number: 2 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTTVALG*GLPADQ
Trigger: TTGGTCAGCAGGCAGCCCCCAGCCTAGGGCCACAGT...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCCTCCAGGCCCCTGCCTaGGCTCCTCACAGCATCCGG +
Preference number: 2 (lower is better)
Translates to: PRDAQICRCEYIILQYLSLQAPA*APHSIR
Trigger: CCGGATGCTGTGAGGAGCTCAGGCAGGGGCCTGGAG...GGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACAGAGGGAGGCCTGGGTTaGCTGGGGGTGGAGCCCCTT +
Preference number: 2 (lower is better)
Translates to: GLLSSGPRLSGTGNTLKTEGGLG*LGVEPL
Trigger: AAGGGGCTCCACCCCCAGTCAACCCAGGCCTCCCTC...TGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGACGCCCAACCGTAACTaGCCTCTTCAGCTGCCAGGG +
Preference number: 2 (lower is better)
Translates to: REPKEASKFQRKEFMLPWTPNRN*PLQLPG
Trigger: CCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGT...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCGACACCAGGTCCTaGCCAGGGTCCCTGGTACCT +
Preference number: 2 (lower is better)
Translates to: DVLKDTTKRNLLGQKLGLPDTRS*PGSLVP
Trigger: AGGTACCAGGGACCCTGGGCAGGACCTGGTGTCGGG...CAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGGCCAGAAATTGGGGCTaGCCAGGCCCTGAAGAGGAC +
Preference number: 2 (lower is better)
Translates to: RHELGHVCLGDSVLILLVARNWG*PGPEED
Trigger: GTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGC...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACAGATGCTGGCTGGTTTaGACAACTCACTCTTCTGGA +
Preference number: 2 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNRCWLV*TTHSSG
Trigger: TCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCT...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp ATTGTATGCTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGGTGCGCACCCCATGGGGTCTaGTCGCCAGGGTTGGAGGGC +
Preference number: 2 (lower is better)
Translates to: IVCLANANSSSEVELGRCAPHGV*SPGLEG
Trigger: GCCCTCCAACCCTGGCGACCAGACCCCATGGGGTGC...GCACCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCCGAAGGACTGAAGCATaGACTTCCCCAAACAACAAC +
Preference number: 2 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGRRTEA*TSPNNN
Trigger: GTTGTTGTTTGGGGAAGTCCATGCTTCAGTCCTTCG...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCTCCTGGGGTTTGAATTaGTGCCTGTCGCGGGGCCGT +
Preference number: 2 (lower is better)
Translates to: CAERHYKEKPAGPEIGAASWGLN*CLSRGR
Trigger: ACGGCCCCGCGACAGGCATCAATTCAAACCCCAGGA...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATTTGGACAAGGACCCTaGCATCCAACGGGAACATGC +
Preference number: 2 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAFGQGP*HPTGTC
Trigger: GCATGTTCCCGTTGGATGTCAGGGTCCTTGTCCAAA...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGACCCCAGCTCAACTCTaGAGGCTGCACAGGGGCAGC +
Preference number: 2 (lower is better)
Translates to: DVLKDTTKRNLLGQKLGLTPAQL*RLHRGS
Trigger: GCTGCCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGT...CAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACACATACTCCGAAGGACTaGAGCATGGACTTCCCCAAA +
Preference number: 2 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTHTPKD*SMDFPK
Trigger: TTTGGGGAAGTCCATGCTTCAGTCCTTCGGAGTATG...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACACTGGGGGCTGCCTGCTaGCCAAGGCCAGTCGTTCCT +
Preference number: 2 (lower is better)
Translates to: GLLSSGPRLSGTGNTLKTLGAAC*PRPVVP
Trigger: AGGAACGACTGGCCTTGGTCAGCAGGCAGCCCCCAG...TGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACAGTGTACAGCAAAGGCTaGTGGGATTTGAACCCCACT +
Preference number: 2 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTVYSKG*WDLNPT
Trigger: AGTGGGGTTCAAATCCCAGCAGCCTTTGCTGTACAC...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TTGAGACTACCCCTCGCCCAGCTTTTTGCTTTGGAGAGAACAGAATTATCATCTTTTGGACCCGGCCGCTaGCTGCCCCCGACGAGGGTC +
Preference number: 2 (lower is better)
Translates to: LRLPLAQLFALERTELSSFGPGR*LPPTRV
Trigger: GACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA...AGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 18 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGTGGTGGAGCTCATGCTaGCCCCAAAGGCACCCCGAG +
Preference number: 2 (lower is better)
Translates to: DVLKDTTKRNLLGQKLGLWWSSC*PQRHPE
Trigger: CTCGGGGTGCCTTTGGGGGCAGCATGAGCTCCACCA...CAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACATCGCACCCCATGGGGTCTaGTCGCCAGGGTTGGAGGGC +
Preference number: 2 (lower is better)
Translates to: STEFRTKTVWHWKHTENIAPHGV*SPGLEG
Trigger: GCCCTCCAACCCTGGCGACCAGACCCCATGGGGTGC...GATGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACAAGGCTCACAAGCGTCTaGCGGGAATCAGGAGCACAG +
Preference number: 2 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTRLTSV*RESGAQ
Trigger: CTGTGCTCCTGATTCCCGCCAGACGCTTGTGAGCCT...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCAGAAGCCAGTTGTCACTaGCCTGGGAGAGACAGAAAG +
Preference number: 2 (lower is better)
Translates to: KDPDIQREHAVSLAQMCAEASCH*PGRDRK
Trigger: CTTTCTGTCTCTCCCAGGCCAGTGACAACTGGCTTC...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACCCCTTGACCTCTGTTaGTCCATCTCCTGGACTGGC +
Preference number: 2 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTPLDLC*SISWTG
Trigger: GCCAGTCCAGGAGATGGACCAACAGAGGTCAAGGGG...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACATCCCATGCCCTCGCACCTaGCCAGCATTGGCCTCCCGG +
Preference number: 2 (lower is better)
Translates to: STEFRTKTVWHWKHTENIPCPRT*PALASR
Trigger: CCGGGAGGCCAATGCTGGCCAGGTGCGAGGGCATGG...GATGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp GATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCTCCCAGCTGGCCTTaGCTCCCAAGAGGCTCAAGA +
Preference number: 2 (lower is better)
Translates to: DVLKDTTKRNLLGQKLGLPPSWP*LPRGSR
Trigger: TCTTGAGCCTCTTGGGAGTCAAGGCCAGCTGGGAGG...CAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp GCTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGCAAGTGAAGACAGAGTaGCTCTTGCTGTCCTTCAGT +
Preference number: 2 (lower is better)
Translates to: AGLDSQEAQETPSCVQQRQVKTE*LLLSFS
Trigger: ACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTG...CCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAGC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTCATCCAACGGGAACATaGCGTGAGCCTGGCACAGAT +
Preference number: 2 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTHPTGT*REPGTD
Trigger: ATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATG...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGCTCAACTCTGAAGGCTaGACAGGGGCAGCTGTGAGT +
Preference number: 2 (lower is better)
Translates to: RHELGHVCLGDSVLILLVLNSEG*TGAAVS
Trigger: ACTCACAGCTGCCCCTGTGCAGCCTTCAGAGTTGAG...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp GGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACAAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 2 (lower is better)
Translates to: GLLSSGPRLSGTGNTLKTRALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...TGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGAGCCAGATGCTGGCTaGTTTGGACAACTCACTCTT +
Preference number: 2 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCEPDAG*FGQLTL
Trigger: AAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTC...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCAGCCCTCCGGATGGTTaGAGCTGTCGAGAGTGTCCT +
Preference number: 2 (lower is better)
Translates to: CAERHYKEKPAGPEIGAASPPDG*SCRECP
Trigger: AGGACACTCTCGACAGCTCCAACCATCCGGAGGGCT...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTAGGCTCACAAGCGTCTaGCGGGAATCAGGAGCACAG +
Preference number: 2 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPRLTSV*RESGAQ
Trigger: CTGTGCTCCTGATTCCCGCCAGACGCTTGTGAGCCT...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AGGCCTAGCATTTTGGATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCCTGCCCAGGGTCCCTaGTACCTCACCTCCTTCCTC +
Preference number: 2 (lower is better)
Translates to: RPSILDVLKDTTKRNLLGPAQGP*YLTSFL
Trigger: GAGGAAGGAGGTGAGGTACCAGGGACCCTGGGCAGG...GCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATCCAAAATGCTAGGCCT
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGCTGTGAGTTTGGTTTaGACAAGGACCCTGACATCC +
Preference number: 2 (lower is better)
Translates to: LQRETCWARNWGCPGPEEAVSLV*TRTLTS
Trigger: GGATGTCAGGGTCCTTGTCCAAACCAAACTCACAGC...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACATGTTGGTCCATCTCCTaGACTGGCTGTCTGCAGAGG +
Preference number: 2 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTCWSIS*TGCLQR
Trigger: CCTCTGCAGACAGCCAGTCCAGGAGATGGACCAACA...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TTGAGACTACCCCTCGCCCAGCTTTTTGCTTTGGAGAGAACAGAATTATCATCTGCCTCTGCTCAGTCCTaGTCCTCCGGCGTCCGAGCA +
Preference number: 2 (lower is better)
Translates to: LRLPLAQLFALERTELSSASAQS*SSGVRA
Trigger: TGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGC...AGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGACCCTCTCACTGTCCTaGAGAACCAATTCCTTCCCC +
Preference number: 2 (lower is better)
Translates to: RHELGHVCLGDSVLILLVTLSLS*RTNSFP
Trigger: GGGGAAGGAATTGGTTCTGCAGGACAGTGAGAGGGT...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AACCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCACGGCGCCACGAGCTaGGTCACGTGTGTCTGGGAG +
Preference number: 2 (lower is better)
Translates to: NLAMLRFAGVSTSYSSIFHGATS*VTCVWE
Trigger: CTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTG...AAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGGTT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACAGGAGAATGCACCCTCTaGGTTTTCTCATGCAGTGAG +
Preference number: 2 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTGECTL*VFSCSE
Trigger: CTCACTGCATGAGAAAACTCAGAGGGTGCATTCTCC...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCGGAGAGACAGAAAGCTaGCCAAGCACGAGGCTTCCC +
Preference number: 2 (lower is better)
Translates to: PRDAQICRCEYIILQYLSGETES*PSTRLP
Trigger: GGGAAGCCTCGTGCTTGGTCAGCTTTCTGTCTCTCC...GGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp CCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCGCACAGGAAGCCCTATaGACATCCCTCCAGCTGGCA +
Preference number: 2 (lower is better)
Translates to: PRDAQICRCEYIILQYLSAQEAL*TSLQLA
Trigger: TGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTGC...GGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp AGGCCTAGCATTTTGGATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCACTGCCCTCTTCAGCTaGCAGGGAGGGTCCTTGGTT +
Preference number: 2 (lower is better)
Translates to: RPSILDVLKDTTKRNLLGTALFS*QGGSLV
Trigger: AACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGT...GCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATCCAAAATGCTAGGCCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp AACCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTTGCGGCCTGGCCAGCTaGCCCTTGACCTCTGTTGGT +
Preference number: 2 (lower is better)
Translates to: NLAMLRFAGVSTSYSSIFCGLAS*PLTSVG
Trigger: ACCAACAGAGGTCAAGGGGCAGCTGGCCAGGCCGCA...AAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGGTT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACATCGAGTTCATGCTGCCCTaGCTCCCGGGCCATAGTCAC +
Preference number: 2 (lower is better)
Translates to: STEFRTKTVWHWKHTENIEFMLP*LPGHSH
Trigger: GTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTC...GATGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp TTGAGACTACCCCTCGCCCAGCTTTTTGCTTTGGAGAGAACAGAATTATCATCTGGGACTGGGGTCTCCTaGTGCTGGGTCCTGGGAACA +
Preference number: 2 (lower is better)
Translates to: LRLPLAQLFALERTELSSGTGVS*CWVLGT
Trigger: TGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCCC...AGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAA
52% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AACCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTTGGGTTGACTGGGGGTaGAGCCCCTTCAGGATGACC +
Preference number: 2 (lower is better)
Translates to: NLAMLRFAGVSTSYSSIFWVDWG*SPFRMT
Trigger: GGTCATCCTGAAGGGGCTCCACCCCCAGTCAACCCA...AAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGGTT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp AACCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTTGCTGGGCCAGAAATTaGGGCTGCCCAGGCCCTGAA +
Preference number: 2 (lower is better)
Translates to: NLAMLRFAGVSTSYSSIFCWARN*GCPGPE
Trigger: TTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCA...AAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGGTT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAATTATCATCTCAGTaGACTGTGTGTGTCGGCTGG +
Preference number: 2 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTELSSQ*TVCVGW
Trigger: CCAGCCGACACACACAGTCCACTGAGATGATAATTC...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGTCTAGGAAATTCAAGTaGAGACAGAGTGCCTCTTGC +
Preference number: 2 (lower is better)
Translates to: REPKEASKFQRKEFMLPWSRKFK*RQSASC
Trigger: GCAAGAGGCACTCTGTCTTCACTTGAATTTCCTAGA...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACATCAGCACTGACAGAAATTaGGACTACCCCTCGCCCAGC +
Preference number: 2 (lower is better)
Translates to: STEFRTKTVWHWKHTENISTDRN*DYPSPS
Trigger: GCTGGGCGAGGGGTAGTCTCAATTTCTGTCAGTGCT...GATGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTTGTGCTCATGCAGGCTaGTACACATTTTGCCCATTT +
Preference number: 2 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTCAHAG*YTFCPF
Trigger: AAATGGGCAAAATGTGTAGCAGCCTGCATGAGCACA...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp GGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACACAAAGAGAAACCTGCTaGGCCAGAAATTGGGGCTGC +
Preference number: 2 (lower is better)
Translates to: GLLSSGPRLSGTGNTLKTQRETC*ARNWGC
Trigger: GCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTG...TGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCAAGTGAAGACAGAGTaGCTCTTGCTGTCCTTCAGT +
Preference number: 2 (lower is better)
Translates to: FPKQQQRFPVLPLPAQLYQVKTE*LLLSFS
Trigger: ACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTG...GTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR TCA 90 bp TTGAGACTACCCCTCGCCCAGCTTTTTGCTTTGGAGAGAACAGAATTATCATCTTTTGGACAAGGACCCTaGCATCCAACGGGAACATGC +
Preference number: 2 (lower is better)
Translates to: LRLPLAQLFALERTELSSFGQGP*HPTGTC
Trigger: GCATGTTCCCGTTGGATGTCAGGGTCCTTGTCCAAA...AGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TTGAGACTACCCCTCGCCCAGCTTTTTGCTTTGGAGAGAACAGAATTATCATCTACCCTCTCACTGTCCTaGAGAACCAATTCCTTCCCC +
Preference number: 2 (lower is better)
Translates to: LRLPLAQLFALERTELSSTLSLS*RTNSFP
Trigger: GGGGAAGGAATTGGTTCTGCAGGACAGTGAGAGGGT...AGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAA
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR GCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTAGGAGCATTCTTGTTTaGATAGCACAGCTCAGAACT +
Preference number: 2 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPRSILV*IAQLRT
Trigger: AGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCT...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CCA 90 bp CGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCCCAAGATGCTGGCTGGTTTaGACAACTCACTCTTCTGGA +
Preference number: 2 (lower is better)
Translates to: RDAQICRCEYIILQYLSPRCWLV*TTHSSG
Trigger: TCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCT...TGGGGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp GTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTaGTGGGCAGCGGCCGGGTGCAGGGCGCTGTGGGGG +
Preference number: 3 (lower is better)
Translates to: VPLAVLQCQPAR*WAAAGCRALWG
Trigger: CCCCCACAGCGCCCTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCAC
74% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR CCA 72 bp CCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTaGGCAGCGGCCGGGTGCAGGGCGCTGTGGGGGTGG +
Preference number: 3 (lower is better)
Translates to: PLAVLQCQPARC*AAAGCRALWGW
Trigger: CCACCCCCACAGCGCCCTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGG
74% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR GCA 72 bp GGCCAATGTCGCCCAGCCCTCCTGGGTAGCGGCGGCTaGTGGCGGGACTGGGGTCTCCTGGTGCTGGGTCCT +
Preference number: 3 (lower is better)
Translates to: GQCRPALLGSGG*WRDWGLLVLGP
Trigger: AGGACCCAGCACCAGGAGACCCCAGTCCCGCCAGCAGCCGCCGCTACCCAGGAGGGCTGGGCGACATTGGCC
72% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp ACACAGCCGCAGGGAGTCGGGAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCT +
Preference number: 3 (lower is better)
Translates to: TQPQGVGKTGRL*SVLLLRRPSTA
Trigger: AGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGACTCCCTGCGGCTGTGT
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR CCA 72 bp AGACAGAAAGCTGACCAAGCACGAGGCTTCCCCACGTaGGGCCTGCCCCCTGCCGCAGCCCAAGGCGCCCAG +
Preference number: 3 (lower is better)
Translates to: RQKADQARGFPT*GLPPAAAQGAQ
Trigger: CTGGGCGCCTTGGGCTGCGGCAGGGGGCAGGCCCCACGTGGGGAAGCCTCGTGCTTGGTCAGCTTTCTGTCT
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGCCTCCCAGCTGGCCTaGACTCCCAAGAGGCTCAAG +
Preference number: 3 (lower is better)
Translates to: CQPRGQQQVWTRPLPAPDASQLA*TPKRLK
Trigger: CTTGAGCCTCTTGGGAGTCAAGGCCAGCTGGGAGGC...GTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCA
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp TGCTGGGCAGCGGCCGGGTGCAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGCTCAACGTGGGGATTG +
Preference number: 3 (lower is better)
Translates to: CWAAAGCRALWG*VLMLDSSTWGL
Trigger: CAATCCCCACGTTGAGCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCTGCACCCGGCCGCTGCCCAGCA
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
3UTR CCA 72 bp CCGGTGCGGCCTGGCCAGCTGCCCCTTGACCTCTGTTaGTCCATCTCCTGGACTGGCTGTCTGCAGAGGGGG +
Preference number: 3 (lower is better)
Translates to: PVRPGQLPLDLC*SISWTGCLQRG
Trigger: CCCCCTCTGCAGACAGCCAGTCCAGGAGATGGACCAACAGAGGTCAAGGGGCAGCTGGCCAGGCCGCACCGG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp TCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTaGCCCCGACGAGGGTCCATAGGAGAGGAGAGGCAC +
Preference number: 3 (lower is better)
Translates to: SRTAASLDPAAA*PRRGSIGEERH
Trigger: GTGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp AGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTaGCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAG +
Preference number: 3 (lower is better)
Translates to: SLEDSSKFGPGR*LPPTRVHRRGE
Trigger: CTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp CTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTaGCCCTTGACCTCTGTTGGTCCATCTCCTGGACTG +
Preference number: 3 (lower is better)
Translates to: LRTRGPRCGLAS*PLTSVGPSPGL
Trigger: CAGTCCAGGAGATGGACCAACAGAGGTCAAGGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp ATTGATGCCTGTCGCGGGGCCGTTGATGGCACCCCATaGGGTCTGGTCGCCAGGGTTGGAGGGCTGGAGCCA +
Preference number: 3 (lower is better)
Translates to: IDACRGAVDGTP*GLVARVGGLEP
Trigger: TGGCTCCAGCCCTCCAACCCTGGCGACCAGACCCCATGGGGTGCCATCAACGGCCCCGCGACAGGCATCAAT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp GCACCCAGCACGTGGCACAGTGAACCCCGCCCTCCCTaGGCAGCCATGGGAGGGTCAGAAAGGACAGGTTGG +
Preference number: 3 (lower is better)
Translates to: APSTWHSEPRPP*AAMGGSERTGW
Trigger: CCAACCTGTCCTTTCTGACCCTCCCATGGCTGCCCAGGGAGGGCGGGGTTCACTGTGCCACGTGCTGGGTGC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGACAGCCCTCCGGATGGTaGGAGCTGTCGAGAGTGTCC +
Preference number: 3 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRQPSGW*ELSRVS
Trigger: GGACACTCTCGACAGCTCCAACCATCCGGAGGGCTG...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp GGGACGGGGAGGCTTCGCAGGCTGCTGGGTGTGTTCTaGTCACCACGCCCAACCGTAACTGCCCTCTTCAGC +
Preference number: 3 (lower is better)
Translates to: GTGRLRRLLGVF*SPRPTVTALFS
Trigger: GCTGAAGAGGGCAGTTACGGTTGGGCGTGGTGACCAGAACACACCCAGCAGCCTGCGAAGCCTCCCCGTCCC
65% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTTCCGCCTGCGTGATTaGGGCAAAAGGAACGGGGGC +
Preference number: 3 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDFRLRD*GKRNGG
Trigger: GCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAA...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp ATTGTACAGAGAGGTGGTCCCCCGCTGGGCCTGTTGTaGGGTACTGTCCCTCCTACGGACCCACGGCGCCAC +
Preference number: 3 (lower is better)
Translates to: IVQRGGPPLGLL*GTVPPTDPRRH
Trigger: GTGGCGCCGTGGGTCCGTAGGAGGGACAGTACCTCACAACAGGCCCAGCGGGGGACCACCTCTCTGTACAAT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp GGACTTTATTCATTCTCTGGAGCAGCGCGCCCCGCCTaGCCGCGCACAACCGCTCCGCAAGGGTCTACTGAG +
Preference number: 3 (lower is better)
Translates to: GLYSFSGAARPA*PRTTAPQGSTE
Trigger: CTCAGTAGACCCTTGCGGAGCGGTTGTGCGCGGGCAGGCGGGGCGCGCTGCTCCAGAGAATGAATAAAGTCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTCCTCGGGAAGCCAGTaGTCACTGGCCTGGGAGAGA +
Preference number: 3 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASSSGSQ*SLAWER
Trigger: TCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGA...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp AAGCCAGTTGTCACTGGCCTGGGAGAGACAGAAAGCTaGCCAAGCACGAGGCTTCCCCACGTGGGGCCTGCC +
Preference number: 3 (lower is better)
Translates to: KPVVTGLGETES*PSTRLPHVGPA
Trigger: GGCAGGCCCCACGTGGGGAAGCCTCGTGCTTGGTCAGCTTTCTGTCTCTCCCAGGCCAGTGACAACTGGCTT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp TGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTaGCATCTGCACAGCCCTCCGGATGGTTGGAGCTGT +
Preference number: 3 (lower is better)
Translates to: CPLQLPGRVLGS*HLHSPPDGWSC
Trigger: ACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp GCTGGGTGTGTTCTGGTCACCACGCCCAACCGTAACTaGCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCC +
Preference number: 3 (lower is better)
Translates to: AGCVLVTTPNRN*PLQLPGRVLGS
Trigger: GGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGTGGTGACCAGAACACACCCAGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp GAGCTGGGACTAGCTGGGGTTGGAGGCCGCTCGGGATaGGAAGGTGGGGACGGTCTGTCTGCTTTAGACACT +
Preference number: 3 (lower is better)
Translates to: ELGLAGVGGRSG*EGGDGLSALDT
Trigger: AGTGTCTAAAGCAGACAGACCGTCCCCACCTTCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCCAGCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp CTGAATGATGCCTTCAGAGCTGGGACTAGCTGGGGTTaGAGGCCGCTCGGGATGGGAAGGTGGGGACGGTCT +
Preference number: 3 (lower is better)
Translates to: LNDAFRAGTSWG*RPLGMGRWGRS
Trigger: AGACCGTCCCCACCTTCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCCAGCTCTGAAGGCATCATTCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGACAGATGCTGGCTGGTTaGGACAACTCACTCTTCTGG +
Preference number: 3 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRQMLAG*DNSLFW
Trigger: CCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTG...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGAGGACAGCAGCAAGTTaGGACCCGGCCGCTGCCTGC +
Preference number: 3 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALRTAAS*DPAAAC
Trigger: GCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCT...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp CCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGTTTaGATTGATGCCTGTCGCGGGGCCGTTGATGGCACC +
Preference number: 3 (lower is better)
Translates to: PDGWSCRECPGV*IDACRGAVDGT
Trigger: GGTGCCATCAACGGCCCCGCGACAGGCATCAATTCAAACCCCAGGACACTCTCGACAGCTCCAACCATCCGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp ACATCCCTCCAGCTGGCACTGCAGCTTCCGCCTGCGTaGTTTGGGCAAAAGGAACGGGGGCTTGGCAGTGAC +
Preference number: 3 (lower is better)
Translates to: TSLQLALQLPPA*FGQKERGLGSD
Trigger: GTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp CGCCTGCCCGCGCACAACCGCTCCGCAAGGGTCTACTaGGTTCAGGACCAAGACTGTCTGGCACTGGAAACA +
Preference number: 3 (lower is better)
Translates to: RLPAHNRSARVY*VQDQDCLALET
Trigger: TGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAGCGGTTGTGCGCGGGCAGGCG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp GGGTCTGGTCGCCAGGGTTGGAGGGCTGGAGCCAGATaGTGGCTGGTTTGGACAACTCACTCTTCTGGACCA +
Preference number: 3 (lower is better)
Translates to: GSGRQGWRAGAR*WLVWTTHSSGP
Trigger: TGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGACCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp TTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTaGACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGT +
Preference number: 3 (lower is better)
Translates to: FSCQGGSLVPAI*TALRMVGAVES
Trigger: ACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp TGGTCACCACGCCCAACCGTAACTGCCCTCTTCAGCTaGCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACA +
Preference number: 3 (lower is better)
Translates to: WSPRPTVTALFS*QGGSLVPAICT
Trigger: TGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGTGGTGACCA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp GCTGGGGGCTGCCTGCTGACCAAGGCCAGTCGTTCCTaGCACTCCAACCTGCAGCACAGGTTTCTCCTGTTT +
Preference number: 3 (lower is better)
Translates to: AGGCLLTKASRS*HSNLQHRFLLF
Trigger: AAACAGGAGAAACCTGTGCTGCAGGTTGGAGTGGCAGGAACGACTGGCCTTGGTCAGCAGGCAGCCCCCAGC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp CAGCCATGGGAGGGTCAGAAAGGACAGGTTGGAGACTaGGACCCCAGCTCAACTCTGAAGGCTGCACAGGGG +
Preference number: 3 (lower is better)
Translates to: QPWEGQKGQVGD*DPSSTLKAAQG
Trigger: CCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTCTGACCCTCCCATGGCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp AGCTGTTTGGAGCAGGGATGGGCACAGGAAGCCCTATaGACATCCCTCCAGCTGGCACTGCAGCTTCCGCCT +
Preference number: 3 (lower is better)
Translates to: SCLEQGWAQEAL*TSLQLALQLPP
Trigger: AGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTGCCCATCCCTGCTCCAAACAGCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp ATGAACATCCCTCCAGCTGGCACTGCAGCTTCCGCCTaGGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAG +
Preference number: 3 (lower is better)
Translates to: MNIPPAGTAASA*VIWAKGTGAWQ
Trigger: CTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTCAT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTaGCCAGGCCCTGAAGAGGACTGTGGCCCTAGGCTG +
Preference number: 3 (lower is better)
Translates to: LQRETCWARNWG*PGPEEDCGPRL
Trigger: CAGCCTAGGGCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp CCATTTCTGAATGATGCCTTCAGAGCTGGGACTAGCTaGGGTTGGAGGCCGCTCGGGATGGGAAGGTGGGGA +
Preference number: 3 (lower is better)
Translates to: PFLNDAFRAGTS*GWRPLGMGRWG
Trigger: TCCCCACCTTCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCCAGCTCTGAAGGCATCATTCAGAAATGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp CAGGGTTGGAGGGCTGGAGCCAGATGCTGGCTGGTTTaGACAACTCACTCTTCTGGACCAAAGGCAGAGGGG +
Preference number: 3 (lower is better)
Translates to: QGWRAGARCWLV*TTHSSGPKAEG
Trigger: CCCCTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp CTCGCACCTGGCCAGCATTGGCCTCCCGGCCTCCAGTaGGAGTCCCCTGATTATAGGCAGTCGTATCTACAA +
Preference number: 3 (lower is better)
Translates to: LAPGQHWPPGLQ*ESPDYRQSYLQ
Trigger: TTGTAGATACGACTGCCTATAATCAGGGGACTCCCACTGGAGGCCGGGAGGCCAATGCTGGCCAGGTGCGAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp AAATTCCCTAAAGGAACCAAACCATGCCCTCGCACCTaGCCAGCATTGGCCTCCCGGCCTCCAGTGGGAGTC +
Preference number: 3 (lower is better)
Translates to: KFPKGTKPCPRT*PALASRPPVGV
Trigger: GACTCCCACTGGAGGCCGGGAGGCCAATGCTGGCCAGGTGCGAGGGCATGGTTTGGTTCCTTTAGGGAATTT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCATTCCCCCTGTCTGGCTaGAGTCAACCCAGCCCTGGA +
Preference number: 3 (lower is better)
Translates to: KDPDIQREHAVSLAQMCAFPLSG*SQPSPG
Trigger: TCCAGGGCTGGGTTGACTCAAGCCAGACAGGGGGAA...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAAGCTGTGAGTTTGGTTaGGACAAGGACCCTGACATC +
Preference number: 3 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGSCEFG*DKDPDI
Trigger: GATGTCAGGGTCCTTGTCCAAACCAAACTCACAGCT...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATCAGGAGCATTCTTGTTaGCATAGCACAGCTCAGAAC +
Preference number: 3 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDQEHSC*HSTAQN
Trigger: GTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTG...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp CCAGACACAGCCATGCCAGAGGGAGAATGCACCCTCTaGGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGC +
Preference number: 3 (lower is better)
Translates to: PDTAMPEGECTL*VFSCSEHRQPS
Trigger: GCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTCCCTCTGGCATGGCTGTGTCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp TCTGGTCGCCAGGGTTGGAGGGCTGGAGCCAGATGCTaGCTGGTTTGGACAACTCACTCTTCTGGACCAAAG +
Preference number: 3 (lower is better)
Translates to: SGRQGWRAGARC*LVWTTHSSGPK
Trigger: CTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGGCGACCAGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp GGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATaGTTGGAGCTGTCGAGAGTGTCCTGGGGTTTGAAT +
Preference number: 3 (lower is better)
Translates to: GPWFLPSAQPSG*LELSRVSWGLN
Trigger: ATTCAAACCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp AACGCATTCCAATTGTACAGAGAGGTGGTCCCCCGCTaGGCCTGTTGTGAGGTACTGTCCCTCCTACGGACC +
Preference number: 3 (lower is better)
Translates to: NAFQLYREVVPR*ACCEVLSLLRT
Trigger: GGTCCGTAGGAGGGACAGTACCTCACAACAGGCCCAGCGGGGGACCACCTCTCTGTACAATTGGAATGCGTT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCAAGACAGAGTGCCTCTaGCTGTCCTTCAGTGCCAGC +
Preference number: 3 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCKTECL*LSFSAS
Trigger: GCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGTTCCCCCTGTCTGGCTaGAGTCAACCCAGCCCTGGA +
Preference number: 3 (lower is better)
Translates to: RHELGHVCLGDSVLILLVFPLSG*SQPSPG
Trigger: TCCAGGGCTGGGTTGACTCAAGCCAGACAGGGGGAA...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp TGGACAAGGACCCTGACATCCAACGGGAACATGCCGTaGGCCTGGCACAGATGTGTGCACTCAAGGCCAAAG +
Preference number: 3 (lower is better)
Translates to: WTRTLTSNGNMP*AWHRCVHSRPK
Trigger: CTTTGGCCTTGAGTGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTTGTCCA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp CACAGGAAGCCCTATGAACATCCCTCCAGCTGGCACTaGAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAAC +
Preference number: 3 (lower is better)
Translates to: HRKPYEHPSSWH*SFRLRDLGKRN
Trigger: GTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp TCTGAAGGCTGCACAGGGGCAGCTGTGAGTTTGGTTTaGACAAGGACCCTGACATCCAACGGGAACATGCCG +
Preference number: 3 (lower is better)
Translates to: SEGCTGAAVSLV*TRTLTSNGNMP
Trigger: CGGCATGTTCCCGTTGGATGTCAGGGTCCTTGTCCAAACCAAACTCACAGCTGCCCCTGTGCAGCCTTCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp AAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTaGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCCCT +
Preference number: 3 (lower is better)
Translates to: KTLQRETCWARN*GCPGPEEDCGP
Trigger: AGGGCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACGTCCTGGGGTTTGAATaGATGCCTGTCGCGGGGCCG +
Preference number: 3 (lower is better)
Translates to: FPKQQQRFPVLPLPAQLYVLGFE*MPVAGP
Trigger: CGGCCCCGCGACAGGCATCAATTCAAACCCCAGGAC...GTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCTTCCGCCTGCGTGATTaGGGCAAAAGGAACGGGGGC +
Preference number: 3 (lower is better)
Translates to: CAERHYKEKPAGPEIGAAFRLRD*GKRNGG
Trigger: GCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAA...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp GGACTTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTAAGACAGAGTGCCTCTaGCTGTCCTTCAGTGCCAGC +
Preference number: 3 (lower is better)
Translates to: GLPQTTTEISSPSTTRPAKTECL*LSFSAS
Trigger: GCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT...AGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAAGTCC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACTCCTCGGGAAGCCAGTaGTCACTGGCCTGGGAGAGA +
Preference number: 3 (lower is better)
Translates to: FPKQQQRFPVLPLPAQLYSSGSQ*SLAWER
Trigger: TCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGA...GTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp TTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCTGGCCAGCTGCCCCTaGACCTCTGTTGGTCCATCT +
Preference number: 3 (lower is better)
Translates to: FPKQQQRFPVLPLPAQLYLASCP*TSVGPS
Trigger: AGATGGACCAACAGAGGTCAAGGGGCAGCTGGCCAG...GTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp AGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTaGCCTGGCTCCCGGGCCATAGTCACACTTCGAACA +
Preference number: 3 (lower is better)
Translates to: RRPRNFRERSSC*PGSRAIVTLRT
Trigger: TGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGAAAGGCTGCTGGGATTaGAACCCCACTCTGTTTTCA +
Preference number: 3 (lower is better)
Translates to: LQRETCWARNWGCPGPEEKGCWD*NPTLFS
Trigger: TGAAAACAGAGTGGGGTTCAAATCCCAGCAGCCTTT...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CCA 72 bp GCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTaGCTCCCGGGCCATAGTCACACTTCGAACAATCCA +
Preference number: 3 (lower is better)
Translates to: ASKFQRKEFMLP*LPGHSHTSNNP
Trigger: TGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp AGGCCTAGCATTTTGGATGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCAAAGGCTGCTGGGATTaGAACCCCACTCTGTTTTCA +
Preference number: 3 (lower is better)
Translates to: RPSILDVLKDTTKRNLLGKGCWD*NPTLFS
Trigger: TGAAAACAGAGTGGGGTTCAAATCCCAGCAGCCTTT...GCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACATCCAAAATGCTAGGCCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR-3UTR CAA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTCTGGGAGATTCTGTGTaGATTCTTTTGGTGTTATTC +
Preference number: 3 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTLGDSV*ILLVLF
Trigger: GAATAACACCAAAAGAATCAACACAGAATCTCCCAG...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp TCACACTTCGAACAATCCACGCATACTCCGAAGGACTaGAGCATGGACTTCCCCAAACAACAACAGAGATTT +
Preference number: 3 (lower is better)
Translates to: SHFEQSTHTPKD*SMDFPKQQQRF
Trigger: AAATCTCTGTTGTTGTTTGGGGAAGTCCATGCTTCAGTCCTTCGGAGTATGCGTGGATTGTTCGAAGTGTGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp CTGACAGAAATTGAGACTACCCCTCGCCCAGCTTTTTaGTTTGGAGAGAACAGAATTATCATCTCAGTGGAC +
Preference number: 3 (lower is better)
Translates to: LTEIETTPRPAF*FGENRIIISVD
Trigger: GTCCACTGAGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAATTTCTGTCAG
46% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR TCA 72 bp GAACGTTTAACCTCGCGATGCTCAGATTTGCAGGTGTaGGTACATCATACTCCAGTATCTTTCCCCAAAACA +
Preference number: 3 (lower is better)
Translates to: ERLTSRCSDLQV*VHHTPVSFPKT
Trigger: TGTTTTGGGGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGGTTAAACGTTC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR GCA 72 bp AAGCTTAAGGAAGAGAGACGTTCGACACTGATTGTATaGTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAG +
Preference number: 3 (lower is better)
Translates to: KLKEERRSTLIV*LANANSSSEVE
Trigger: CTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAATCAGTGTCGAACGTCTCTCTTCCTTAAGCTT
44% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGGAAGGGCCATAGGCTaGGGTGGGGGCCGGGGCCCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSGRAIG*GGGRGP
Trigger: GGGGCCCCGGCCCCCACCTCAGCCTATGGCCCTTCC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
73% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGTGGCAGGTGCAGGGTaGGGCTCCGGGAGGGCTCCC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTVAGAG*GSGRAP
Trigger: GGGAGCCCTCCCGGAGCCCCACCCTGCACCTGCCAC...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
73% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCAGCACGTGGCACAGTaGACCCCGCCCTCCCTGGGC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFQHVAQ*TPPSLG
Trigger: GCCCAGGGAGGGCGGGGTTCACTGTGCCACGTGCTG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCGGATCCTCACGAGCTaGTGCGGGAAGGGCCCGCGC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSRILTS*CGKGPR
Trigger: GCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGATCCG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
71% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCTCTGGAGGGTCCCGGTaGCGCTGGCCGGGGGTATCC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFSGGSR*RWPGVS
Trigger: GGATACCCCCGGCCAGCGGCACCGGGACCCTCCAGA...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
71% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGAGCTGACGGAGCCTaGGGTGGAGCCGCTCCCCTC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFGADGA*GGAAPL
Trigger: GAGGGGAGCGGCTCCACCGCAGGCTCCGTCAGCTCC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCCGCCTCAGCCCGTTaGCGTTCTGGTGCTGGGGCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSAASAR*RSGAGA
Trigger: GGCCCCAGCACCAGAACGCCAACGGGCTGAGGCGGC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
71% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGGTCTGTGCGGACGCTaGAGTGCCCGGATGGATCCC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTGLCGR*SARMDP
Trigger: GGGATCCATCCGGGCACTTCAGCGTCCGCACAGACC...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
70% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGCGGCACCATGGGCCTaGTCGGGTACTGGGGCTCAG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSAAPWA*SGTGAQ
Trigger: CTGAGCCCCAGTACCCGATCAGGCCCATGGTGCCGC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCCCCGAGACACTCCCTaGCCCCAGTGGCAGGTGCAG +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSPRDTP*PQWQVQ
Trigger: CTGCACCTGCCACTGGGGTCAGGGAGTGTCTCGGGG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
70% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCCTGTCCTTCCCCAGTaGTGGCACCGCCCTGCCCGA +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFPVLPQ*WHRPAR
Trigger: TCGGGCAGGGCGGTGCCAGCACTGGGGAAGGACAGG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
70% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCTGGGTAGCGGCGGCTaGTGGCGGGACTGGGGTCTC +
Preference number: 4 (lower is better)
Translates to: SLDPAAACPRRGSIGEERLGSGG*WRDWGL
Trigger: GAGACCCCAGTCCCGCCAGCAGCCGCCGCTACCCAG...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCGAGGCTTCCCCACGTaGGGCCTGCCCCCTGCCGCA +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARRGFPT*GLPPAA
Trigger: TGCGGCAGGGGGCAGGCCCCACGTGGGGAAGCCTCG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
70% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCCCGAACCCCGCCCTCCCTaGGCAGCCATGGGAGGGTCA +
Preference number: 4 (lower is better)
Translates to: CIAQLRTRGPRCGLASCPEPRPP*AAMGGS
Trigger: TGACCCTCCCATGGCTGCCCAGGGAGGGCGGGGTTC...GGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCA
70% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGGCACCCAGCACGTaGCACAGTGAACCCCGCCCT +
Preference number: 4 (lower is better)
Translates to: PASRTAASLDPAAACPRRGAPST*HSEPRP
Trigger: AGGGCGGGGTTCACTGTGCCACGTGCTGGGTGCCCC...TCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGG
70% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCACCTGGCCAGCATTaGCCTCCCGGCCTCCAGTGG +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFAPGQH*PPGLQW
Trigger: CCACTGGAGGCCGGGAGGCCAATGCTGGCCAGGTGC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
70% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCCCCCCATGCAGTCACCGTaGACGCCACCTGCTCGGAGG +
Preference number: 4 (lower is better)
Translates to: CIAQLRTRGPRCGLASCPPMQSP*TPPARR
Trigger: CCTCCGAGCAGGTGGCGTTCACGGTGACTGCATGGG...GGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCA
69% GC, longest homopolymer 7 nt, total homopolymer stretches 15 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGGTCTGTGCGGACGCTaGAGTGCCCGGATGGATCCC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSGLCGR*SARMDP
Trigger: GGGATCCATCCGGGCACTTCAGCGTCCGCACAGACC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGCACTGCCGCCGTGGTaGTCTGGCCGTTGGTGGCAT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSALPPW*SGRWWH
Trigger: ATGCCACCAACGGCCAGATCACCACGGCGGCAGTGC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
69% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGGCACTGCCGCCGTGGTaGTCTGGCCGTTGGTGGCAT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQALPPW*SGRWWH
Trigger: ATGCCACCAACGGCCAGATCACCACGGCGGCAGTGC...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCCTTCTGCTGGGGCTaGAGGGCTAAGCCTCCCAGC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSAFCWG*RAKPPS
Trigger: GCTGGGAGGCTTAGCCCTTCAGCCCCAGCAGAAGGC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCACCCCGAGACACTCCCTaGCCCCAGTGGCAGGTGCAG +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEAPRDTP*PQWQVQ
Trigger: CTGCACCTGCCACTGGGGTCAGGGAGTGTCTCGGGG...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
69% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGTGCGGACGCTGAAGTaGCCGGATGGATCCCCACTG +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTVRTLK*PDGSPL
Trigger: CAGTGGGGATCCATCCGGGCACTTCAGCGTCCGCAC...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCTCACGGTCCAGCACTaGCGCCGTGGTGATCTGGCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSLTVQH*RRGDLA
Trigger: GGCCAGATCACCACGGCGGCAGTGCTGGACCGTGAG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
69% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCTCACGGTCCAGCACTaGCGCCGTGGTGATCTGGCC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQLTVQH*RRGDLA
Trigger: GGCCAGATCACCACGGCGGCAGTGCTGGACCGTGAG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCTGGAGGGTCCCGGTaGCGCTGGCCGGGGGTATCC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARSGGSR*RWPGVS
Trigger: GGATACCCCCGGCCAGCGGCACCGGGACCCTCCAGA...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCCCAGACCAGCCGCTaGCACTGCGCCAATGGTGGT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSAQTSR*HCANGG
Trigger: ACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGGCCCAGACCAGCCGCTaGCACTGCGCCAATGGTGGT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQAQTSR*HCANGG
Trigger: ACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGC...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCCCATGGCTTCCGGCTaGTGCAGCTGGCTGAGGTCG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSPMASG*CSWLRS
Trigger: CGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCACGCCAGGGGCTTTaGTTGGCACGTGCCCCATGG +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSARQGL*LARAPW
Trigger: CCATGGGGCACGTGCCAAGCAAAGCCCCTGGCGTGC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCCGATGTCGCCTGGGTaGGGCACCATGGGCCTGATC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQPMSPG*GTMGLI
Trigger: GATCAGGCCCATGGTGCCGCACCCAGGCGACATCGG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCCTCTGCTCAGTCCTaGTCCTCCGGCGTCCGAGCA +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFASAQS*SSGVRA
Trigger: TGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
69% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCCCTGGTGGAGCTCATaGTGCCCCCAAAGGCACCCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSPWWSS*CPQRHP
Trigger: GGGGTGCCTTTGGGGGCAGCATGAGCTCCACCAGGG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
69% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGAGCCCGTTGGCGTTCTaGTGCTGGGGCCACGGCAGC +
Preference number: 4 (lower is better)
Translates to: SLDPAAACPRRGSIGEERSPLAF*CWGHGS
Trigger: GCTGCCGTGGCCCCAGCACCAGAACGCCAACGGGCT...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
69% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGAGATCTGCGCCTCCTTaGGCAGCAGCTCAGGGGCGT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTRSAPP*AAAQGR
Trigger: ACGCCCCTGAGCTGCTGCCCAAGGAGGCGCAGATCT...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCGTAGGGGCCGATGTTaGGGTCGACGTCAGCGTCGG +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQRRGRC*GRRQRR
Trigger: CCGACGCTGACGTCGACCCCAACATCGGCCCCTACG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCGTAGGGGCCGATGTTaGGGTCGACGTCAGCGTCGG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSRRGRC*GRRQRR
Trigger: CCGACGCTGACGTCGACCCCAACATCGGCCCCTACG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGAGCAGCTGCTTCGTGTaGCGCTCCTTCTCTCGCCGC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTSSCFV*RSFSRR
Trigger: GCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCT...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCCAGGGGCTTTGCTTaGCACGTGCCCCATGGCTTC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTARGFA*HVPHGF
Trigger: GAAGCCATGGGGCACGTGCCAAGCAAAGCCCCTGGC...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTCACCGATGTCGCCTaGGTGCGGCACCATGGGCCT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFVTDVA*VRHHGP
Trigger: AGGCCCATGGTGCCGCACCCAGGCGACATCGGTGAC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
69% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGGACAGCAGCAAGTTTaGACCCGGCCGCTGCCTGCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSGQQQV*TRPLPA
Trigger: GGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
69% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCGGCGCCCACTCCCGTaGTGCTGTACCGGATGGGGA +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARRRPLP*CCTGWG
Trigger: TCCCCATCCGGTACAGCATCACGGGAGTGGGCGCCG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCATGGGCCTTGTaGCGTACATCCGGCCGGACA +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFGPWAL*RTSGRT
Trigger: TGTCCGGCCGGATGTACGTCACAAGGCCCATGGACC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGGGCCAGCCGCCACTGTaGCGATATCTCCAGTCTCGC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQGQPPL*RYLQSR
Trigger: GCGAGACTGGAGATATCGTCACAGTGGCGGCTGGCC...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGGCCGTTGGTGGCATTaGTGTGCAGCCAGCTCGCTG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSGRWWH*CAASSL
Trigger: CAGCGAGCTGGCTGCACATCAATGCCACCAACGGCC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCGTCCTCGGGGTCAATaGGCAGCTGCTTCGTGTGGC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQRPRGQ*AAASCG
Trigger: GCCACACGAAGCAGCTGCTCATTGACCCCGAGGACG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCGTCCTCGGGGTCAATaGGCAGCTGCTTCGTGTGGC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSRPRGQ*AAASCG
Trigger: GCCACACGAAGCAGCTGCTCATTGACCCCGAGGACG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGATGAGTTCAGGGAGCTaGCGGAGCCTGCGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQMSSGS*RSLRWS
Trigger: GCTCCACCGCAGGCTCCGTCAGCTCCCTGAACTCAT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTATGAGTTCAGGGAGCTaGCGGAGCCTGCGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSMSSGS*RSLRWS
Trigger: GCTCCACCGCAGGCTCCGTCAGCTCCCTGAACTCAT...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGTGTCCGCCAGCTTCTTaGATCTGGGCCCCCAGTCGT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTCPPAS*IWAPSR
Trigger: ACGACTGGGGGCCCAGATTCAAGAAGCTGGCGGACA...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGGCCTTCTGCTGGGGCTaGAGGGCTAAGCCTCCCAGC +
Preference number: 4 (lower is better)
Translates to: SLDPAAACPRRGSIGEERAFCWG*RAKPPS
Trigger: GCTGGGAGGCTTAGCCCTTCAGCCCCAGCAGAAGGC...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGGTGACAGGTGTCCCTaGGGGAGGCCTGGGTTGACT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSGDRCP*GRPGLT
Trigger: AGTCAACCCAGGCCTCCCTCAGGGACACCTGTCACC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAACCCCAGCTCAACTCTaGAGGCTGCACAGGGGCAGC +
Preference number: 4 (lower is better)
Translates to: PASRTAASLDPAAACPRRTPAQL*RLHRGS
Trigger: GCTGCCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGT...TCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGG
68% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACAGCACGTGGCACAGTaGACCCCGCCCTCCCTGGGC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSQHVAQ*TPPSLG
Trigger: GCCCAGGGAGGGCGGGGTTCACTGTGCCACGTGCTG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAATCTGGAGGGTCCCGGTaGCGCTGGCCGGGGGTATCC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSESGGSR*RWPGVS
Trigger: GGATACCCCCGGCCAGCGGCACCGGGACCCTCCAGA...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCTTTGCTTGGCACGTaGCCCATGGCTTCCGGCTGC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFALLGT*PMASGC
Trigger: GCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCACCGATGTCGCCTGGGTaGGGCACCATGGGCCTGATC +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEAPMSPG*GTMGLI
Trigger: GATCAGGCCCATGGTGCCGCACCCAGGCGACATCGG...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGGAGCTGACGGAGCCTaGGGTGGAGCCGCTCCCCTC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCGADGA*GGAAPL
Trigger: GAGGGGAGCGGCTCCACCGCAGGCTCCGTCAGCTCC...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGGAGCTGACGGAGCCTaGGGTGGAGCCGCTCCCCTC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSGADGA*GGAAPL
Trigger: GAGGGGAGCGGCTCCACCGCAGGCTCCGTCAGCTCC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCTTGCTGTCCTTCAGTaGCAGCCAGCGCGGTGCTGG +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQLAVLQ*QPARCW
Trigger: CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCTTGCTGTCCTTCAGTaGCAGCCAGCGCGGTGCTGG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSLAVLQ*QPARCW
Trigger: CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACTGGTGGAGCTCATGCTaGCCCCAAAGGCACCCCGAG +
Preference number: 4 (lower is better)
Translates to: CQPRGQQQVWTRPLPAPDWWSSC*PQRHPE
Trigger: CTCGGGGTGCCTTTGGGGGCAGCATGAGCTCCACCA...GTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCA
68% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTGCGGGGACGAGGTCTaGGCCACCAGCAACCGCACC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARCGDEV*ATSNRT
Trigger: GGTGCGGTTGCTGGTGGCCCAGACCTCGTCCCCGCA...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGAGCCCGTTGGCGTTCTaGTGCTGGGGCCACGGCAGC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARSPLAF*CWGHGS
Trigger: GCTGCCGTGGCCCCAGCACCAGAACGCCAACGGGCT...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGCCGCCTCAGCCCGTTaGCGTTCTGGTGCTGGGGCC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSAASAR*RSGAGA
Trigger: GGCCCCAGCACCAGAACGCCAACGGGCTGAGGCGGC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCCATCCCGTTGGCCGTaGTGCTGTCGTCAGCATCGT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTPSRWP*CCRQHR
Trigger: ACGATGCTGACGACAGCACCACGGCCAACGGGATGG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGACCGCACCATCCCGTTaGCCGTGGTGCTGTCGTCAG +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQTAPSR*PWCCRQ
Trigger: CTGACGACAGCACCACGGCCAACGGGATGGTGCGGT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCTGGCCAGGGGCGCCTaGTTGGACACCATCACTGTC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFLARGA*LDTITV
Trigger: GACAGTGATGGTGTCCAACCAGGCGCCCCTGGCCAG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCTGGCCAGGGGCGCCTaGTTGGACACCATCACTGTC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSLARGA*LDTITV
Trigger: GACAGTGATGGTGTCCAACCAGGCGCCCCTGGCCAG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGACATCTGGATTCCGCTaGCCAGGGGCGCCTGGTTGG +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQTSGFR*PGAPGW
Trigger: CCAACCAGGCGCCCCTGGCCAGCGGAATCCAGATGT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCCACAGCTGAAAACGTaGTCAGCACGGTGCCGGGGG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSPQLKT*SARCRG
Trigger: CCCCCGGCACCGTGCTGACCACGTTTTCAGCTGTGG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCCGCCGTGGTGATCTaGCCGTTGGTGGCATTGATG +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTAAVVI*PLVALM
Trigger: CATCAATGCCACCAACGGCCAGATCACCACGGCGGC...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGAGATCTGCGCCTCCTTaGGCAGCAGCTCAGGGGCGT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQRSAPP*AAAQGR
Trigger: ACGCCCCTGAGCTGCTGCCCAAGGAGGCGCAGATCT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
68% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCAGCAGCTGCTTCGTGTaGCGCTCCTTCTCTCGCCGC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFSSCFV*RSFSRR
Trigger: GCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCT...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
68% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGAGCAGCTGCTTCGTGTaGCGCTCCTTCTCTCGCCGC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSSSCFV*RSFSRR
Trigger: GCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCT...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
68% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGCCAGGGGCTTTGCTTaGCACGTGCCCCATGGCTTC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSARGFA*HVPHGF
Trigger: GAAGCCATGGGGCACGTGCCAAGCAAAGCCCCTGGC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGCACCCCATGGGGTCTaGTCGCCAGGGTTGGAGGGC +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGAPHGV*SPGLEG
Trigger: GCCCTCCAACCCTGGCGACCAGACCCCATGGGGTGC...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
68% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTGGCAGGTGCAGGGTaGGGCTCCGGGAGGGCTCCC +
Preference number: 4 (lower is better)
Translates to: QGGSLVPAICTALRMVGAVAGAG*GSGRAP
Trigger: GGGAGCCCTCCCGGAGCCCCACCCTGCACCTGCCAC...AGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTG
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCCCATGCCCTCGCACCTaGCCAGCATTGGCCTCCCGG +
Preference number: 4 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFPCPRT*PALASR
Trigger: CCGGGAGGCCAATGCTGGCCAGGTGCGAGGGCATGG...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
68% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACACTGTGGCCCTAGGCTaGGGGCTGCCTGCTGACCAA +
Preference number: 4 (lower is better)
Translates to: CQPRGQQQVWTRPLPAPDTVALG*GLPADQ
Trigger: TTGGTCAGCAGGCAGCCCCCAGCCTAGGGCCACAGT...GTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCA
68% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CAA 72 bp GAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGTTaGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCC +
Preference number: 4 (lower is better)
Translates to: EIAVPASRTAAS*DPAAACPRRGS
Trigger: GGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTC
68% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCCCATGCAGTCACCGTaGACGCCACCTGCTCGGAGG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARPMQSP*TPPARR
Trigger: CCTCCGAGCAGGTGGCGTTCACGGTGACTGCATGGG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCAGCATCGTTGGCCGTaGCGGTCATCACGTAGGTGC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFQHRWP*RSSRRC
Trigger: GCACCTACGTGATGACCGTCACGGCCAACGATGCTG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
67% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCTCGGTCCATCACCGTaGGGTTTGCGACCACGGTCT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSLGPSP*GLRPRS
Trigger: AGACCGTGGTCGCAAACCTCACGGTGATGGACCGAG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATGGTCTGTGCGGACGCTaGAGTGCCCGGATGGATCCC +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDGLCGR*SARMDP
Trigger: GGGATCCATCCGGGCACTTCAGCGTCCGCACAGACC...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTCACAGCCTGCTGCATaGACCGGTCAGGGTCCACAG +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSSQPAA*TGQGPQ
Trigger: CTGTGGACCCTGACCGGTTCATGCAGCAGGCTGTGA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACCGTTCAGGCGGGTaGTGGTCCAGTTCTTCCGCA +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSHRSGG*WSSSSA
Trigger: TGCGGAAGAACTGGACCATCACCCGCCTGAACGGTG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGCGGCACCATGGGCCTaGTCGGGTACTGGGGCTCAG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEAAPWA*SGTGAQ
Trigger: CTGAGCCCCAGTACCCGATCAGGCCCATGGTGCCGC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGGCGGCACCATGGGCCTaGTCGGGTACTGGGGCTCAG +
Preference number: 4 (lower is better)
Translates to: PAICTALRMVGAVESVLGAAPWA*SGTGAQ
Trigger: CTGAGCCCCAGTACCCGATCAGGCCCATGGTGCCGC...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGAGGGAGGCCTGGGTTaGCTGGGGGTGGAGCCCCTT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSEGGLG*LGVEPL
Trigger: AAGGGGCTCCACCCCCAGTCAACCCAGGCCTCCCTC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTCCTGGGGTTTGAATTaGTGCCTGTCGCGGGGCCGT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSSWGLN*CLSRGR
Trigger: ACGGCCCCGCGACAGGCATCAATTCAAACCCCAGGA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCACAGGAAGCCCTATaGACATCCCTCCAGCTGGCA +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTAQEAL*TSLQLA
Trigger: TGCCAGCTGGAGGGATGTTCATAGGGCTTCCTGTGC...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCCGTTGGCGTTCTGGTaGTGGGGCCACGGCAGCAGG +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCPLAFW*WGHGSR
Trigger: CCTGCTGCCGTGGCCCCAGCACCAGAACGCCAACGG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACCGTTGGCGTTCTGGTaGTGGGGCCACGGCAGCAGG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEPLAFW*WGHGSR
Trigger: CCTGCTGCCGTGGCCCCAGCACCAGAACGCCAACGG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCGGTCATCACGTAGGTaGCTGGCTTGGAGCCCTCGT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSRSSRR*LAWSPR
Trigger: ACGAGGGCTCCAAGCCAGGCACCTACGTGATGACCG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTCCCGTTGGCCGTGGTaGTGTCGTCAGCATCGTTGG +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSSRWPW*CRQHRW
Trigger: CCAACGATGCTGACGACAGCACCACGGCCAACGGGA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCATCACCGTGAGGTTTaGGACCACGGTCTCCACGCG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSHHREV*DHGLHA
Trigger: CGCGTGGAGACCGTGGTCGCAAACCTCACGGTGATG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCATCACCGTGAGGTTTaGGACCACGGTCTCCACGCG +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFHHREV*DHGLHA
Trigger: CGCGTGGAGACCGTGGTCGCAAACCTCACGGTGATG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACTCACGGTCCAGCACTaGCGCCGTGGTGATCTGGCC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRLTVQH*RRGDLA
Trigger: GGCCAGATCACCACGGCGGCAGTGCTGGACCGTGAG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
67% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTCTGGAGGGTCCCGGTaGCGCTGGCCGGGGGTATCC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGSGGSR*RWPGVS
Trigger: GGATACCCCCGGCCAGCGGCACCGGGACCCTCCAGA...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCTGCGCCAATGGTGGTaGAGTCCCCGTTGTCATCAC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTLRQWW*SPRCHH
Trigger: GTGATGACAACGGGGACTGCACCACCATTGGCGCAG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGCCCAGACCAGCCGCTaGCACTGCGCCAATGGTGGT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARAQTSR*HCANGG
Trigger: ACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACCACGATGGCACCGGTaGCCAGACCAGCCGCTGCCA +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEPRWHR*PDQPLP
Trigger: TGGCAGCGGCTGGTCTGGGCACCGGTGCCATCGTGG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
67% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCACGATGGCACCGGTaGCCAGACCAGCCGCTGCCA +
Preference number: 4 (lower is better)
Translates to: CLHSTAQNSGTPVRPGQLPRWHR*PDQPLP
Trigger: TGGCAGCGGCTGGTCTGGGCACCGGTGCCATCGTGG...CAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACCACGATGGCACCGGTaGCCAGACCAGCCGCTGCCA +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSPRWHR*PDQPLP
Trigger: TGGCAGCGGCTGGTCTGGGCACCGGTGCCATCGTGG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
67% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCCCATGGCTTCCGGCTaGTGCAGCTGGCTGAGGTCG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARPMASG*CSWLRS
Trigger: CGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCCGATGTCGCCTGGGTaGGGCACCATGGGCCTGATC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARPMSPG*GTMGLI
Trigger: GATCAGGCCCATGGTGCCGCACCCAGGCGACATCGG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGGAGCTGACGGAGCCTaGGGTGGAGCCGCTCCCCTC +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQGADGA*GGAAPL
Trigger: GAGGGGAGCGGCTCCACCGCAGGCTCCGTCAGCTCC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 4 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGGGAGGCTTCGCAGGCTaGTGGGTGTGTTCTGGTCAC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQGGFAG*WVCSGH
Trigger: GTGACCAGAACACACCCAGCAGCCTGCGAAGCCTCC...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACTTTGGACCCGGCCGCTaGCTGCCCCCGACGAGGGTC +
Preference number: 4 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNFGPGR*LPPTRV
Trigger: GACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCATGCGGCCTGGCCAGCTaGCCCTTGACCTCTGTTGGT +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEACGLAS*PLTSVG
Trigger: ACCAACAGAGGTCAAGGGGCAGCTGGCCAGGCCGCA...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCGTTCCTCTACCCTGTaGCTGGGACTCCTTCCTCCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSRSSTL*LGLLPP
Trigger: GGGAGGAAGGAGTCCCAGCCACAGGGTAGAGGAACG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000543233.2
CDS-3UTR CCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCGGGGACGAGGTCTaGGCCACCAGCAACCGCACC +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASCGDEV*ATSNRT
Trigger: GGTGCGGTTGCTGGTGGCCCAGACCTCGTCCCCGCA...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCATCACGTAGGTGCCTaGCTTGGAGCCCTCGTCCAC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSHHVGA*LGALVH
Trigger: GTGGACGAGGGCTCCAAGCCAGGCACCTACGTGATG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCATCACGTAGGTGCCTaGCTTGGAGCCCTCGTCCAC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSHHVGA*LGALVH
Trigger: GTGGACGAGGGCTCCAAGCCAGGCACCTACGTGATG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGCCGCCGTGGTGATCTaGCCGTTGGTGGCATTGATG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSAAVVI*PLVALM
Trigger: CATCAATGCCACCAACGGCCAGATCACCACGGCGGC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
67% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCGGGTCCCGGTGCCGCTaGCCGGGGGTATCCCATTGT +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASGSRCR*PGVSHC
Trigger: ACAATGGGATACCCCCGGCCAGCGGCACCGGGACCC...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
67% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGGGTCCCGGTGCCGCTaGCCGGGGGTATCCCATTGT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSGSRCR*PGVSHC
Trigger: ACAATGGGATACCCCCGGCCAGCGGCACCGGGACCC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACGTAGGGGCCGATGTTaGGGTCGACGTCAGCGTCGG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRRRGRC*GRRQRR
Trigger: CCGACGCTGACGTCGACCCCAACATCGGCCCCTACG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCCACTGCGCCAATGGTaGTGCAGTCCCCGTTGTCAT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTPLRQW*CSPRCH
Trigger: ATGACAACGGGGACTGCACCACCATTGGCGCAGTGG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCTGCCACTGCGCCAATaGTGGTGCAGTCCCCGTTGT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSLPLRQ*WCSPRC
Trigger: ACAACGGGGACTGCACCACCATTGGCGCAGTGGCAG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGTCACCGATGTCGCCTaGGTGCGGCACCATGGGCCT +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGVTDVA*VRHHGP
Trigger: AGGCCCATGGTGCCGCACCCAGGCGACATCGGTGAC...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGCAGCCAGGCCCGTCTaGTCCCAACCAGGGCACTCT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARAARPV*SQPGHS
Trigger: AGAGTGCCCTGGTTGGGACCAGACGGGCCTGGCTGC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGGGACTAGCTGGGGTTaGAGGCCGCTCGGGATGGGA +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARGTSWG*RPLGMG
Trigger: TCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCCCTGGGTTGACTGGGGGTaGAGCCCCTTCAGGATGACC +
Preference number: 4 (lower is better)
Translates to: CIAQLRTRGPRCGLASCPWVDWG*SPFRMT
Trigger: GGTCATCCTGAAGGGGCTCCACCCCCAGTCAACCCA...GGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 21 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGAGGCCTGGGTTGACTaGGGGTGGAGCCCCTTCAGG +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGEAWVD*GWSPFR
Trigger: CCTGAAGGGGCTCCACCCCCAGTCAACCCAGGCCTC...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTTGATGGCACCCCATaGGGTCTGGTCGCCAGGGTT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFVDGTP*GLVARV
Trigger: AACCCTGGCGACCAGACCCCATGGGGTGCCATCAAC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
67% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGCCAGGGAGGGTCCTTaGTTCCTGCCATCTGCACAG +
Preference number: 4 (lower is better)
Translates to: CQPRGQQQVWTRPLPAPDAREGP*FLPSAQ
Trigger: CTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC...GTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCTGCTGGGTGTGTTCTaGTCACCACGCCCAACCGTA +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTLLGVF*SPRPTV
Trigger: TACGGTTGGGCGTGGTGACCAGAACACACCCAGCAG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGGGGCACCCAGCACGTaGCACAGTGAACCCCGCCCT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSGAPST*HSEPRP
Trigger: AGGGCGGGGTTCACTGTGCCACGTGCTGGGTGCCCC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCGGTAGCGGCGGCTGCTaGCGGGACTGGGGTCTCCTG +
Preference number: 4 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGGSGGC*RDWGLL
Trigger: CAGGAGACCCCAGTCCCGCCAGCAGCCGCCGCTACC...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATCACGGCGCCACGAGCTaGGTCACGTGTGTCTGGGAG +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDHGATS*VTCVWE
Trigger: CTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTG...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
67% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCAGAGGTGGTCCCCCGCTaGGCCTGTTGTGAGGTACTG +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEAEVVPR*ACCEVL
Trigger: CAGTACCTCACAACAGGCCCAGCGGGGGACCACCTC...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
67% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGTTTGGAGAGTGGGGCTaGTCTCGGTCCATCACCGTG +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQFGEWG*SRSITV
Trigger: CACGGTGATGGACCGAGATCAGCCCCACTCTCCAAA...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCTTTGGAGAGTGGGGCTaGTCTCGGTCCATCACCGTG +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFFGEWG*SRSITV
Trigger: CACGGTGATGGACCGAGATCAGCCCCACTCTCCAAA...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGGTCTGTGCGGACGCTaGAGTGCCCGGATGGATCCC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSGLCGR*SARMDP
Trigger: GGGATCCATCCGGGCACTTCAGCGTCCGCACAGACC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTCAGGGTCCACAGCTaGAAACGTGGTCAGCACGGT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFVRVHS*KRGQHG
Trigger: ACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGAC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGTCAGGGTCCACAGCTaGAAACGTGGTCAGCACGGT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSVRVHS*KRGQHG
Trigger: ACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGAC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGCACTGCCGCCGTGGTaGTCTGGCCGTTGGTGGCAT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCALPPW*SGRWWH
Trigger: ATGCCACCAACGGCCAGATCACCACGGCGGCAGTGC...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
66% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACGTCCTCGGGGTCAATaGGCAGCTGCTTCGTGTGGC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRRPRGQ*AAASCG
Trigger: GCCACACGAAGCAGCTGCTCATTGACCCCGAGGACG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGATGAGTTCAGGGAGCTaGCGGAGCCTGCGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARMSSGS*RSLRWS
Trigger: GCTCCACCGCAGGCTCCGTCAGCTCCCTGAACTCAT...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGAGTGTCCTGGGGTTTaGATTGATGCCTGTCGCGGG +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSECPGV*IDACRG
Trigger: CCCGCGACAGGCATCAATTCAAACCCCAGGACACTC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGAAGGGCCATAGGCTaGGGTGGGGGCCGGGGCCCC +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCGRAIG*GGGRGP
Trigger: GGGGCCCCGGCCCCCACCTCAGCCTATGGCCCTTCC...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAACCGTGAACGCCACCTaGTCGGAGGGGACCTGCAGC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSTVNAT*SEGTCS
Trigger: GCTGCAGGTCCCCTCCGAGCAGGTGGCGTTCACGGT...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCGTCCCATTTCTCTaGTGTCTGGCTGTCCCATGC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFGVPFL*CLAVPC
Trigger: GCATGGGACAGCCAGACAGCAGAGAAATGGGACGCC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGATCCTCACGAGCTGCTaGGGGAAGGGCCCGCGCGAG +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQILTSC*GKGPRE
Trigger: CTCGCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGAT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCATCCCGTTGGCCGTGGTaGTGTCGTCAGCATCGTTGG +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEASRWPW*CRQHRW
Trigger: CCAACGATGCTGACGACAGCACCACGGCCAACGGGA...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGTGCGGACGCTGAAGTaGCCGGATGGATCCCCACTG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARVRTLK*PDGSPL
Trigger: CAGTGGGGATCCATCCGGGCACTTCAGCGTCCGCAC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGAGATGGTCACCCCTaGCGTGGACTGGAAGGACAT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFGDGHP*RGLEGH
Trigger: ATGTCCTTCCAGTCCACGGCAGGGGTGACCATCTCC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGGAGATGGTCACCCCTaGCGTGGACTGGAAGGACAT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSGDGHP*RGLEGH
Trigger: ATGTCCTTCCAGTCCACGGCAGGGGTGACCATCTCC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGCCCAGACCAGCCGCTaGCACTGCGCCAATGGTGGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCAQTSR*HCANGG
Trigger: ACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGC...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCCACGATGGCACCGGTaGCCAGACCAGCCGCTGCCA +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQPRWHR*PDQPLP
Trigger: TGGCAGCGGCTGGTCTGGGCACCGGTGCCATCGTGG...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGGTCAATGAGCAGCTaGTTCGTGTGGCGCTCCTTC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFGSMSS*FVWRSF
Trigger: GAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGCCCATGGCTTCCGGCTaGTGCAGCTGGCTGAGGTCG +
Preference number: 4 (lower is better)
Translates to: PAICTALRMVGAVESVLGPMASG*CSWLRS
Trigger: CGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGG...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACCCATGGCTTCCGGCTaGTGCAGCTGGCTGAGGTCG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEPMASG*CSWLRS
Trigger: CGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACCGATGTCGCCTGGGTaGGGCACCATGGGCCTGATC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEPMSPG*GTMGLI
Trigger: GATCAGGCCCATGGTGCCGCACCCAGGCGACATCGG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGACCGATGTCGCCTGGGTaGGGCACCATGGGCCTGATC +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGPMSPG*GTMGLI
Trigger: GATCAGGCCCATGGTGCCGCACCCAGGCGACATCGG...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
66% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCTCCTGCATTTTCCCTaGCTCCGTGAAGCATCCCTG +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTLLHFP*LREASL
Trigger: CAGGGATGCTTCACGGAGGCAGGGAAAATGCAGGAG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACCCGACACCAGGTCCTaGCCAGGGTCCCTGGTACCT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSPDTRS*PGSLVP
Trigger: AGGTACCAGGGACCCTGGGCAGGACCTGGTGTCGGG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCATCCAACGGGAACATaGCGTGAGCCTGGCACAGAT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTHPTGT*REPGTD
Trigger: ATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGAGCCCGTTGGCGTTCTaGTGCTGGGGCCACGGCAGC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGSPLAF*CWGHGS
Trigger: GCTGCCGTGGCCCCAGCACCAGAACGCCAACGGGCT...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCCGCCTCAGCCCGTTaGCGTTCTGGTGCTGGGGCC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWAASAR*RSGAGA
Trigger: GGCCCCAGCACCAGAACGCCAACGGGCTGAGGCGGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCGTAGGTGCCTGGCTTaGAGCCCTCGTCCACGGAGC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCRRCLA*SPRPRS
Trigger: GCTCCGTGGACGAGGGCTCCAAGCCAGGCACCTACG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGGGCTCTGTGGGGTCTaGGTCACGATCCGGTACCGC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSGLCGV*VTIRYR
Trigger: GCGGTACCGGATCGTGACCCAGACCCCACAGAGCCC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGCTGAAGTGCCCGGATaGATCCCCACTGATGATGCG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSAEVPG*IPTDDA
Trigger: CGCATCATCAGTGGGGATCCATCCGGGCACTTCAGC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGTGGTCACCCCTGCCGTaGACTGGAAGGACATCTGGA +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQWSPLP*TGRTSG
Trigger: TCCAGATGTCCTTCCAGTCCACGGCAGGGGTGACCA...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATCCACAGCTGAAAACGTaGTCAGCACGGTGCCGGGGG +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDPQLKT*SARCRG
Trigger: CCCCCGGCACCGTGCTGACCACGTTTTCAGCTGTGG...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACCACAGCTGAAAACGTaGTCAGCACGGTGCCGGGGG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRPQLKT*SARCRG
Trigger: CCCCCGGCACCGTGCTGACCACGTTTTCAGCTGTGG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
66% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGGGTCCCGGTGCCGCTaGCCGGGGGTATCCCATTGT +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQGSRCR*PGVSHC
Trigger: ACAATGGGATACCCCCGGCCAGCGGCACCGGGACCC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGGGTCCCGGTGCCGCTaGCCGGGGGTATCCCATTGT +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGGSRCR*PGVSHC
Trigger: ACAATGGGATACCCCCGGCCAGCGGCACCGGGACCC...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
66% GC, longest homopolymer 6 nt, total homopolymer stretches 11 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCCACTGCGCCAATGGTaGTGCAGTCCCCGTTGTCAT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFPLRQW*CSPRCH
Trigger: ATGACAACGGGGACTGCACCACCATTGGCGCAGTGG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAAGCAGCTGCTTCGTGTaGCGCTCCTTCTCTCGCCGC +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGSSCFV*RSFSRR
Trigger: GCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCT...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGCCAGGGGCTTTGCTTaGCACGTGCCCCATGGCTTC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRARGFA*HVPHGF
Trigger: GAAGCCATGGGGCACGTGCCAAGCAAAGCCCCTGGC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGTCACCGATGTCGCCTaGGTGCGGCACCATGGGCCT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSVTDVA*VRHHGP
Trigger: AGGCCCATGGTGCCGCACCCAGGCGACATCGGTGAC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARRALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGRALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGGAGGCCTGGGTTGACTaGGGGTGGAGCCCCTTCAGG +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEEAWVD*GWSPFR
Trigger: CCTGAAGGGGCTCCACCCCCAGTCAACCCAGGCCTC...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTAGGCTCACAAGCGTCTaGCGGGAATCAGGAGCACAG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSRLTSV*RESGAQ
Trigger: CTGTGCTCCTGATTCCCGCCAGACGCTTGTGAGCCT...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACCTGCCCAGGGTCCCTaGTACCTCACCTCCTTCCTC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRPAQGP*YLTSFL
Trigger: GAGGAAGGAGGTGAGGTACCAGGGACCCTGGGCAGG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACAGTCGCCCAGCCCTCCTaGGTAGCGGCGGCTGCTGGC +
Preference number: 4 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTVAQPS*VAAAAG
Trigger: GCCAGCAGCCGCCGCTACCCAGGAGGGCTGGGCGAC...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCCTCCCGGCCTCCAGTaGGAGTCCCCTGATTATAGG +
Preference number: 4 (lower is better)
Translates to: SLDPAAACPRRGSIGEERPPGLQ*ESPDYR
Trigger: CCTATAATCAGGGGACTCCCACTGGAGGCCGGGAGG...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
66% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCATGCTGGGCCAGAAATTaGGGCTGCCCAGGCCCTGAA +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEACWARN*GCPGPE
Trigger: TTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCA...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGAATTGTACAGAGAGGTaGTCCCCCGCTGGGCCTGTT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTNCTER*SPAGPV
Trigger: AACAGGCCCAGCGGGGGACCACCTCTCTGTACAATT...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
66% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGGCCAGCCGCCACTGTaGCGATATCTCCAGTCTCGC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEGQPPL*RYLQSR
Trigger: GCGAGACTGGAGATATCGTCACAGTGGCGGCTGGCC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
64% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACTCGGTCCATCACCGTaGGGTTTGCGACCACGGTCT +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRLGPSP*GLRPRS
Trigger: AGACCGTGGTCGCAAACCTCACGGTGATGGACCGAG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCTCGGTCCATCACCGTaGGGTTTGCGACCACGGTCT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARLGPSP*GLRPRS
Trigger: AGACCGTGGTCGCAAACCTCACGGTGATGGACCGAG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGTTTGGAGAGTGGGGCTaGTCTCGGTCCATCACCGTG +
Preference number: 4 (lower is better)
Translates to: SLDPAAACPRRGSIGEERFGEWG*SRSITV
Trigger: CACGGTGATGGACCGAGATCAGCCCCACTCTCCAAA...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGTCTGTGCGGACGCTaGAGTGCCCGGATGGATCCC +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAGLCGR*SARMDP
Trigger: GGGATCCATCCGGGCACTTCAGCGTCCGCACAGACC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGATCACAGCCTGCTGCATaGACCGGTCAGGGTCCACAG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRSQPAA*TGQGPQ
Trigger: CTGTGGACCCTGACCGGTTCATGCAGCAGGCTGTGA...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGCACTGCCGCCGTGGTaGTCTGGCCGTTGGTGGCAT +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQALPPW*SGRWWH
Trigger: ATGCCACCAACGGCCAGATCACCACGGCGGCAGTGC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGACACCGTTCAGGCGGGTaGTGGTCCAGTTCTTCCGCA +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGHRSGG*WSSSSA
Trigger: TGCGGAAGAACTGGACCATCACCCGCCTGAACGGTG...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACACCGTTCAGGCGGGTaGTGGTCCAGTTCTTCCGCA +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRHRSGG*WSSSSA
Trigger: TGCGGAAGAACTGGACCATCACCCGCCTGAACGGTG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGACAGGATGCGCAAGCTaGGTTGGGCATAGTCACCGT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQTGCAS*VGHSHR
Trigger: ACGGTGACTATGCCCAACTCAGCTTGCGCATCCTGT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTGCCGCTTCATCCACATaGCAAACAGCAGGACCATGG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSAASST*QTAGPW
Trigger: CCATGGTCCTGCTGTTTGTCATGTGGATGAAGCGGC...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCGGCACCATGGGCCTaGTCGGGTACTGGGGCTCAG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWAAPWA*SGTGAQ
Trigger: CTGAGCCCCAGTACCCGATCAGGCCCATGGTGCCGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGTCCCCGGAACTGGATaGGTTCAGGGAGCTGACGGA +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARVPGTG*VQGADG
Trigger: TCCGTCAGCTCCCTGAACTCATCCAGTTCCGGGGAC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGTCCCCGGAACTGGATaGGTTCAGGGAGCTGACGGA +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRVPGTG*VQGADG
Trigger: TCCGTCAGCTCCCTGAACTCATCCAGTTCCGGGGAC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGTCCCCCATTTCTGAATaGTGCCTTCAGAGCTGGGAC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTSPISE*CLQSWD
Trigger: GTCCCAGCTCTGAAGGCATCATTCAGAAATGGGGGA...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGGGTGACAGGTGTCCCTaGGGGAGGCCTGGGTTGACT +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEGDRCP*GRPGLT
Trigger: AGTCAACCCAGGCCTCCCTCAGGGACACCTGTCACC...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGGTGGCACTCAGGGTaGCAGGTGTCCCTGAGGGAG +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASWWHSG*QVSLRE
Trigger: CTCCCTCAGGGACACCTGTCACCCTGAGTGCCACCA...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGATCCTCACGAGCTGCTaGGGGAAGGGCCCGCGCGAG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWILTSC*GKGPRE
Trigger: CTCGCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGAT...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGATCCTCACGAGCTGCTaGGGGAAGGGCCCGCGCGAG +
Preference number: 4 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQILTSC*GKGPRE
Trigger: CTCGCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGAT...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGATCCCGTTGGCCGTGGTaGTGTCGTCAGCATCGTTGG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRSRWPW*CRQHRW
Trigger: CCAACGATGCTGACGACAGCACCACGGCCAACGGGA...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACATCACCGTGAGGTTTaGGACCACGGTCTCCACGCG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRHHREV*DHGLHA
Trigger: CGCGTGGAGACCGTGGTCGCAAACCTCACGGTGATG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGTGCGGACGCTGAAGTaGCCGGATGGATCCCCACTG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEVRTLK*PDGSPL
Trigger: CAGTGGGGATCCATCCGGGCACTTCAGCGTCCGCAC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCTATCTCACAGCCTGCTaGATGAACCGGTCAGGGTCC +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFYLTAC*MNRSGS
Trigger: GGACCCTGACCGGTTCATGCAGCAGGCTGTGAGATA...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTATCTCACAGCCTGCTaGATGAACCGGTCAGGGTCC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSYLTAC*MNRSGS
Trigger: GGACCCTGACCGGTTCATGCAGCAGGCTGTGAGATA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGAGTATCTCACAGCCTaGTGCATGAACCGGTCAGGG +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFEYLTA*CMNRSG
Trigger: CCCTGACCGGTTCATGCAGCAGGCTGTGAGATACTC...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTTGGTGGCATTGATGTaGAGCCAGCTCGCTGGGTCT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSLVALM*SQLAGS
Trigger: AGACCCAGCGAGCTGGCTGCACATCAATGCCACCAA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCTCACGGTCCAGCACTaGCGCCGTGGTGATCTGGCC +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQLTVQH*RRGDLA
Trigger: GGCCAGATCACCACGGCGGCAGTGCTGGACCGTGAG...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCCCATGGCTTCCGGCTaGTGCAGCTGGCTGAGGTCG +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQPMASG*CSWLRS
Trigger: CGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGG...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGCTTTGCTTGGCACGTaGCCCATGGCTTCCGGCTGC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEALLGT*PMASGC
Trigger: GCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGCTTTGCTTGGCACGTaGCCCATGGCTTCCGGCTGC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSALLGT*PMASGC
Trigger: GCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGCACGCCAGGGGCTTTaGTTGGCACGTGCCCCATGG +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQARQGL*LARAPW
Trigger: CCATGGGGCACGTGCCAAGCAAAGCCCCTGGCGTGC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCGCACGCCAGGGGCTTTaGTTGGCACGTGCCCCATGG +
Preference number: 4 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGARQGL*LARAPW
Trigger: CCATGGGGCACGTGCCAAGCAAAGCCCCTGGCGTGC...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGCACGCCAGGGGCTTTaGTTGGCACGTGCCCCATGG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGARQGL*LARAPW
Trigger: CCATGGGGCACGTGCCAAGCAAAGCCCCTGGCGTGC...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGCCTCTGCTCAGTCCTaGTCCTCCGGCGTCCGAGCA +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQASAQS*SSGVRA
Trigger: TGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCTTGCTGTCCTTCAGTaGCAGCCAGCGCGGTGCTGG +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCLAVLQ*QPARCW
Trigger: CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
64% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACTTGCTGTCCTTCAGTaGCAGCCAGCGCGGTGCTGG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSELAVLQ*QPARCW
Trigger: CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
64% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACCCAAAGTGTACGTCTaGAGCCAGGCCCGTCTGGTC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRPKVYV*SQARLV
Trigger: GACCAGACGGGCCTGGCTGCAGACGTACACTTTGGG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACTTGAGAGCAGGGGCTaGGAGGGAGACCCAGCCTCT +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSELESRG*EGDPAS
Trigger: AGAGGCTGGGTCTCCCTCGCAGCCCCTGCTCTCAAG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGAGGGCTGGAGCCAGATaGTGGCTGGTTTGGACAACT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQRAGAR*WLVWTT
Trigger: AGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGAACGCCCAACCGTAACTaGCCTCTTCAGCTGCCAGGG +
Preference number: 4 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRTPNRN*PLQLPG
Trigger: CCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGT...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGAAAGGAACCAAACCATaGCCTCGCACCTGGCCAGCA +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQKGTKP*PRTWPA
Trigger: TGCTGGCCAGGTGCGAGGGCATGGTTTGGTTCCTTT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTAAAGGAACCAAACCATaGCCTCGCACCTGGCCAGCA +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSKGTKP*PRTWPA
Trigger: TGCTGGCCAGGTGCGAGGGCATGGTTTGGTTCCTTT...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCCTGCCACTCCAACCTaGAGCACAGGTTTCTCCTGT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQPATPT*STGFSC
Trigger: ACAGGAGAAACCTGTGCTGCAGGTTGGAGTGGCAGG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCCTCTACCCTGTGGCTaGGACTCCTTCCTCCCTTTA +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSPLPCG*DSFLPL
Trigger: TAAAGGGAGGAAGGAGTCCCAGCCACAGGGTAGAGG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000543233.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCGTAGGTGCCTGGCTTaGAGCCCTCGTCCACGGAGC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGRRCLA*SPRPRS
Trigger: GCTCCGTGGACGAGGGCTCCAAGCCAGGCACCTACG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATCCATCCCGTTGGCCGTaGTGCTGTCGTCAGCATCGT +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDPSRWP*CCRQHR
Trigger: ACGATGCTGACGACAGCACCACGGCCAACGGGATGG...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCTGGGACGGGCTCTGTaGGGTCTGGGTCACGATCCG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGLGRAL*GLGHDP
Trigger: CGGATCGTGACCCAGACCCCACAGAGCCCGTCCCAG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCTGGCCAGGGGCGCCTaGTTGGACACCATCACTGTC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCLARGA*LDTITV
Trigger: GACAGTGATGGTGTCCAACCAGGCGCCCCTGGCCAG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCACATCTGGATTCCGCTaGCCAGGGGCGCCTGGTTGG +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCTSGFR*PGAPGW
Trigger: CCAACCAGGCGCCCCTGGCCAGCGGAATCCAGATGT...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACATCTGGATTCCGCTaGCCAGGGGCGCCTGGTTGG +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGTSGFR*PGAPGW
Trigger: CCAACCAGGCGCCCCTGGCCAGCGGAATCCAGATGT...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGACTGGAAGGACATCTaGATTCCGCTGGCCAGGGGC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARDWKDI*IPLARG
Trigger: GCCCCTGGCCAGCGGAATCCAGATGTCCTTCCAGTC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGCCGCCGTGGTGATCTaGCCGTTGGTGGCATTGATG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARAAVVI*PLVALM
Trigger: CATCAATGCCACCAACGGCCAGATCACCACGGCGGC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAAGATCTGCGCCTCCTTaGGCAGCAGCTCAGGGGCGT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSRSAPP*AAAQGR
Trigger: ACGCCCCTGAGCTGCTGCCCAAGGAGGCGCAGATCT...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTCGTAGGGGCCGATGTTaGGGTCGACGTCAGCGTCGG +
Preference number: 4 (lower is better)
Translates to: QGGSLVPAICTALRMVGARRGRC*GRRQRR
Trigger: CCGACGCTGACGTCGACCCCAACATCGGCCCCTACG...AGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCAGCAGCTGCTTCGTGTaGCGCTCCTTCTCTCGCCGC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCSSCFV*RSFSRR
Trigger: GCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCT...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
64% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAAGCAGCTGCTTCGTGTaGCGCTCCTTCTCTCGCCGC +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGSSCFV*RSFSRR
Trigger: GCGGCGAGAGAAGGAGCGCCACACGAAGCAGCTGCT...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGTCACCGATGTCGCCTaGGTGCGGCACCATGGGCCT +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAVTDVA*VRHHGP
Trigger: AGGCCCATGGTGCCGCACCCAGGCGACATCGGTGAC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCRALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCATCCCTGAGGGAGGCCTaGGTTGACTGGGGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWASLREA*VDWGWS
Trigger: GCTCCACCCCCAGTCAACCCAGGCCTCCCTCAGGGA...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATGCCAGGGAGGGTCCTTaGTTCCTGCCATCTGCACAG +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDAREGP*FLPSAQ
Trigger: CTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGAACCCCGCCCTCCCTaGGCAGCCATGGGAGGGTCA +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWEPRPP*AAMGGS
Trigger: TGACCCTCCCATGGCTGCCCAGGGAGGGCGGGGTTC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGAGAGTTCATGCTGCCCTaGCTCCCGGGCCATAGTCAC +
Preference number: 4 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGREFMLP*LPGHSH
Trigger: GTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTC...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATGAGTTCATGCTGCCCTaGCTCCCGGGCCATAGTCAC +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDEFMLP*LPGHSH
Trigger: GTGACTATGGCCCGGGAGCCAGGGCAGCATGAACTC...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGGGACTGGGGTCTCCTaGTGCTGGGTCCTGGGAACA +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEGTGVS*CWVLGT
Trigger: TGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCCC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCAGTCGCCCAGCCCTCCTaGGTAGCGGCGGCTGCTGGC +
Preference number: 4 (lower is better)
Translates to: KDPDIQREHAVSLAQMCAVAQPS*VAAAAG
Trigger: GCCAGCAGCCGCCGCTACCCAGGAGGGCTGGGCGAC...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGAACATCCCTCCAGCTaGCACTGCAGCTTCCGCCTG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVREHPSS*HCSFRL
Trigger: CAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCCAGCATCGTTGGCCGTaGCGGTCATCACGTAGGTGC +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASQHRWP*RSSRRC
Trigger: GCACCTACGTGATGACCGTCACGGCCAACGATGCTG...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR TCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGCTGTGGCCTGAACGATaGCTGTGTACTGCTGAACTT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTLWPER*LCTAEL
Trigger: AAGTTCAGCAGTACACAGTCATCGTTCAGGCCACAG...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTTTGGAGAGTGGGGCTaGTCTCGGTCCATCACCGTG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARFGEWG*SRSITV
Trigger: CACGGTGATGGACCGAGATCAGCCCCACTCTCCAAA...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACTGCCTTCACCACGGTaGCCATGCCCTCGTTGGTTA +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRLPSPR*PCPRWL
Trigger: TAACCAACGAGGGCATGGTCACCGTGGTGAAGGCAG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCTGCCTTCACCACGGTaGCCATGCCCTCGTTGGTTA +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARLPSPR*PCPRWL
Trigger: TAACCAACGAGGGCATGGTCACCGTGGTGAAGGCAG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGTCAGGGTCCACAGCTaGAAACGTGGTCAGCACGGT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARVRVHS*KRGQHG
Trigger: ACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGAC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGCCGTTGGTGGCATTaGTGTGCAGCCAGCTCGCTG +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAGRWWH*CAASSL
Trigger: CAGCGAGCTGGCTGCACATCAATGCCACCAACGGCC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACGGCCGTTGGTGGCATTaGTGTGCAGCCAGCTCGCTG +
Preference number: 4 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNGRWWH*CAASSL
Trigger: CAGCGAGCTGGCTGCACATCAATGCCACCAACGGCC...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCACCGTTCAGGCGGGTaGTGGTCCAGTTCTTCCGCA +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCHRSGG*WSSSSA
Trigger: TGCGGAAGAACTGGACCATCACCCGCCTGAACGGTG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCTTCCTCGTCATACTTaGGGATGTTGTCGCGGACGT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSLPRHT*GCCRGR
Trigger: ACGTCCGCGACAACATCCTCAAGTATGACGAGGAAG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCTTCCTCGTCATACTTaGGGATGTTGTCGCGGACGT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQLPRHT*GCCRGR
Trigger: ACGTCCGCGACAACATCCTCAAGTATGACGAGGAAG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGATGAGTTCAGGGAGCTaGCGGAGCCTGCGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGMSSGS*RSLRWS
Trigger: GCTCCACCGCAGGCTCCGTCAGCTCCCTGAACTCAT...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGATGAGTTCAGGGAGCTaGCGGAGCCTGCGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQMSSGS*RSLRWS
Trigger: GCTCCACCGCAGGCTCCGTCAGCTCCCTGAACTCAT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGTGTCCGCCAGCTTCTTaGATCTGGGCCCCCAGTCGT +
Preference number: 4 (lower is better)
Translates to: CLHSTAQNSGTPVRPGQLCPPAS*IWAPSR
Trigger: ACGACTGGGGGCCCAGATTCAAGAAGCTGGCGGACA...CAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCTGTCCGCCAGCTTCTTaGATCTGGGCCCCCAGTCGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCCPPAS*IWAPSR
Trigger: ACGACTGGGGGCCCAGATTCAAGAAGCTGGCGGACA...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCTTTCCTCTGGAACTTaGGTTCTGGATCCACAGCCC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQLSSGT*VLDPQP
Trigger: GGGCTGTGGATCCAGAACTCAAGTTCCAGAGGAAAG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR TCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGCTCCAGGCCCCTGCCTaGGCTCCTCACAGCATCCGG +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKLQAPA*APHSIR
Trigger: CCGGATGCTGTGAGGAGCTCAGGCAGGGGCCTGGAG...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGTTTTCTCATGCAGTaGGCACAGGCAGCCGAGCGC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRSFLMQ*AQAAER
Trigger: GCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACT...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACACCCCAGCTCAACTCTaGAGGCTGCACAGGGGCAGC +
Preference number: 4 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNTPAQL*RLHRGS
Trigger: GCTGCCCCTGTGCAGCCTTCAGAGTTGAGCTGGGGT...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCCAGCTTCCGCCTGCGTaGTTTGGGCAAAAGGAACGG +
Preference number: 4 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFQLPPA*FGQKER
Trigger: CCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTG...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCTGCTCCTGTGTTGTGTaGGGCGAAGGGAAGCGGGCT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCCSCVV*GEGKRA
Trigger: AGCCCGCTTCCCTTCGCCGCACACAACACAGGAGCA...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000543233.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGCTTGTGTCCAGAGTaGGGGGACGAGGTCTGGGCC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWGLCPE*GDEVWA
Trigger: GGCCCAGACCTCGTCCCCGCACTCTGGACACAAGCC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR GCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGGGCTTGTGTCCAGAGTaGGGGGACGAGGTCTGGGCC +
Preference number: 4 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQGLCPE*GDEVWA
Trigger: GGCCCAGACCTCGTCCCCGCACTCTGGACACAAGCC...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCGGTCATCACGTAGGTaGCTGGCTTGGAGCCCTCGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCRSSRR*LAWSPR
Trigger: ACGAGGGCTCCAAGCCAGGCACCTACGTGATGACCG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCATCACCGTGAGGTTTaGGACCACGGTCTCCACGCG +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCHHREV*DHGLHA
Trigger: CGCGTGGAGACCGTGGTCGCAAACCTCACGGTGATG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGTTCTCACGGTCCAGCACTaGCGCCGTGGTGATCTGGCC +
Preference number: 4 (lower is better)
Translates to: CHLHSPPDGWSCRECPGVLTVQH*RRGDLA
Trigger: GGCCAGATCACCACGGCGGCAGTGCTGGACCGTGAG...AACCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTATCCCATTGTCAGCTaGCAGGAAGGTGGCCTCGTA +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSYPIVS*QEGGLV
Trigger: TACGAGGCCACCTTCCTGGCAGCTGACAATGGGATA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCTATCCCATTGTCAGCTaGCAGGAAGGTGGCCTCGTA +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFYPIVS*QEGGLV
Trigger: TACGAGGCCACCTTCCTGGCAGCTGACAATGGGATA...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCTCTGGAGGGTCCCGGTaGCGCTGGCCGGGGGTATCC +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCSGGSR*RWPGVS
Trigger: GGATACCCCCGGCCAGCGGCACCGGGACCCTCCAGA...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACTGCGCCAATGGTGGTaGAGTCCCCGTTGTCATCAC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRLRQWW*SPRCHH
Trigger: GTGATGACAACGGGGACTGCACCACCATTGGCGCAG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGGGTCAATGAGCAGCTaGTTCGTGTGGCGCTCCTTC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARGSMSS*FVWRSF
Trigger: GAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGGGTCAATGAGCAGCTaGTTCGTGTGGCGCTCCTTC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRGSMSS*FVWRSF
Trigger: GAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCACGCCAGGGGCTTTaGTTGGCACGTGCCCCATGG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWARQGL*LARAPW
Trigger: CCATGGGGCACGTGCCAAGCAAAGCCCCTGGCGTGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCCGATGTCGCCTGGGTaGGGCACCATGGGCCTGATC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWPMSPG*GTMGLI
Trigger: GATCAGGCCCATGGTGCCGCACCCAGGCGACATCGG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGACTTCGGTCCGAAGATaGGAGGTCAGTCAATCCTCT +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTTSVRR*EVSQSS
Trigger: AGAGGATTGACTGACCTCGCATCTTCGGACCGAAGT...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGAAGACCGGCCGCCTCTaGTCAGTCCTGCTCCTCCGG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWKTGRL*SVLLLR
Trigger: CCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTT...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCTGAACTTGACTCCTaGATTTTCCCTGCCTCCGTG +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSAELDS*IFPASV
Trigger: CACGGAGGCAGGGAAAATGCAGGAGTCAAGTTCAGC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR GCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAGTGCTGGCACCGCCCTaGCCGACACCAGGTCCTGCC +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAVLAPP*PTPGPA
Trigger: GGCAGGACCTGGTGTCGGGCAGGGCGGTGCCAGCAC...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCCCCCTGGCACAGATGTGTaGACTCAAGGCCAAAGCTGT +
Preference number: 4 (lower is better)
Translates to: CIAQLRTRGPRCGLASCPPGTDV*TQGQSC
Trigger: ACAGCTTTGGCCTTGAGTGCACACATCTGTGCCAGG...GGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCA
63% GC, longest homopolymer 6 nt, total homopolymer stretches 14 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATACTGGGGTCTCCTGGTaGTGGGTCCTGGGAACATCA +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDTGVSW*WVLGTS
Trigger: TGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACTGGGGTCTCCTGGTaGTGGGTCCTGGGAACATCA +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRTGVSW*WVLGTS
Trigger: TGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCACTGGGTAGCGGCGGCTaGTGGCGGGACTGGGGTCTC +
Preference number: 4 (lower is better)
Translates to: KDPDIQREHAVSLAQMCALGSGG*WRDWGL
Trigger: GAGACCCCAGTCCCGCCAGCAGCCGCCGCTACCCAG...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGACTGCAGCTTCCGCCTaGGTGATTTGGGCAAAAGGA +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQTAASA*VIWAKG
Trigger: TCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCCTGCAGCTCCCGGGTaGCGAAGACTGTCCCATCTG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGPAAPG*RRLSHL
Trigger: CAGATGGGACAGTCTTCGCCACCCGGGAGCTGCAGG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGACCGCACCATCCCGTTaGCCGTGGTGCTGTCGTCAG +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQTAPSR*PWCCRQ
Trigger: CTGACGACAGCACCACGGCCAACGGGATGGTGCGGT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACACCGCACCATCCCGTTaGCCGTGGTGCTGTCGTCAG +
Preference number: 4 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNTAPSR*PWCCRQ
Trigger: CTGACGACAGCACCACGGCCAACGGGATGGTGCGGT...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGGCTCTGTGGGGTCTaGGTCACGATCCGGTACCGC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWGLCGV*VTIRYR
Trigger: GCGGTACCGGATCGTGACCCAGACCCCACAGAGCCC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGAACGGCATTCCAGTTTaGAGAGTGGGGCTGATCTCG +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQNGIPV*RVGLIS
Trigger: CGAGATCAGCCCCACTCTCCAAACTGGAATGCCGTT...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCAACGGCATTCCAGTTTaGAGAGTGGGGCTGATCTCG +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFNGIPV*RVGLIS
Trigger: CGAGATCAGCCCCACTCTCCAAACTGGAATGCCGTT...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTAACGGCATTCCAGTTTaGAGAGTGGGGCTGATCTCG +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSNGIPV*RVGLIS
Trigger: CGAGATCAGCCCCACTCTCCAAACTGGAATGCCGTT...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCTGGCCAGGGGCGCCTaGTTGGACACCATCACTGTC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGLARGA*LDTITV
Trigger: GACAGTGATGGTGTCCAACCAGGCGCCCCTGGCCAG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGACATCTGGATTCCGCTaGCCAGGGGCGCCTGGTTGG +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQTSGFR*PGAPGW
Trigger: CCAACCAGGCGCCCCTGGCCAGCGGAATCCAGATGT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGACTGGAAGGACATCTaGATTCCGCTGGCCAGGGGC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEDWKDI*IPLARG
Trigger: GCCCCTGGCCAGCGGAATCCAGATGTCCTTCCAGTC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGACTGGAAGGACATCTaGATTCCGCTGGCCAGGGGC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSDWKDI*IPLARG
Trigger: GCCCCTGGCCAGCGGAATCCAGATGTCCTTCCAGTC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGACCCCTGCCGTGGACTaGAAGGACATCTGGATTCCG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARTPAVD*KDIWIP
Trigger: CGGAATCCAGATGTCCTTCCAGTCCACGGCAGGGGT...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCCACAGCTGAAAACGTaGTCAGCACGGTGCCGGGGG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGPQLKT*SARCRG
Trigger: CCCCCGGCACCGTGCTGACCACGTTTTCAGCTGTGG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCAGCTGCCAGGAAGGTaGCCTCGTAGACGTTGTTTT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFQLPGR*PRRRCF
Trigger: AAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAAGATCTGCGCCTCCTTaGGCAGCAGCTCAGGGGCGT +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWARSAPP*AAAQGR
Trigger: ACGCCCCTGAGCTGCTGCCCAAGGAGGCGCAGATCT...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGAGATCTGCGCCTCCTTaGGCAGCAGCTCAGGGGCGT +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQRSAPP*AAAQGR
Trigger: ACGCCCCTGAGCTGCTGCCCAAGGAGGCGCAGATCT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCCACTGCGCCAATGGTaGTGCAGTCCCCGTTGTCAT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARPLRQW*CSPRCH
Trigger: ATGACAACGGGGACTGCACCACCATTGGCGCAGTGG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGACCACTGCGCCAATGGTaGTGCAGTCCCCGTTGTCAT +
Preference number: 4 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRPLRQW*CSPRCH
Trigger: ATGACAACGGGGACTGCACCACCATTGGCGCAGTGG...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACTGCCACTGCGCCAATaGTGGTGCAGTCCCCGTTGT +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSELPLRQ*WCSPRC
Trigger: ACAACGGGGACTGCACCACCATTGGCGCAGTGGCAG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCTGCCACTGCGCCAATaGTGGTGCAGTCCCCGTTGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCLPLRQ*WCSPRC
Trigger: ACAACGGGGACTGCACCACCATTGGCGCAGTGGCAG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGCCAGGGGCTTTGCTTaGCACGTGCCCCATGGCTTC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGARGFA*HVPHGF
Trigger: GAAGCCATGGGGCACGTGCCAAGCAAAGCCCCTGGC...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGTAACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACGTCACCGATGTCGCCTaGGTGCGGCACCATGGGCCT +
Preference number: 4 (lower is better)
Translates to: RNCPLQLPGRVLGSCHLHVTDVA*VRHHGP
Trigger: AGGCCCATGGTGCCGCACCCAGGCGACATCGGTGAC...GTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTCACCGATGTCGCCTaGGTGCGGCACCATGGGCCT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWVTDVA*VRHHGP
Trigger: AGGCCCATGGTGCCGCACCCAGGCGACATCGGTGAC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWARALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CTGGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACGGGTGCAGGGCGCTGTaGGGGTGGGTGCTCATGCTA +
Preference number: 4 (lower is better)
Translates to: LVPHLLPREASCHWPGRDGCRAL*GWVLML
Trigger: TAGCATGAGCACCCACCCCCACAGCGCCCTGCACCC...GTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACCAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGGGAGACCCAGCCTCTaGGAAGAAGCAATTCGGGTC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRGRPSL*EEAIRV
Trigger: GACCCGAATTGCTTCTTCCCAGAGGCTGGGTCTCCC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR CCA 90 bp CGTAACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGAGCTGGGACTAGCTaGGGTTGGAGGCCGCTCGGG +
Preference number: 4 (lower is better)
Translates to: RNCPLQLPGRVLGSCHLHRAGTS*GWRPLG
Trigger: CCCGAGCGGCCTCCAACCCCAGCTAGTCCCAGCTCT...GTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGTGGGTTGACTGGGGGTaGAGCCCCTTCAGGATGACC +
Preference number: 4 (lower is better)
Translates to: CLHSTAQNSGTPVRPGQLWVDWG*SPFRMT
Trigger: GGTCATCCTGAAGGGGCTCCACCCCCAGTCAACCCA...CAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGATCAGGAGCACAGGCTaGGGACGGGGAGGCTTCGCA +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQIRSTG*GRGGFA
Trigger: TGCGAAGCCTCCCCGTCCCCAGCCTGTGCTCCTGAT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACCTGGTGCTGGGTCCTaGGAACATCAGCCCGGAGTT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSPGAGS*EHQPGV
Trigger: AACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGACAAAGAGAAACCTGCTaGGCCAGAAATTGGGGCTGC +
Preference number: 4 (lower is better)
Translates to: PASRTAASLDPAAACPRRQRETC*ARNWGC
Trigger: GCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTG...TCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCATCTGCCCCAACTTTaGAGTCCATGCTGTTGGTCT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSHLPQL*SPCCWS
Trigger: AGACCAACAGCATGGACTTCAAAGTTGGGGCAGATG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGTCCATGGGCCTTGTaGCGTACATCCGGCCGGACA +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWGPWAL*RTSGRT
Trigger: TGTCCGGCCGGATGTACGTCACAAGGCCCATGGACC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCATCGTTGGCCGTaGCGGTCATCACGTAGGTGC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGQHRWP*RSSRRC
Trigger: GCACCTACGTGATGACCGTCACGGCCAACGATGCTG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCTGTGGCCTGAACGATaGCTGTGTACTGCTGAACTT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQLWPER*LCTAEL
Trigger: AAGTTCAGCAGTACACAGTCATCGTTCAGGCCACAG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGTCCATATCTGTGGCCTaGACGATGACTGTGTACTGC +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQSISVA*TMTVYC
Trigger: GCAGTACACAGTCATCGTTCAGGCCACAGATATGGA...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGGCTGTGGCTGTGTTTaGGAGGCCATAGTTGAGATT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSGCGCV*EAIVEI
Trigger: AATCTCAACTATGGCCTCTCAAACACAGCCACAGCC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAATTTGGAGAGTGGGGCTaGTCTCGGTCCATCACCGTG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEFGEWG*SRSITV
Trigger: CACGGTGATGGACCGAGATCAGCCCCACTCTCCAAA...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGGTCAGGGTCCACAGCTaGAAACGTGGTCAGCACGGT +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEVRVHS*KRGQHG
Trigger: ACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGAC...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGTCAGGGTCCACAGCTaGAAACGTGGTCAGCACGGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCVRVHS*KRGQHG
Trigger: ACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGAC...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCATCACAGCCTGCTGCATaGACCGGTCAGGGTCCACAG +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWASQPAA*TGQGPQ
Trigger: CTGTGGACCCTGACCGGTTCATGCAGCAGGCTGTGA...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGCCGTTGGTGGCATTaGTGTGCAGCCAGCTCGCTG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWGRWWH*CAASSL
Trigger: CAGCGAGCTGGCTGCACATCAATGCCACCAACGGCC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACAGGATGCGCAAGCTaGGTTGGGCATAGTCACCGT +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRTGCAS*VGHSHR
Trigger: ACGGTGACTATGCCCAACTCAGCTTGCGCATCCTGT...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGCCGCTTCATCCACATaGCAAACAGCAGGACCATGG +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARAASST*QTAGPW
Trigger: CCATGGTCCTGCTGTTTGTCATGTGGATGAAGCGGC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCGTCCTCGGGGTCAATaGGCAGCTGCTTCGTGTGGC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWRPRGQ*AAASCG
Trigger: GCCACACGAAGCAGCTGCTCATTGACCCCGAGGACG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCGTCCCCGGAACTGGATaGGTTCAGGGAGCTGACGGA +
Preference number: 4 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGVPGTG*VQGADG
Trigger: TCCGTCAGCTCCCTGAACTCATCCAGTTCCGGGGAC...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGTCCCCGGAACTGGATaGGTTCAGGGAGCTGACGGA +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAVPGTG*VQGADG
Trigger: TCCGTCAGCTCCCTGAACTCATCCAGTTCCGGGGAC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTGTCCGCCAGCTTCTTaGATCTGGGCCCCCAGTCGT +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGCPPAS*IWAPSR
Trigger: ACGACTGGGGGCCCAGATTCAAGAAGCTGGCGGACA...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTCTCATTCCCATCCTTaGGAGCAGGGGCTGCGAGGG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGSHSHP*EQGLRG
Trigger: CCCTCGCAGCCCCTGCTCTCAAGGATGGGAATGAGA...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR TCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAGAGTGTCCTGGGGTTTaGATTGATGCCTGTCGCGGG +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGECPGV*IDACRG
Trigger: CCCGCGACAGGCATCAATTCAAACCCCAGGACACTC...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATAGCACTGACAGAAATTaGGACTACCCCTCGCCCAGC +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDSTDRN*DYPSPS
Trigger: GCTGGGCGAGGGGTAGTCTCAATTTCTGTCAGTGCT...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCATGTCTGGCTGTCCCATaGAGTCACCGTGAACGCCAC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSCLAVP*SHRERH
Trigger: GTGGCGTTCACGGTGACTGCATGGGACAGCCAGACA...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTGCGGACGCTGAAGTaGCCGGATGGATCCCCACTG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWVRTLK*PDGSPL
Trigger: CAGTGGGGATCCATCCGGGCACTTCAGCGTCCGCAC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGGAGATGGTCACCCCTaGCGTGGACTGGAAGGACAT +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEGDGHP*RGLEGH
Trigger: ATGTCCTTCCAGTCCACGGCAGGGGTGACCATCTCC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGAGTATCTCACAGCCTaGTGCATGAACCGGTCAGGG +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGEYLTA*CMNRSG
Trigger: CCCTGACCGGTTCATGCAGCAGGCTGTGAGATACTC...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTTGGTGGCATTGATGTaGAGCCAGCTCGCTGGGTCT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARLVALM*SQLAGS
Trigger: AGACCCAGCGAGCTGGCTGCACATCAATGCCACCAA...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACTGCGCCAATGGTGGTaGAGTCCCCGTTGTCATCAC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSLRQWW*SPRCHH
Trigger: GTGATGACAACGGGGACTGCACCACCATTGGCGCAG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCTGCGCCAATGGTGGTaGAGTCCCCGTTGTCATCAC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCLRQWW*SPRCHH
Trigger: GTGATGACAACGGGGACTGCACCACCATTGGCGCAG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACTGCGCCAATGGTGGTaGAGTCCCCGTTGTCATCAC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSELRQWW*SPRCHH
Trigger: GTGATGACAACGGGGACTGCACCACCATTGGCGCAG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAGGGTCAATGAGCAGCTaGTTCGTGTGGCGCTCCTTC +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGGSMSS*FVWRSF
Trigger: GAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCC...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGGGTCAATGAGCAGCTaGTTCGTGTGGCGCTCCTTC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCGSMSS*FVWRSF
Trigger: GAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCC...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCTTTGCTTGGCACGTaGCCCATGGCTTCCGGCTGC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWALLGT*PMASGC
Trigger: GCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTACTTCGGTCCGAAGATaGGAGGTCAGTCAATCCTCT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSTSVRR*EVSQSS
Trigger: AGAGGATTGACTGACCTCGCATCTTCGGACCGAAGT...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
62% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCTTGCTGTCCTTCAGTaGCAGCCAGCGCGGTGCTGG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWLAVLQ*QPARCW
Trigger: CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCACTGCCCTCTTCAGCTaGCAGGGAGGGTCCTTGGTT +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASTALFS*QGGSLV
Trigger: AACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGT...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCACCTGTCCTTCCCCAGTaGTGGCACCGCCCTGCCCGA +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAPVLPQ*WHRPAR
Trigger: TCGGGCAGGGCGGTGCCAGCACTGGGGAAGGACAGG...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCCTCAACTCTGAAGGCTaGACAGGGGCAGCTGTGAGT +
Preference number: 4 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFLNSEG*TGAAVS
Trigger: ACTCACAGCTGCCCCTGTGCAGCCTTCAGAGTTGAG...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGACCTGCCACTCCAACCTaGAGCACAGGTTTCTCCTGT +
Preference number: 4 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRPATPT*STGFSC
Trigger: ACAGGAGAAACCTGTGCTGCAGGTTGGAGTGGCAGG...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGATCCCCAAAACAACTGTaGTCATGCAGGCTGCTACAC +
Preference number: 4 (lower is better)
Translates to: PASRTAASLDPAAACPRRSPKQL*SCRLLH
Trigger: GTGTAGCAGCCTGCATGAGCACAGTTGTTTTGGGGA...TCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGAGATGTACAGGTCGATaGGGTTCTCCACCTTGTTGC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSRCTGR*GSPPCC
Trigger: GCAACAAGGTGGAGAACCCCATCGACCTGTACATCT...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCACATCACGTAGGTGCCTaGCTTGGAGCCCTCGTCCAC +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAHHVGA*LGALVH
Trigger: GTGGACGAGGGCTCCAAGCCAGGCACCTACGTGATG...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGCTGGCGGTAAATTCTaGCGGGTTGTCATTCACATC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSAGGKF*RVVIHI
Trigger: GATGTGAATGACAACCCGCCAGAATTTACCGCCAGC...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCGCTGAAGTGCCCGGATaGATCCCCACTGATGATGCG +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASAEVPG*IPTDDA
Trigger: CGCATCATCAGTGGGGATCCATCCGGGCACTTCAGC...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGACATCTGGATTCCGCTaGCCAGGGGCGCCTGGTTGG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWTSGFR*PGAPGW
Trigger: CCAACCAGGCGCCCCTGGCCAGCGGAATCCAGATGT...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGACTGGAAGGACATCTaGATTCCGCTGGCCAGGGGC +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQDWKDI*IPLARG
Trigger: GCCCCTGGCCAGCGGAATCCAGATGTCCTTCCAGTC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAACCCCTGCCGTGGACTaGAAGGACATCTGGATTCCG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSETPAVD*KDIWIP
Trigger: CGGAATCCAGATGTCCTTCCAGTCCACGGCAGGGGT...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAACCCCTGCCGTGGACTaGAAGGACATCTGGATTCCG +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSTPAVD*KDIWIP
Trigger: CGGAATCCAGATGTCCTTCCAGTCCACGGCAGGGGT...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCATGGTCACCCCTGCCGTaGACTGGAAGGACATCTGGA +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSWSPLP*TGRTSG
Trigger: TCCAGATGTCCTTCCAGTCCACGGCAGGGGTGACCA...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCCACTGCGCCAATGGTaGTGCAGTCCCCGTTGTCAT +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEPLRQW*CSPRCH
Trigger: ATGACAACGGGGACTGCACCACCATTGGCGCAGTGG...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCTGCCACTGCGCCAATaGTGGTGCAGTCCCCGTTGT +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGLPLRQ*WCSPRC
Trigger: ACAACGGGGACTGCACCACCATTGGCGCAGTGGCAG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCCAGGGGCTTTGCTTaGCACGTGCCCCATGGCTTC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWARGFA*HVPHGF
Trigger: GAAGCCATGGGGCACGTGCCAAGCAAAGCCCCTGGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGAGGGCGCTGTGGGGGTaGGTGCTCATGCTAGACAGC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWRALWG*VLMLDS
Trigger: GCTGTCTAGCATGAGCACCCACCCCCACAGCGCCCT...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGTAAGATCCTCATTATaGGCCCGGAGCGCGCCGGAG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGVRSSL*ARSAPE
Trigger: CTCCGGCGCGCTCCGGGCCCATAATGAGGATCTTAC...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGGGACAGCAGCAAGTTTaGACCCGGCCGCTGCCTGCC +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKGQQQV*TRPLPA
Trigger: GGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCC...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGTTCCTTCCCCCTGTCTaGCTTGAGTCAACCCAGCCC +
Preference number: 4 (lower is better)
Translates to: CLHSTAQNSGTPVRPGQLFLPPV*LESTQP
Trigger: GGGCTGGGTTGACTCAAGCCAGACAGGGGGAAGGAA...CAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCCCCTTGACCTCTGTTaGTCCATCTCCTGGACTGGC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCPLDLC*SISWTG
Trigger: GCCAGTCCAGGAGATGGACCAACAGAGGTCAAGGGG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGGCACCTGGCCAGCATTaGCCTCCCGGCCTCCAGTGG +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALAPGQH*PPGLQW
Trigger: CCACTGGAGGCCGGGAGGCCAATGCTGGCCAGGTGC...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAAATTGTACAGAGAGGTaGTCCCCCGCTGGGCCTGTT +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGNCTER*SPAGPV
Trigger: AACAGGCCCAGCGGGGGACCACCTCTCTGTACAATT...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCACTGCCTTCACCACGGTaGCCATGCCCTCGTTGGTTA +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWALPSPR*PCPRWL
Trigger: TAACCAACGAGGGCATGGTCACCGTGGTGAAGGCAG...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCTGCCTTCACCACGGTaGCCATGCCCTCGTTGGTTA +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQLPSPR*PCPRWL
Trigger: TAACCAACGAGGGCATGGTCACCGTGGTGAAGGCAG...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATCAGCTTGTGGTTTaGGGGGAAGTAGGGAGCCTC +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEDQLVV*GEVGSL
Trigger: GAGGCTCCCTACTTCCCCTCAAACCACAAGCTGATC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGATCAGCTTGTGGTTTaGGGGGAAGTAGGGAGCCTC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSDQLVV*GEVGSL
Trigger: GAGGCTCCCTACTTCCCCTCAAACCACAAGCTGATC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGTCAGGGTCCACAGCTaGAAACGTGGTCAGCACGGT +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAVRVHS*KRGQHG
Trigger: ACCGTGCTGACCACGTTTTCAGCTGTGGACCCTGAC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGTCACAGCCTGCTGCATaGACCGGTCAGGGTCCACAG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWSQPAA*TGQGPQ
Trigger: CTGTGGACCCTGACCGGTTCATGCAGCAGGCTGTGA...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAGCACTGCCGCCGTGGTaGTCTGGCCGTTGGTGGCAT +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAALPPW*SGRWWH
Trigger: ATGCCACCAACGGCCAGATCACCACGGCGGCAGTGC...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCACCGTTCAGGCGGGTaGTGGTCCAGTTCTTCCGCA +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWHRSGG*WSSSSA
Trigger: TGCGGAAGAACTGGACCATCACCCGCCTGAACGGTG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCACAGGATGCGCAAGCTaGGTTGGGCATAGTCACCGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCTGCAS*VGHSHR
Trigger: ACGGTGACTATGCCCAACTCAGCTTGCGCATCCTGT...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGCCGCTTCATCCACATaGCAAACAGCAGGACCATGG +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSAASST*QTAGPW
Trigger: CCATGGTCCTGCTGTTTGTCATGTGGATGAAGCGGC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCCTTCCTCGTCATACTTaGGGATGTTGTCGCGGACGT +
Preference number: 4 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFLPRHT*GCCRGR
Trigger: ACGTCCGCGACAACATCCTCAAGTATGACGAGGAAG...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGCTTCCTCGTCATACTTaGGGATGTTGTCGCGGACGT +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARLPRHT*GCCRGR
Trigger: ACGTCCGCGACAACATCCTCAAGTATGACGAGGAAG...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGTGTCCGCCAGCTTCTTaGATCTGGGCCCCCAGTCGT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWCPPAS*IWAPSR
Trigger: ACGACTGGGGGCCCAGATTCAAGAAGCTGGCGGACA...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTCGGGAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGTCTAGGAAATTCAAGTaGAGACAGAGTGCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: VGKTGRLCSVLLLRRPSTSRKFK*RQSASC
Trigger: GCAAGAGGCACTCTGTCTTCACTTGAATTTCCTAGA...CGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTCCCGAC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGTTCCTTTCTGCGGTTTaGAGTCCATGCTGTTGGTCT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQFLSAV*SPCCWS
Trigger: AGACCAACAGCATGGACTTCAAACCGCAGAAAGGAA...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR TCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGTGGTGGCACTCAGGGTaGCAGGTGTCCCTGAGGGAG +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKWWHSG*QVSLRE
Trigger: CTCCCTCAGGGACACCTGTCACCCTGAGTGCCACCA...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGTTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGGGAGAATGCACCCTCTaGGTTTTCTCATGCAGTGAG +
Preference number: 4 (lower is better)
Translates to: SLDPAAACPRRGSIGEERGECTL*VFSCSE
Trigger: CTCACTGCATGAGAAAACTCAGAGGGTGCATTCTCC...CCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGAACGGGAACATGCCGTaGGCCTGGCACAGATGTGTG +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQNGNMP*AWHRCV
Trigger: CACACATCTGTGCCAGGCTCACGGCATGTTCCCGTT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGATTTGGACAAGGACCCTaGCATCCAACGGGAACATGC +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGFGQGP*HPTGTC
Trigger: GCATGTTCCCGTTGGATGTCAGGGTCCTTGTCCAAA...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGGCACAGGGGCAGCTGTaGGTTTGGTTTGGACAAGGA +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEAQGQL*VWFGQG
Trigger: TCCTTGTCCAAACCAAACTCACAGCTGCCCCTGTGC...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGCTGGGGGCTGCCTGCTaGCCAAGGCCAGTCGTTCCT +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALLGAAC*PRPVVP
Trigger: AGGAACGACTGGCCTTGGTCAGCAGGCAGCCCCCAG...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGTTTCCAAGCTGTGAGTaGACGGCTGAGAAGATTGCT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQFPSCE*TAEKIA
Trigger: AGCAATCTTCTCAGCCGTGCACTCACAGCTTGGAAA...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000543233.2
CDS-3UTR GCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGATCCTCACGAGCTaGTGCGGGAAGGGCCCGCGC +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPARILTS*CGKGPR
Trigger: GCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGATCCG...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR GCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACAGTGCGGACGCTGAAGTaGCCGGATGGATCCCCACTG +
Preference number: 4 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTVRTLK*PDGSPL
Trigger: CAGTGGGGATCCATCCGGGCACTTCAGCGTCCGCAC...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCTATCTCACAGCCTGCTaGATGAACCGGTCAGGGTCC +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCYLTAC*MNRSGS
Trigger: GGACCCTGACCGGTTCATGCAGCAGGCTGTGAGATA...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTATCCCATTGTCAGCTaGCAGGAAGGTGGCCTCGTA +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARYPIVS*QEGGLV
Trigger: TACGAGGCCACCTTCCTGGCAGCTGACAATGGGATA...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCAAGTGAAGACAGAGTaGCTCTTGCTGTCCTTCAGT +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQQVKTE*LLLSFS
Trigger: ACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGAGGGCTGGAGCCAGATaGTGGCTGGTTTGGACAACT +
Preference number: 4 (lower is better)
Translates to: PAICTALRMVGAVESVLGRAGAR*WLVWTT
Trigger: AGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCT...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGTTACGCCCAACCGTAACTaGCCTCTTCAGCTGCCAGGG +
Preference number: 4 (lower is better)
Translates to: CHLHSPPDGWSCRECPGVTPNRN*PLQLPG
Trigger: CCCTGGCAGCTGAAGAGGGCAGTTACGGTTGGGCGT...AACCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGTTTGGACCCGGCCGCTaGCTGCCCCCGACGAGGGTC +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWFGPGR*LPPTRV
Trigger: GACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGACTTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTGTGCTGGCACCGCCCTaGCCGACACCAGGTCCTGCC +
Preference number: 4 (lower is better)
Translates to: GLPQTTTEISSPSTTRPAVLAPP*PTPGPA
Trigger: GGCAGGACCTGGTGTCGGGCAGGGCGGTGCCAGCAC...AGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAAGTCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACATCCAACGGGAACATaGCGTGAGCCTGGCACAGAT +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEHPTGT*REPGTD
Trigger: ATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GCTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGTGCGGCCTGGCCAGCTaGCCCTTGACCTCTGTTGGT +
Preference number: 4 (lower is better)
Translates to: AGLDSQEAQETPSCVQQRCGLAS*PLTSVG
Trigger: ACCAACAGAGGTCAAGGGGCAGCTGGCCAGGCCGCA...CCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAGC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATACTGCAGCTTCCGCCTaGGTGATTTGGGCAAAAGGA +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDTAASA*VIWAKG
Trigger: TCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCAGT...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACATTTCTCTGCTGTCTaGCTGTCCCATGCAGTCACC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRHFSAV*LSHAVT
Trigger: GGTGACTGCATGGGACAGCCAGACAGCAGAGAAATG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCCATCCCGTTGGCCGTaGTGCTGTCGTCAGCATCGT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWPSRWP*CCRQHR
Trigger: ACGATGCTGACGACAGCACCACGGCCAACGGGATGG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGATGGTGAACATATTCTaGGACGGGCTCTGTGGGGTC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARMVNIF*DGLCGV
Trigger: GACCCCACAGAGCCCGTCCCAGAATATGTTCACCAT...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAACGGCATTCCAGTTTaGAGAGTGGGGCTGATCTCG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRNGIPV*RVGLIS
Trigger: CGAGATCAGCCCCACTCTCCAAACTGGAATGCCGTT...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAAACGGCATTCCAGTTTaGAGAGTGGGGCTGATCTCG +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGNGIPV*RVGLIS
Trigger: CGAGATCAGCCCCACTCTCCAAACTGGAATGCCGTT...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCTGAAGTGCCCGGATaGATCCCCACTGATGATGCG +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAAEVPG*IPTDDA
Trigger: CGCATCATCAGTGGGGATCCATCCGGGCACTTCAGC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGCTGGCCAGGGGCGCCTaGTTGGACACCATCACTGTC +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKLARGA*LDTITV
Trigger: GACAGTGATGGTGTCCAACCAGGCGCCCCTGGCCAG...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACACCCCTGCCGTGGACTaGAAGGACATCTGGATTCCG +
Preference number: 4 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNTPAVD*KDIWIP
Trigger: CGGAATCCAGATGTCCTTCCAGTCCACGGCAGGGGT...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCATGGTCACCCCTGCCGTaGACTGGAAGGACATCTGGA +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAWSPLP*TGRTSG
Trigger: TCCAGATGTCCTTCCAGTCCACGGCAGGGGTGACCA...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCCGCCGTGGTGATCTaGCCGTTGGTGGCATTGATG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWAAVVI*PLVALM
Trigger: CATCAATGCCACCAACGGCCAGATCACCACGGCGGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCCGTAGACGTTGTTTTTaGTGTAGAGGGACTCACGGT +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFRRRCF*CRGTHG
Trigger: ACCGTGAGTCCCTCTACACCAAAAACAACGTCTACG...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACCGTAGACGTTGTTTTTaGTGTAGAGGGACTCACGGT +
Preference number: 4 (lower is better)
Translates to: CQPRGQQQVWTRPLPAPDRRRCF*CRGTHG
Trigger: ACCGTGAGTCCCTCTACACCAAAAACAACGTCTACG...GTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGCGTAGACGTTGTTTTTaGTGTAGAGGGACTCACGGT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSRRRCF*CRGTHG
Trigger: ACCGTGAGTCCCTCTACACCAAAAACAACGTCTACG...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGACAGCTGCCAGGAAGGTaGCCTCGTAGACGTTGTTTT +
Preference number: 4 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRQLPGR*PRRRCF
Trigger: AAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTG...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACAGCTGCCAGGAAGGTaGCCTCGTAGACGTTGTTTT +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRQLPGR*PRRRCF
Trigger: AAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCCCGTTGTCATCACATaGGCACACCTTGACTTTGAT +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSPVVIT*AHLDFD
Trigger: ATCAAAGTCAAGGTGTGCCCATGTGATGACAACGGG...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCCACTGCGCCAATGGTaGTGCAGTCCCCGTTGTCAT +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGPLRQW*CSPRCH
Trigger: ATGACAACGGGGACTGCACCACCATTGGCGCAGTGG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCGGCCGGGTGCAGCTGGAACTTGAGTTCTaGATCCACAGCCCAATACCA +
Preference number: 4 (lower is better)
Translates to: SCCPSVPASAVLGSGRVQLELEF*IHSPIP
Trigger: TGGTATTGGGCTGTGGATCCAGAACTCAAGTTCCAG...CTGCACCCGGCCGCTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGA
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR CCA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGGGACTAGCTGGGGTTaGAGGCCGCTCGGGATGGGA +
Preference number: 4 (lower is better)
Translates to: LQRETCWARNWGCPGPEEGTSWG*RPLGMG
Trigger: TCCCATCCCGAGCGGCCTCCAACCCCAGCTAGTCCC...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATCCCTGAGGGAGGCCTaGGTTGACTGGGGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHASLREA*VDWGWS
Trigger: GCTCCACCCCCAGTCAACCCAGGCCTCCCTCAGGGA...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGCCCCAGATGCTGGCTGGTTTaGACAACTCACTCTTCTGGA +
Preference number: 4 (lower is better)
Translates to: CIAQLRTRGPRCGLASCPRCWLV*TTHSSG
Trigger: TCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCT...GGGGCAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCAGCCCTCCGGATGGTTaGAGCTGTCGAGAGTGTCCT +
Preference number: 4 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGSPPDG*SCRECP
Trigger: AGGACACTCTCGACAGCTCCAACCATCCGGAGGGCT...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGGGCTTCGCAGGCTGCTaGGTGTGTTCTGGTCACCAC +
Preference number: 4 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQGFAGC*VCSGHH
Trigger: GTGGTGACCAGAACACACCCAGCAGCCTGCGAAGCC...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAAGGCTCACAAGCGTCTaGCGGGAATCAGGAGCACAG +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWARLTSV*RESGAQ
Trigger: CTGTGCTCCTGATTCCCGCCAGACGCTTGTGAGCCT...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGTTGAACATCCCTCCAGCTaGCACTGCAGCTTCCGCCTG +
Preference number: 4 (lower is better)
Translates to: CHLHSPPDGWSCRECPGVEHPSS*HCSFRL
Trigger: CAGGCGGAAGCTGCAGTGCCAGCTGGAGGGATGTTC...AACCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGACTTTATTCATTCTCTaGAGCAGCGCGCCCCGCCTG +
Preference number: 4 (lower is better)
Translates to: PAICTALRMVGAVESVLGTLFIL*SSAPRL
Trigger: CAGGCGGGGCGCGCTGCTCCAGAGAATGAATAAAGT...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp ACTGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGACATCTGCCCCAACTTTaGAGTCCATGCTGTTGGTCT +
Preference number: 4 (lower is better)
Translates to: TVPPTDPRRHELGHVCLGHLPQL*SPCCWS
Trigger: AGACCAACAGCATGGACTTCAAAGTTGGGGCAGATG...TCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACAGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCTGTCATTCATGTCGATaGCGTAGATGTACAGGTCGA +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFCHSCR*RRCTGR
Trigger: TCGACCTGTACATCTACGTCATCGACATGAATGACA...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
60% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp CCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACGATGTCATTCATGTCGATaGCGTAGATGTACAGGTCGA +
Preference number: 4 (lower is better)
Translates to: PASRTAASLDPAAACPRRCHSCR*RRCTGR
Trigger: TCGACCTGTACATCTACGTCATCGACATGAATGACA...TCGTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR TCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCCATATCTGTGGCCTaGACGATGACTGTGTACTGC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARSISVA*TMTVYC
Trigger: GCAGTACACAGTCATCGTTCAGGCCACAGATATGGA...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
60% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGATCAGCTTGTGGTTTaGGGGGAAGTAGGGAGCCTC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGDQLVV*GEVGSL
Trigger: GAGGCTCCCTACTTCCCCTCAAACCACAAGCTGATC...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCCGCTTCATCCACATaGCAAACAGCAGGACCATGG +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAAASST*QTAGPW
Trigger: CCATGGTCCTGCTGTTTGTCATGTGGATGAAGCGGC...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCTTCCTCGTCATACTTaGGGATGTTGTCGCGGACGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCLPRHT*GCCRGR
Trigger: ACGTCCGCGACAACATCCTCAAGTATGACGAGGAAG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGGCGGCACCATGGGCCTaGTCGGGTACTGGGGCTCAG +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPAAAPWA*SGTGAQ
Trigger: CTGAGCCCCAGTACCCGATCAGGCCCATGGTGCCGC...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGATGAGTTCAGGGAGCTaGCGGAGCCTGCGGTGGAGC +
Preference number: 4 (lower is better)
Translates to: LQRETCWARNWGCPGPEEMSSGS*RSLRWS
Trigger: GCTCCACCGCAGGCTCCGTCAGCTCCCTGAACTCAT...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAAGACCGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTTCTAGGAAATTCAAGTaGAGACAGAGTGCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: EDRPPLLSPAPPASEHGSSRKFK*RQSASC
Trigger: GCAAGAGGCACTCTGTCTTCACTTGAATTTCCTAGA...AGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCGGTCTTC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGTCTAGGAAATTCAAGTaGAGACAGAGTGCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSSRKFK*RQSASC
Trigger: GCAAGAGGCACTCTGTCTTCACTTGAATTTCCTAGA...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCAGCACCAGGGCTGCTaGAGCCCAAAGTGTACGTCT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWQHQGC*SPKCTS
Trigger: AGACGTACACTTTGGGCTTCAGCAGCCCTGGTGCTG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR TCA 90 bp TGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCTGTCCCCCATTTCTGAATaGTGCCTTCAGAGCTGGGAC +
Preference number: 4 (lower is better)
Translates to: CLHSTAQNSGTPVRPGQLSPISE*CLQSWD
Trigger: GTCCCAGCTCTGAAGGCATCATTCAGAAATGGGGGA...CAGCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACA
60% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGCATCTCTGAGAGCCTaGCAGTTGGACATTGCTCTG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEASLRA*QLDIAL
Trigger: CAGAGCAATGTCCAACTGTCAGGCTCTCAGAGATGC...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
60% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGACCTTCTTTCCTTTCTaGGGCTTGTGTCCAGAGTGC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARTFFPF*GLCPEC
Trigger: GCACTCTGGACACAAGCCGCAGAAAGGAAAGAAGGT...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR GCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTCGGATCCTCACGAGCTaGTGCGGGAAGGGCCCGCGC +
Preference number: 4 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPRILTS*CGKGPR
Trigger: GCGCGGGCCCTTCCCGCAGCAGCTCGTGAGGATCCG...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTATCTCACAGCCTGCTaGATGAACCGGTCAGGGTCC +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGYLTAC*MNRSGS
Trigger: GGACCCTGACCGGTTCATGCAGCAGGCTGTGAGATA...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGAGTATCTCACAGCCTaGTGCATGAACCGGTCAGGG +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGEYLTA*CMNRSG
Trigger: CCCTGACCGGTTCATGCAGCAGGCTGTGAGATACTC...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCTTGGTGGCATTGATGTaGAGCCAGCTCGCTGGGTCT +
Preference number: 4 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGLVALM*SQLAGS
Trigger: AGACCCAGCGAGCTGGCTGCACATCAATGCCACCAA...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCCACGATGGCACCGGTaGCCAGACCAGCCGCTGCCA +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPAPRWHR*PDQPLP
Trigger: TGGCAGCGGCTGGTCTGGGCACCGGTGCCATCGTGG...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACCACGATGGCACCGGTaGCCAGACCAGCCGCTGCCA +
Preference number: 4 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTPRWHR*PDQPLP
Trigger: TGGCAGCGGCTGGTCTGGGCACCGGTGCCATCGTGG...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGCAGCTTCCGCCTGCGTGATTTGGGCAAAAGGAACGGGGGCTTGGCAGTGACAGGAGGCTTCGCAGGCTaGTGGGTGTGTTCTGGTCAC +
Preference number: 4 (lower is better)
Translates to: CSFRLRDLGKRNGGLAVTGGFAG*WVCSGH
Trigger: GTGACCAGAACACACCCAGCAGCCTGCGAAGCCTCC...TGTCACTGCCAAGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTGCA
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGACCCGGCCGCTGCCTaGCCCCGACGAGGGTCCATA +
Preference number: 4 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPDPAAA*PRRGSI
Trigger: TATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTC...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCACCCTCCAGCTGGCACTaGAGCTTCCGCCTGCGTGAT +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAPSSWH*SFRLRD
Trigger: ATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGG...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGCCCTCCAGCTGGCACTaGAGCTTCCGCCTGCGTGAT +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALPSSWH*SFRLRD
Trigger: ATCACGCAGGCGGAAGCTGCAGTGCCAGCTGGAGGG...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TGTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATCCCCAAAACAACTGTaGTCATGCAGGCTGCTACAC +
Preference number: 4 (lower is better)
Translates to: CPSYGPTAPRAGSRVSGRSPKQL*SCRLLH
Trigger: GTGTAGCAGCCTGCATGAGCACAGTTGTTTTGGGGA...TCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGACA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCACCTGCAGCTCCCGGGTaGCGAAGACTGTCCCATCTG +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAPAAPG*RRLSHL
Trigger: CAGATGGGACAGTCTTCGCCACCCGGGAGCTGCAGG...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp TCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGGCTGGCGGTAAATTCTaGCGGGTTGTCATTCACATC +
Preference number: 4 (lower is better)
Translates to: SCSSGVRARLSLRSEDARAGGKF*RVVIHI
Trigger: GATGTGAATGACAACCCGCCAGAATTTACCGCCAGC...CCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGCTGGCGGTAAATTCTaGCGGGTTGTCATTCACATC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRAGGKF*RVVIHI
Trigger: GATGTGAATGACAACCCGCCAGAATTTACCGCCAGC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCTGAAGTGCCCGGATaGATCCCCACTGATGATGCG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWAEVPG*IPTDDA
Trigger: CGCATCATCAGTGGGGATCCATCCGGGCACTTCAGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCACTGGCCAGGGGCGCCTaGTTGGACACCATCACTGTC +
Preference number: 4 (lower is better)
Translates to: KDPDIQREHAVSLAQMCALARGA*LDTITV
Trigger: GACAGTGATGGTGTCCAACCAGGCGCCCCTGGCCAG...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGCCACAGCTGAAAACGTaGTCAGCACGGTGCCGGGGG +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALPQLKT*SARCRG
Trigger: CCCCCGGCACCGTGCTGACCACGTTTTCAGCTGTGG...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACAGCTGCCAGGAAGGTaGCCTCGTAGACGTTGTTTT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSQLPGR*PRRRCF
Trigger: AAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGGGGTCCCGGTGCCGCTaGCCGGGGGTATCCCATTGT +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWGSRCR*PGVSHC
Trigger: ACAATGGGATACCCCCGGCCAGCGGCACCGGGACCC...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCAGATCTGCGCCTCCTTaGGCAGCAGCTCAGGGGCGT +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCRSAPP*AAAQGR
Trigger: ACGCCCCTGAGCTGCTGCCCAAGGAGGCGCAGATCT...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAGGCATCGCTTTCCTCTaGAACTTGAGTTCTGGATCC +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRGIAFL*NLSSGS
Trigger: GGATCCAGAACTCAAGTTCCAGAGGAAAGCGATGCC...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR CCA 90 bp CCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCGAGCCAGATGCTGGCTaGTTTGGACAACTCACTCTT +
Preference number: 4 (lower is better)
Translates to: PSYGPTAPRAGSRVSGRFEPDAG*FGQLTL
Trigger: AAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTC...GAATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGGCACCCCATGGGGTCTaGTCGCCAGGGTTGGAGGGC +
Preference number: 4 (lower is better)
Translates to: RHELGHVCLGDSVLILLVAPHGV*SPGLEG
Trigger: GCCCTCCAACCCTGGCGACCAGACCCCATGGGGTGC...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGTTCTGCTGGGTGTGTTCTaGTCACCACGCCCAACCGTA +
Preference number: 4 (lower is better)
Translates to: CHLHSPPDGWSCRECPGVLLGVF*SPRPTV
Trigger: TACGGTTGGGCGTGGTGACCAGAACACACCCAGCAG...AACCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATGCTGTGAGTTTGGTTTaGACAAGGACCCTGACATCC +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDAVSLV*TRTLTS
Trigger: GGATGTCAGGGTCCTTGTCCAAACCAAACTCACAGC...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGGACTGTGGCTGTTGGTCCATCTCCTaGACTGGCTGTCTGCAGAGG +
Preference number: 4 (lower is better)
Translates to: ETCWARNWGCPGPEEDCGCWSIS*TGCLQR
Trigger: CCTCTGCAGACAGCCAGTCCAGGAGATGGACCAACA...GCCACAGTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGCCCCTTGACCTCTGTTaGTCCATCTCCTGGACTGGC +
Preference number: 4 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQPLDLC*SISWTG
Trigger: GCCAGTCCAGGAGATGGACCAACAGAGGTCAAGGGG...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGACTGTGGCCCTAGGCTaGGGGCTGCCTGCTGACCAA +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALTVALG*GLPADQ
Trigger: TTGGTCAGCAGGCAGCCCCCAGCCTAGGGCCACAGT...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
3UTR CAA 72 bp CCAGGGTTGGAGGGCTGGAGCCAGATGCTGGCTGGTTaGGACAACTCACTCTTCTGGACCAAAGGCAGAGGG +
Preference number: 4 (lower is better)
Translates to: PGLEGWSQMLAG*DNSLFWTKGRG
Trigger: CCCTCTGCCTTTGGTCCAGAAGAGTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGCCCTCCAACCCTGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAATGACTGTGTACTGCTaGACTTTCTCTCGGTCCAGG +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSMTVYC*TFSRSR
Trigger: CCTGGACCGAGAGAAAGTTCAGCAGTACACAGTCAT...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAATGACTGTGTACTGCTaGACTTTCTCTCGGTCCAGG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEMTVYC*TFSRSR
Trigger: CCTGGACCGAGAGAAAGTTCAGCAGTACACAGTCAT...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACTGTGGCCTGAACGATaGCTGTGTACTGCTGAACTT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSLWPER*LCTAEL
Trigger: AAGTTCAGCAGTACACAGTCATCGTTCAGGCCACAG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
59% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGGGCTGTGGCTGTGTTTaGGAGGCCATAGTTGAGATT +
Preference number: 4 (lower is better)
Translates to: PAICTALRMVGAVESVLGGCGCV*EAIVEI
Trigger: AATCTCAACTATGGCCTCTCAAACACAGCCACAGCC...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
59% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGGCTGTGGCTGTGTTTaGGAGGCCATAGTTGAGATT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSGCGCV*EAIVEI
Trigger: AATCTCAACTATGGCCTCTCAAACACAGCCACAGCC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCTCACAGCCTGCTGCATaGACCGGTCAGGGTCCACAG +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCSQPAA*TGQGPQ
Trigger: CTGTGGACCCTGACCGGTTCATGCAGCAGGCTGTGA...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCAGGCCCTGAAGAGTCACAGCCTGCTGCATaGACCGGTCAGGGTCCACAG +
Preference number: 4 (lower is better)
Translates to: LQRETCWARNWGCPGPEESQPAA*TGQGPQ
Trigger: CTGTGGACCCTGACCGGTTCATGCAGCAGGCTGTGA...CTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGACAGGATGCGCAAGCTaGGTTGGGCATAGTCACCGT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWTGCAS*VGHSHR
Trigger: ACGGTGACTATGCCCAACTCAGCTTGCGCATCCTGT...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCTGTCCGCCAGCTTCTTaGATCTGGGCCCCCAGTCGT +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCCPPAS*IWAPSR
Trigger: ACGACTGGGGGCCCAGATTCAAGAAGCTGGCGGACA...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCAGTGAAGCATCCCTGTTaGCTTTGGCATCGCTTTCCT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSVKHPC*LWHRFP
Trigger: AGGAAAGCGATGCCAAAGTCAACAGGGATGCTTCAC...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR TCA 90 bp CCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCTGAGGGAGGCCTGGGTTaGCTGGGGGTGGAGCCCCTT +
Preference number: 4 (lower is better)
Translates to: PQTTTEISSPSTTRPAIPEGGLG*LGVEPL
Trigger: AAGGGGCTCCACCCCCAGTCAACCCAGGCCTCCCTC...AGGTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCGGCCTGGCCAGCGGAGAATGCACCCTCTaGGTTTTCTCATGCAGTGAG +
Preference number: 4 (lower is better)
Translates to: LVCIAQLRTRGPRCGLASGECTL*VFSCSE
Trigger: CTCACTGCATGAGAAAACTCAGAGGGTGCATTCTCC...GCTGGCCAGGCCGCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGGGAGAGACAGAAAGCTaGCCAAGCACGAGGCTTCCC +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKGETES*PSTRLP
Trigger: GGGAAGCCTCGTGCTTGGTCAGCTTTCTGTCTCTCC...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGTGGCCAGCTGCCCCTTaGCCTCTGTTGGTCCATCTC +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALWPAAP*PLLVHL
Trigger: GAGATGGACCAACAGAGGTCAAGGGGCAGCTGGCCA...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGACATACTCCGAAGGACTaGAGCATGGACTTCCCCAAA +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGHTPKD*SMDFPK
Trigger: TTTGGGGAAGTCCATGCTTCAGTCCTTCGGAGTATG...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGCCAGCTTCCGCCTGCGTaGTTTGGGCAAAAGGAACGG +
Preference number: 4 (lower is better)
Translates to: LALTPKRLKRPPAVYSKGQLPPA*FGQKER
Trigger: CCGTTCCTTTTGCCCAAATCACGCAGGCGGAAGCTG...GCCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTCTGGGGGCTGCCTGCTaGCCAAGGCCAGTCGTTCCT +
Preference number: 4 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTLGAAC*PRPVVP
Trigger: AGGAACGACTGGCCTTGGTCAGCAGGCAGCCCCCAG...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CGGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCTCAGATTTGCAGGTGTaGGTACATCATACTCCAGTA +
Preference number: 4 (lower is better)
Translates to: RPPLLSPAPPASEHGSHFSDLQV*VHHTPV
Trigger: TACTGGAGTATGATGTACTCACACCTGCAAATCTGA...GAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCCG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGAGTATCTCACAGCCTaGTGCATGAACCGGTCAGGG +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWEYLTA*CMNRSG
Trigger: CCCTGACCGGTTCATGCAGCAGGCTGTGAGATACTC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGTTGGTGGCATTGATGTaGAGCCAGCTCGCTGGGTCT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWLVALM*SQLAGS
Trigger: AGACCCAGCGAGCTGGCTGCACATCAATGCCACCAA...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTCTCACGGTCCAGCACTaGCGCCGTGGTGATCTGGCC +
Preference number: 4 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTLTVQH*RRGDLA
Trigger: GGCCAGATCACCACGGCGGCAGTGCTGGACCGTGAG...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTTATCCCATTGTCAGCTaGCAGGAAGGTGGCCTCGTA +
Preference number: 4 (lower is better)
Translates to: QGGSLVPAICTALRMVGAYPIVS*QEGGLV
Trigger: TACGAGGCCACCTTCCTGGCAGCTGACAATGGGATA...AGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCATATCCCATTGTCAGCTaGCAGGAAGGTGGCCTCGTA +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWAYPIVS*QEGGLV
Trigger: TACGAGGCCACCTTCCTGGCAGCTGACAATGGGATA...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGACTTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTGCCCAGACCAGCCGCTaGCACTGCGCCAATGGTGGT +
Preference number: 4 (lower is better)
Translates to: GLPQTTTEISSPSTTRPAAQTSR*HCANGG
Trigger: ACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGC...AGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAAGTCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAGTGTACAGCAAAGGCTaGTGGGATTTGAACCCCACT +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGVYSKG*WDLNPT
Trigger: AGTGGGGTTCAAATCCCAGCAGCCTTTGCTGTACAC...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp ACTTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATGACCCGGCCGCTGCCTaGCCCCGACGAGGGTCCATA +
Preference number: 4 (lower is better)
Translates to: TSPNNNRDFQSFHYPPSYDPAAA*PRRGSI
Trigger: TATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTC...ATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAAGT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGCCCGACACCAGGTCCTaGCCAGGGTCCCTGGTACCT +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWPDTRS*PGSLVP
Trigger: AGGTACCAGGGACCCTGGGCAGGACCTGGTGTCGGG...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGCCGCCTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGAGGAGCATTCTTGTTTaGATAGCACAGCTCAGAACT +
Preference number: 4 (lower is better)
Translates to: GRLCSVLLLRRPSTALTSRSILV*IAQLRT
Trigger: AGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCT...CGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAGGCGGCC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGACTGACAGTTGGACATTaGTCTGACACGTTGGTGGCA +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGLTVGH*SDTLVA
Trigger: TGCCACCAACGTGTCAGAGCAATGTCCAACTGTCAG...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TTTGGACCCGGCCGCTGCCTGCCCCCGACGAGGGTCCATAGGAGAGGAGAGGCATGTGCTCATGCAGGCTaGTACACATTTTGCCCATTT +
Preference number: 4 (lower is better)
Translates to: FGPGRCLPPTRVHRRGEACAHAG*YTFCPF
Trigger: AAATGGGCAAAATGTGTAGCAGCCTGCATGAGCACA...TGCCTCTCCTCTCCTATGGACCCTCGTCGGGGGCAGGCAGCGGCCGGGTCCAAA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGCTGGGACGGGCTCTGTaGGGTCTGGGTCACGATCCG +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWLGRAL*GLGHDP
Trigger: CGGATCGTGACCCAGACCCCACAGAGCCCGTCCCAG...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR CCA 90 bp CTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGCTGGTCACCCCTGCCGTaGACTGGAAGGACATCTGGA +
Preference number: 4 (lower is better)
Translates to: LALTPKRLKRPPAVYSKGWSPLP*TGRTSG
Trigger: TCCAGATGTCCTTCCAGTCCACGGCAGGGGTGACCA...GCCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGGCCGCCGTGGTGATCTaGCCGTTGGTGGCATTGATG +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALAAVVI*PLVALM
Trigger: CATCAATGCCACCAACGGCCAGATCACCACGGCGGC...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGACGTAGACGTTGTTTTTaGTGTAGAGGGACTCACGGT +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRRRRCF*CRGTHG
Trigger: ACCGTGAGTCCCTCTACACCAAAAACAACGTCTACG...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGCTGCCAGGAAGGTaGCCTCGTAGACGTTGTTTT +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGQLPGR*PRRRCF
Trigger: AAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTG...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGCGTAGGGGCCGATGTTaGGGTCGACGTCAGCGTCGG +
Preference number: 4 (lower is better)
Translates to: RHELGHVCLGDSVLILLVRRGRC*GRRQRR
Trigger: CCGACGCTGACGTCGACCCCAACATCGGCCCCTACG...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CGTAACTGCCCTCTTCAGCTGCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACGCTGGAGCCAGATGCTaGCTGGTTTGGACAACTCAC +
Preference number: 4 (lower is better)
Translates to: RNCPLQLPGRVLGSCHLHAGARC*LVWTTH
Trigger: GTGAGTTGTCCAAACCAGCCAGCATCTGGCTCCAGC...GTGCAGATGGCAGGAACCAAGGACCCTCCCTGGCAGCTGAAGAGGGCAGTTACG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAGCACAGCCCTCCGGATaGTTGGAGCTGTCGAGAGTG +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHAAQPSG*LELSRV
Trigger: CACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGC...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp ATTGTATGCTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGGTGCCGAGGCTTCCCCACGTaGGGCCTGCCCCCTGCCGCA +
Preference number: 4 (lower is better)
Translates to: IVCLANANSSSEVELGRCRGFPT*GLPPAA
Trigger: TGCGGCAGGGGGCAGGCCCCACGTGGGGAAGCCTCG...GCACCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAAT
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGATGTCATTCATGTCGATaGCGTAGATGTACAGGTCGA +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRCHSCR*RRCTGR
Trigger: TCGACCTGTACATCTACGTCATCGACATGAATGACA...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
58% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR TCA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCACTGCCTTCACCACGGTaGCCATGCCCTCGTTGGTTA +
Preference number: 4 (lower is better)
Translates to: KDPDIQREHAVSLAQMCALPSPR*PCPRWL
Trigger: TAACCAACGAGGGCATGGTCACCGTGGTGAAGGCAG...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGTTTTCCCTGCCTCCGTaGAGCATCCCTGTTGACTTT +
Preference number: 4 (lower is better)
Translates to: VKTECLLLSFSASQRGAGFSLPP*SIPVDF
Trigger: AAAGTCAACAGGGATGCTTCACGGAGGCAGGGAAAA...CCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCAC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR TCA 90 bp TTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATACCTCCCAGCTGGCCTTaGCTCCCAAGAGGCTCAAGA +
Preference number: 4 (lower is better)
Translates to: FMLPWLPGHSHTSNNPRIPPSWP*LPRGSR
Trigger: TCTTGAGCCTCTTGGGAGTCAAGGCCAGCTGGGAGG...TATGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGCCAGCCTCGAGGACAGCAGCAAGTTTGGACCCGGCCGCTGCCTGCCCCCGACTTGGTGTTATTCCTTTaGGCACTGACAGAAATTGAG +
Preference number: 4 (lower is better)
Translates to: CQPRGQQQVWTRPLPAPDLVLFL*ALTEIE
Trigger: CTCAATTTCTGTCAGTGCTCAAAGGAATAACACCAA...GTCGGGGGCAGGCAGCGGCCGGGTCCAAACTTGCTGCTGTCCTCGAGGCTGGCA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGTCCGCAAGGGTCTACTaGGTTCAGGACCAAGACTGT +
Preference number: 4 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQSARVY*VQDQDC
Trigger: ACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGA...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GCCAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGGAAGACTGTCCCATCTaGCCCAACTTTGAAGTCCAT +
Preference number: 4 (lower is better)
Translates to: AREGPWFLPSAQPSGWLEEDCPI*PNFEVH
Trigger: ATGGACTTCAAAGTTGGGGCAGATGGGACAGTCTTC...CTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTGGC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCTGTCTGGCTGTCCCATaGAGTCACCGTGAACGCCAC +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCCLAVP*SHRERH
Trigger: GTGGCGTTCACGGTGACTGCATGGGACAGCCAGACA...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp GCTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGGAGTATCTCACAGCCTaGTGCATGAACCGGTCAGGG +
Preference number: 4 (lower is better)
Translates to: AGLDSQEAQETPSCVQQREYLTA*CMNRSG
Trigger: CCCTGACCGGTTCATGCAGCAGGCTGTGAGATACTC...CCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCCCATCTGGAGGGTCCCGGTaGCGCTGGCCGGGGGTATCC +
Preference number: 4 (lower is better)
Translates to: RDAQICRCEYIILQYLSPSGGSR*RWPGVS
Trigger: GGATACCCCCGGCCAGCGGCACCGGGACCCTCCAGA...TGGGGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTCCCATGGCTTCCGGCTaGTGCAGCTGGCTGAGGTCG +
Preference number: 4 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPPMASG*CSWLRS
Trigger: CGACCTCAGCCAGCTGCAGCAGCCGGAAGCCATGGG...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACAGCTTTGCTTGGCACGTaGCCCATGGCTTCCGGCTGC +
Preference number: 4 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTALLGT*PMASGC
Trigger: GCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGC...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGGCTTTGCTTGGCACGTaGCCCATGGCTTCCGGCTGC +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPAALLGT*PMASGC
Trigger: GCAGCCGGAAGCCATGGGGCACGTGCCAAGCAAAGC...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCGCACGCCAGGGGCTTTaGTTGGCACGTGCCCCATGG +
Preference number: 4 (lower is better)
Translates to: CAERHYKEKPAGPEIGAAARQGL*LARAPW
Trigger: CCATGGGGCACGTGCCAAGCAAAGCCCCTGGCGTGC...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAACTTCGGTCCGAAGATaGGAGGTCAGTCAATCCTCT +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWATSVRR*EVSQSS
Trigger: AGAGGATTGACTGACCTCGCATCTTCGGACCGAAGT...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGACTTCGGTCCGAAGATaGGAGGTCAGTCAATCCTCT +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQTSVRR*EVSQSS
Trigger: AGAGGATTGACTGACCTCGCATCTTCGGACCGAAGT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACAAGTGAAGACAGAGTaGCTCTTGCTGTCCTTCAGT +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEQVKTE*LLLSFS
Trigger: ACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
58% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGACAAGTGAAGACAGAGTaGCTCTTGCTGTCCTTCAGT +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGQVKTE*LLLSFS
Trigger: ACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTG...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp GTCCCTCCTACGGACCCACGGCGCCACGAGCTGGGTCACGTGTGTCTGGGAGATCGCGATGCTCAGATTTaGAGGTGTGAGTACATCATA +
Preference number: 4 (lower is better)
Translates to: VPPTDPRRHELGHVCLGDRDAQI*RCEYII
Trigger: TATGATGTACTCACACCTGCAAATCTGAGCATCGCG...ATCTCCCAGACACACGTGACCCAGCTCGTGGCGCCGTGGGTCCGTAGGAGGGAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAAGATGTACAGGTCGATaGGGTTCTCCACCTTGTTGC +
Preference number: 4 (lower is better)
Translates to: EDRVPLAVLQCQPARCWARCTGR*GSPPCC
Trigger: GCAACAAGGTGGAGAACCCCATCGACCTGTACATCT...TGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGAGATGTACAGGTCGATaGGGTTCTCCACCTTGTTGC +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQRCTGR*GSPPCC
Trigger: GCAACAAGGTGGAGAACCCCATCGACCTGTACATCT...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
CDS-3UTR CCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAACCCCTGCCGTGGACTaGAAGGACATCTGGATTCCG +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHATPAVD*KDIWIP
Trigger: CGGAATCCAGATGTCCTTCCAGTCCACGGCAGGGGT...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCCGTAGACGTTGTTTTTaGTGTAGAGGGACTCACGGT +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCRRRCF*CRGTHG
Trigger: ACCGTGAGTCCCTCTACACCAAAAACAACGTCTACG...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCAGCTGCCAGGAAGGTaGCCTCGTAGACGTTGTTTT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWQLPGR*PRRRCF
Trigger: AAAACAACGTCTACGAGGCCACCTTCCTGGCAGCTG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCACCCGTTGTCATCACATaGGCACACCTTGACTTTGAT +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSPVVIT*AHLDFD
Trigger: ATCAAAGTCAAGGTGTGCCCATGTGATGACAACGGG...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAACCCGTTGTCATCACATaGGCACACCTTGACTTTGAT +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSEPVVIT*AHLDFD
Trigger: ATCAAAGTCAAGGTGTGCCCATGTGATGACAACGGG...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp AGCCATGGGAGGGTCAGAAAGGACAGGTTGGAGACTGAGACCCCAGCTCAACTCAGCCCTCCGGATGGTTaGAGCTGTCGAGAGTGTCCT +
Preference number: 4 (lower is better)
Translates to: SHGRVRKDRLETETPAQLSPPDG*SCRECP
Trigger: AGGACACTCTCGACAGCTCCAACCATCCGGAGGGCT...GAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTCTGACCCTCCCATGGCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CACAGGAGCATTCTTGTTTGCATAGCACAGCTCAGAACTCGGGGACCCCGGTGCTTCCTTCCCCCTGTCTaGCTTGAGTCAACCCAGCCC +
Preference number: 4 (lower is better)
Translates to: HRSILVCIAQLRTRGPRCFLPPV*LESTQP
Trigger: GGGCTGGGTTGACTCAAGCCAGACAGGGGGAAGGAA...GCACCGGGGTCCCCGAGTTCTGAGCTGTGCTATGCAAACAAGAATGCTCCTGTG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGTGTTGGTCCATCTCCTaGACTGGCTGTCTGCAGAGG +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKCWSIS*TGCLQR
Trigger: CCTCTGCAGACAGCCAGTCCAGGAGATGGACCAACA...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTGTCGAGAGTGTCCTGGGGCGAAGGACTGAAGCATaGACTTCCCCAAACAACAAC +
Preference number: 4 (lower is better)
Translates to: PAICTALRMVGAVESVLGRRTEA*TSPNNN
Trigger: GTTGTTGTTTGGGGAAGTCCATGCTTCAGTCCTTCG...CCCCAGGACACTCTCGACAGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp ATTGTATGCTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGGTGCGGTAGCGGCGGCTGCTaGCGGGACTGGGGTCTCCTG +
Preference number: 4 (lower is better)
Translates to: IVCLANANSSSEVELGRCGSGGC*RDWGLL
Trigger: CAGGAGACCCCAGTCCCGCCAGCAGCCGCCGCTACC...GCACCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp GAGAATGCACCCTCTGAGTTTTCTCATGCAGTGAGCACAGGCAGCCGAGCGCTGTCCGCCTGCGTGATTTaGGCAAAAGGAACGGGGGCT +
Preference number: 4 (lower is better)
Translates to: ENAPSEFSHAVSTGSRALSACVI*AKGTGA
Trigger: AGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGA...CAGCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACTCAGAGGGTGCATTCTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTATACCTGGTCCATGGGCCTTGTaGCGTACATCCGGCCGGACA +
Preference number: 4 (lower is better)
Translates to: PQTTTEISSPSTTRPAIPGPWAL*RTSGRT
Trigger: TGTCCGGCCGGATGTACGTCACAAGGCCCATGGACC...AGGTATAGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCTGTGGCCTGAACGATaGCTGTGTACTGCTGAACTT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWLWPER*LCTAEL
Trigger: AAGTTCAGCAGTACACAGTCATCGTTCAGGCCACAG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
57% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp GGTACCTCACCTCCTTCCTCGGGAAGCCAGTTGTCACTGGCCTGGGAGAGACAGTCCATATCTGTGGCCTaGACGATGACTGTGTACTGC +
Preference number: 4 (lower is better)
Translates to: GTSPPSSGSQLSLAWERQSISVA*TMTVYC
Trigger: GCAGTACACAGTCATCGTTCAGGCCACAGATATGGA...CTGTCTCTCCCAGGCCAGTGACAACTGGCTTCCCGAGGAAGGAGGTGAGGTACC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGTCCATATCTGTGGCCTaGACGATGACTGTGTACTGC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWSISVA*TMTVYC
Trigger: GCAGTACACAGTCATCGTTCAGGCCACAGATATGGA...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
57% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CTCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGATTGAGAGGCCATAGTTaGGATTTCCTTCCATATCTG +
Preference number: 4 (lower is better)
Translates to: LCSVLLLRRPSTALTSVRLRGHS*DFLPYL
Trigger: CAGATATGGAAGGAAATCTCAACTATGGCCTCTCAA...TCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGGCTGTGGCTGTGTTTaGGAGGCCATAGTTGAGATT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWGCGCV*EAIVEI
Trigger: AATCTCAACTATGGCCTCTCAAACACAGCCACAGCC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTCTCGGTCCATCACCGTaGGGTTTGCGACCACGGTCT +
Preference number: 4 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTLGPSP*GLRPRS
Trigger: AGACCGTGGTCGCAAACCTCACGGTGATGGACCGAG...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGACTTCCCCAAACAACAACAGAGATTTCCAGTCCTTCCACTACCCGCCCAGCTCTCGGTCCATCACCGTaGGGTTTGCGACCACGGTCT +
Preference number: 4 (lower is better)
Translates to: GLPQTTTEISSPSTTRPALGPSP*GLRPRS
Trigger: AGACCGTGGTCGCAAACCTCACGGTGATGGACCGAG...AGCTGGGCGGGTAGTGGAAGGACTGGAAATCTCTGTTGTTGTTTGGGGAAGTCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCACCGTTCAGGCGGGTaGTGGTCCAGTTCTTCCGCA +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPAHRSGG*WSSSSA
Trigger: TGCGGAAGAACTGGACCATCACCCGCCTGAACGGTG...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCGAGGTCATCTAGGAAATTCAAGTaGAGACAGAGTGCCTCTTGC +
Preference number: 4 (lower is better)
Translates to: CSSGVRARLSLRSEDARSSRKFK*RQSASC
Trigger: GCAAGAGGCACTCTGTCTTCACTTGAATTTCCTAGA...TGACCTCGCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp ATTGTATGCTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGGTGCCTCCAGGCCCCTGCCTaGGCTCCTCACAGCATCCGG +
Preference number: 4 (lower is better)
Translates to: IVCLANANSSSEVELGRCLQAPA*APHSIR
Trigger: CCGGATGCTGTGAGGAGCTCAGGCAGGGGCCTGGAG...GCACCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGTGGCCAGCTGCCCCTTaGCCTCTGTTGGTCCATCTC +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWWPAAP*PLLVHL
Trigger: GAGATGGACCAACAGAGGTCAAGGGGCAGCTGGCCA...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGCCATGGGAGGGTCAGAAAGGACAGGTTGGAGACTGAGACCCCAGCTCAACTCAGTTGGACATTGCTCTaGCACGTTGGTGGCAGGAGG +
Preference number: 4 (lower is better)
Translates to: SHGRVRKDRLETETPAQLSWTLL*HVGGRR
Trigger: CCTCCTGCCACCAACGTGTCAGAGCAATGTCCAACT...GAGTTGAGCTGGGGTCTCAGTCTCCAACCTGTCCTTTCTGACCCTCCCATGGCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AGTTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCAAGTTGGACATTGCTCTaGCACGTTGGTGGCAGGAGG +
Preference number: 4 (lower is better)
Translates to: SSCCPGSRAIVTLRTIHASWTLL*HVGGRR
Trigger: CCTCCTGCCACCAACGTGTCAGAGCAATGTCCAACT...TGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAACT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCAGGAAGACTGTCCCATCTaGCCCAACTTTGAAGTCCAT +
Preference number: 4 (lower is better)
Translates to: KTECLLLSFSASQRGAGQEDCPI*PNFEVH
Trigger: ATGGACTTCAAAGTTGGGGCAGATGGGACAGTCTTC...CTGCCCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000543233.2
ENST00000614565.5
CDS-3UTR GCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAACCTTCTTTCCTTTCTaGGGTTTGAAGTCCATGCTG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSETFFPF*GLKSML
Trigger: CAGCATGGACTTCAAACCGCAGAAAGGAAAGAAGGT...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000611855.4
CDS-3UTR GCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTTGGTGGAGCTCATGCTaGCCCCAAAGGCACCCCGAG +
Preference number: 4 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPWWSSC*PQRHPE
Trigger: CTCGGGGTGCCTTTGGGGGCAGCATGAGCTCCACCA...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGCCTGGCACAGATGTGTaGACTCAAGGCCAAAGCTGT +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKPGTDV*TQGQSC
Trigger: ACAGCTTTGGCCTTGAGTGCACACATCTGTGCCAGG...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGGCCAGAAATTGGGGCTaGCCAGGCCCTGAAGAGGAC +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWARNWG*PGPEED
Trigger: GTCCTCTTCAGGGCCTGGGCAGCCCCAATTTCTGGC...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGGCTGGCGGTAAATTCTaGCGGGTTGTCATTCACATC +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWAGGKF*RVVIHI
Trigger: GATGTGAATGACAACCCGCCAGAATTTACCGCCAGC...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGGACTGGAAGGACATCTaGATTCCGCTGGCCAGGGGC +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPADWKDI*IPLARG
Trigger: GCCCCTGGCCAGCGGAATCCAGATGTCCTTCCAGTC...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR CCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGGCCGCCGTGGTGATCTaGCCGTTGGTGGCATTGATG +
Preference number: 4 (lower is better)
Translates to: RHELGHVCLGDSVLILLVAAVVI*PLVALM
Trigger: CATCAATGCCACCAACGGCCAGATCACCACGGCGGC...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCGGGACTGGGGTCTCCTaGTGCTGGGTCCTGGGAACA +
Preference number: 4 (lower is better)
Translates to: CAERHYKEKPAGPEIGAAGTGVS*CWVLGT
Trigger: TGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCCC...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TTCATGCTGCCCTGGCTCCCGGGCCATAGTCACACTTCGAACAATCCACGCATATCCGCCTGCGTGATTTaGGCAAAAGGAACGGGGGCT +
Preference number: 4 (lower is better)
Translates to: FMLPWLPGHSHTSNNPRISACVI*AKGTGA
Trigger: AGCCCCCGTTCCTTTTGCCCAAATCACGCAGGCGGA...TATGCGTGGATTGTTCGAAGTGTGACTATGGCCCGGGAGCCAGGGCAGCATGAA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp CCTCGCGATGCTCAGATTTGCAGGTGTGAGTACATCATACTCCAGTATCTTTCCCCATGCCCTCGCACCTaGCCAGCATTGGCCTCCCGG +
Preference number: 4 (lower is better)
Translates to: PRDAQICRCEYIILQYLSPCPRT*PALASR
Trigger: CCGGGAGGCCAATGCTGGCCAGGTGCGAGGGCATGG...GGAAAGATACTGGAGTATGATGTACTCACACCTGCAAATCTGAGCATCGCGAGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TTGAGTCAACCCAGCCCTGGAGATAGCAGTGCCAGCCTCGAGGACAGCAGCAAGCAAAGAGAAACCTGCTaGGCCAGAAATTGGGGCTGC +
Preference number: 4 (lower is better)
Translates to: LSQPSPGDSSASLEDSSKQRETC*ARNWGC
Trigger: GCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTG...CTTGCTGCTGTCCTCGAGGCTGGCACTGCTATCTCCAGGGCTGGGTTGACTCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp ACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGAACGAATTATCATCTCAGTaGACTGTGTGTGTCGGCTGG +
Preference number: 4 (lower is better)
Translates to: TGVSWCWVLGTSARSSGNELSSQ*TVCVGW
Trigger: CCAGCCGACACACACAGTCCACTGAGATGATAATTC...GTTCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR CCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCGAGGTGGTCCCCCGCTaGGCCTGTTGTGAGGTACTG +
Preference number: 4 (lower is better)
Translates to: CAERHYKEKPAGPEIGAAEVVPR*ACCEVL
Trigger: CAGTACCTCACAACAGGCCCAGCGGGGGACCACCTC...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGCATGACTGTGTACTGCTaGACTTTCTCTCGGTCCAGG +
Preference number: 4 (lower is better)
Translates to: LALTPKRLKRPPAVYSKGMTVYC*TFSRSR
Trigger: CCTGGACCGAGAGAAAGTTCAGCAGTACACAGTCAT...GCCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR TCA 90 bp CTGGCCTTGACTCCCAAGAGGCTCAAGAGACCCCCAGCTGTGTACAGCAAAGGCCTGTGGCCTGAACGATaGCTGTGTACTGCTGAACTT +
Preference number: 4 (lower is better)
Translates to: LALTPKRLKRPPAVYSKGLWPER*LCTAEL
Trigger: AAGTTCAGCAGTACACAGTCATCGTTCAGGCCACAG...GCCTTTGCTGTACACAGCTGGGGGTCTCTTGAGCCTCTTGGGAGTCAAGGCCAG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TCTGCTCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAATTGAGAGGCCATAGTTaGGATTTCCTTCCATATCTG +
Preference number: 4 (lower is better)
Translates to: SAQSCSSGVRARLSLRSELRGHS*DFLPYL
Trigger: CAGATATGGAAGGAAATCTCAACTATGGCCTCTCAA...TTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGAGCAGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp TCAGTCCTGCTCCTCCGGCGTCCGAGCACGGCTCTCACTTCGGTCCGAAGATGCTTGAGAGGCCATAGTTaGGATTTCCTTCCATATCTG +
Preference number: 4 (lower is better)
Translates to: SVLLLRRPSTALTSVRRCLRGHS*DFLPYL
Trigger: CAGATATGGAAGGAAATCTCAACTATGGCCTCTCAA...GCATCTTCGGACCGAAGTGAGAGCCGTGCTCGGACGCCGGAGGAGCAGGACTGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR TCA 90 bp AGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTGGCTGCCTTCACCACGGTaGCCATGCCCTCGTTGGTTA +
Preference number: 4 (lower is better)
Translates to: REPKEASKFQRKEFMLPWLPSPR*PCPRWL
Trigger: TAACCAACGAGGGCATGGTCACCGTGGTGAAGGCAG...CCAGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCCCTCCCAGCTGGCCTTaGCTCCCAAGAGGCTCAAGA +
Preference number: 4 (lower is better)
Translates to: CAERHYKEKPAGPEIGAAPPSWP*LPRGSR
Trigger: TCTTGAGCCTCTTGGGAGTCAAGGCCAGCTGGGAGG...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGAAATTCAAGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGAGTTTTCTCATGCAGTaGGCACAGGCAGCCGAGCGC +
Preference number: 4 (lower is better)
Translates to: GNSSEDRVPLAVLQCQPASFLMQ*AQAAER
Trigger: GCGCTCGGCTGCCTGTGCTCACTGCATGAGAAAACT...CGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTGAATTTCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp CGCCACGAGCTGGGTCACGTGTGTCTGGGAGATTCTGTGTTGATTCTTTTGGTGGGAGAGACAGAAAGCTaGCCAAGCACGAGGCTTCCC +
Preference number: 4 (lower is better)
Translates to: RHELGHVCLGDSVLILLVGETES*PSTRLP
Trigger: GGGAAGCCTCGTGCTTGGTCAGCTTTCTGTCTCTCC...CACCAAAAGAATCAACACAGAATCTCCCAGACACACGTGACCCAGCTCGTGGCG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp AAGGACCCTGACATCCAACGGGAACATGCCGTGAGCCTGGCACAGATGTGTGCAGCATCTCTGAGAGCCTaGCAGTTGGACATTGCTCTG +
Preference number: 4 (lower is better)
Translates to: KDPDIQREHAVSLAQMCAASLRA*QLDIAL
Trigger: CAGAGCAATGTCCAACTGTCAGGCTCTCAGAGATGC...TGCACACATCTGTGCCAGGCTCACGGCATGTTCCCGTTGGATGTCAGGGTCCTT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR TCA 90 bp GGACTGGGGTCTCCTGGTGCTGGGTCCTGGGAACATCAGCCCGGAGTTCAGGGATATTCCTTTGAGCACTaGCAGAAATTGAGACTACCC +
Preference number: 4 (lower is better)
Translates to: GLGSPGAGSWEHQPGVQGYSFEH*QKLRLP
Trigger: GGGTAGTCTCAATTTCTGTCAGTGCTCAAAGGAATA...TCCCTGAACTCCGGGCTGATGTTCCCAGGACCCAGCACCAGGAGACCCCAGTCC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACATCCCGTTGGCGTTCTGGTaGTGGGGCCACGGCAGCAGG +
Preference number: 4 (lower is better)
Translates to: STEFRTKTVWHWKHTENIPLAFW*WGHGSR
Trigger: CCTGCTGCCGTGGCCCCAGCACCAGAACGCCAACGG...GATGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000614565.5
CDS-3UTR GCA 90 bp GGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGAAAACAGCCCAGACCAGCCGCTaGCACTGCGCCAATGGTGGT +
Preference number: 4 (lower is better)
Translates to: GLLSSGPRLSGTGNTLKTAQTSR*HCANGG
Trigger: ACCACCATTGGCGCAGTGGCAGCGGCTGGTCTGGGC...TGTTTTCAGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACACTGGGTCAATGAGCAGCTaGTTCGTGTGGCGCTCCTTC +
Preference number: 4 (lower is better)
Translates to: PQGSTEFRTKTVWHWKHTGSMSS*FVWRSF
Trigger: GAAGGAGCGCCACACGAAGCAGCTGCTCATTGACCC...AGTGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TTGAGACTACCCCTCGCCCAGCTTTTTGCTTTGGAGAGAACAGAATTATCATCTGGAGCTGACGGAGCCTaGGGTGGAGCCGCTCCCCTC +
Preference number: 4 (lower is better)
Translates to: LRLPLAQLFALERTELSSGADGA*GGAAPL
Trigger: GAGGGGAGCGGCTCCACCGCAGGCTCCGTCAGCTCC...AGATGATAATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGGGGTAGTCTCAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp AGTGAAGACAGAGTGCCTCTTGCTGTCCTTCAGTGCCAGCCAGCGCGGTGCTGGCAAGTGAAGACAGAGTaGCTCTTGCTGTCCTTCAGT +
Preference number: 4 (lower is better)
Translates to: SEDRVPLAVLQCQPARCWQVKTE*LLLSFS
Trigger: ACTGAAGGACAGCAAGAGGCACTCTGTCTTCACTTG...CCAGCACCGCGCTGGCTGGCACTGAAGGACAGCAAGAGGCACTCTGTCTTCACT
56% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000543233.2
ENST00000611855.4
ENST00000614565.5
ENST00000625686.1
ENST00000628489.2
ENST00000629889.2
CDS-3UTR GCA 90 bp TGTGCTGAAAGACACTACAAAGAGAAACCTGCTGGGCCAGAAATTGGGGCTGCCAGGGTCCTTGGTTCCTaGCATCTGCACAGCCCTCCG +
Preference number: 4 (lower is better)
Translates to: CAERHYKEKPAGPEIGAARVLGS*HLHSPP
Trigger: CGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCT...GGCAGCCCCAATTTCTGGCCCAGCAGGTTTCTCTTTGTAGTGTCTTTCAGCACA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp TCAGGGAACCCAAGGAGGCCTCGAAATTTCAGAGAAAGGAGTTCATGCTGCCCTAGGGTCCTTGGTTCCTaGCATCTGCACAGCCCTCCG +
Preference number: 4 (lower is better)
Translates to: SGNPRRPRNFRERSSCCPRVLGS*HLHSPP
Trigger: CGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCT...AGGGCAGCATGAACTCCTTTCTCTGAAATTTCGAGGCCTCCTTGGGTTCCCTGA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp ATTGTATGCTTAGCTAACGCTAACTCAAGTTCAGAGGTGGAGCTGGGAAGGTGCCCCTGGTGGAGCTCATaGTGCCCCCAAAGGCACCCC +
Preference number: 4 (lower is better)
Translates to: IVCLANANSSSEVELGRCPWWSS*CPQRHP
Trigger: GGGGTGCCTTTGGGGGCAGCATGAGCTCCACCAGGG...GCACCTTCCCAGCTCCACCTCTGAACTTGAGTTAGCGTTAGCTAAGCATACAAT
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CTCCGCAAGGGTCTACTGAGTTCAGGACCAAGACTGTCTGGCACTGGAAACACAAAGGCCAGTCGTTCCTaGCACTCCAACCTGCAGCAC +
Preference number: 4 (lower is better)
Translates to: LRKGLLSSGPRLSGTGNTKASRS*HSNLQH
Trigger: GTGCTGCAGGTTGGAGTGGCAGGAACGACTGGCCTT...TGTGTTTCCAGTGCCAGACAGTCTTGGTCCTGAACTCAGTAGACCCTTGCGGAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000614565.5
ENST00000625686.1
CDS-3UTR GCA 90 bp CAGGGAGGGTCCTTGGTTCCTGCCATCTGCACAGCCCTCCGGATGGTTGGAGCTCCTCGCCCAGCTTTTTaGTTTGGAGAGAACAGAATT +
Preference number: 4 (lower is better)
Translates to: QGGSLVPAICTALRMVGAPRPAF*FGENRI
Trigger: AATTCTGTTCTCTCCAAAGCAAAAAGCTGGGCGAGG...AGCTCCAACCATCCGGAGGGCTGTGCAGATGGCAGGAACCAAGGACCCTCCCTG
56% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000614565.5