RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for C2 (Homo sapiens)

Ensembl gene IDs: ENSG00000166278, ENSG00000204364, ENSG00000206372, ENSG00000226560, ENSG00000235017, ENSG00000235696

Ensembl transcript IDs: ENST00000299367.10, ENST00000375510.8, ENST00000383177.7, ENST00000383359.7, ENST00000383362.8, ENST00000383367.6, ENST00000411571.6, ENST00000411803.6, ENST00000411830.5, ENST00000411885.5, ENST00000413154.5, ENST00000413548.6, ENST00000413649.1, ENST00000414609.5, ENST00000415985.5, ENST00000416252.6, ENST00000416456.5, ENST00000417322.5, ENST00000418584.5, ENST00000418949.6, ENST00000419062.5, ENST00000421932.5, ENST00000423826.5, ENST00000428140.5, ENST00000428349.5, ENST00000431247.5, ENST00000432285.5, ENST00000433109.5, ENST00000435104.5, ENST00000435596.5, ENST00000436560.5, ENST00000437162.5, ENST00000437394.1, ENST00000439426.5, ENST00000440861.1, ENST00000442278.6, ENST00000445056.1, ENST00000446097.5, ENST00000447164.1, ENST00000447952.6, ENST00000448206.6, ENST00000449293.1, ENST00000449738.5, ENST00000452202.5, ENST00000452323.6, ENST00000452763.5, ENST00000455713.5, ENST00000458410.5, ENST00000458436.5, ENST00000460487.1, ENST00000461900.1, ENST00000462325.5, ENST00000464303.5, ENST00000466537.1, ENST00000466838.1, ENST00000466858.5, ENST00000468407.1, ENST00000469372.5, ENST00000469696.5, ENST00000469807.1, ENST00000472803.5, ENST00000473998.5, ENST00000474222.5, ENST00000475544.5, ENST00000476210.5, ENST00000477630.5, ENST00000479385.5, ENST00000479997.2, ENST00000480625.2, ENST00000482060.5, ENST00000482418.5, ENST00000482802.5, ENST00000483332.5, ENST00000483849.1, ENST00000483976.5, ENST00000484209.5, ENST00000484636.1, ENST00000484901.5, ENST00000485098.5, ENST00000485544.5, ENST00000485690.5, ENST00000486124.5, ENST00000486307.1, ENST00000486419.5, ENST00000486761.5, ENST00000488666.5, ENST00000489229.5, ENST00000490020.1, ENST00000490080.5, ENST00000491080.5, ENST00000491097.5, ENST00000491198.5, ENST00000491566.1, ENST00000492777.1, ENST00000493064.5, ENST00000493575.5, ENST00000494905.1, ENST00000494965.5, ENST00000495226.5, ENST00000495405.1, ENST00000495674.1, ENST00000497466.5, ENST00000497706.5, ENST00000497736.5, ENST00000498138.5, ENST00000547984.3, ENST00000548250.5, ENST00000548500.4, ENST00000548828.4, ENST00000548973.5, ENST00000548995.3, ENST00000549972.3, ENST00000549997.5, ENST00000550045.5, ENST00000550363.4, ENST00000550682.5, ENST00000551081.4, ENST00000551648.5, ENST00000552638.3, ENST00000612228.1, ENST00000613837.3, ENST00000614291.3, ENST00000615380.4, ENST00000615801.3, ENST00000618254.4, ENST00000618948.4, ENST00000621558.4

Found 2529 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR CCA 90 bp GGTTGGCGGCAGATGGGCTCCGTTCCACTCCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGACCCCGTGAGCACAAGATTCGAGGAG +
Preference number: 1 (lower is better)
Translates to: GWRQMGSVPLQTPLP*HSRSEDPVSTRFEE
Trigger: CTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTGGAACGGAGCCCATCTGCCGCCAACC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 90 bp ACATGCCGTTGGGGCGACACTGACGCACAGGCGAGCCCCGCAATATaGAGCCATCCTCACACTCGAAGCTCACATTGCCACCCACGGGAT +
Preference number: 1 (lower is better)
Translates to: TCRWGDTDAQASPAI*SHPHTRSSHCHPRD
Trigger: ATCCCGTGGGTGGCAATGTGAGCTTCGAGTGTGAGGATGGCTTCATATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 90 bp TCACACACAGCTGTTTCTCCATCCCACATGCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGCAATATGAAGCCATCCTCACACTCG +
Preference number: 1 (lower is better)
Translates to: SHTAVSPSHMPLGRH*RTGEPRNMKPSSHS
Trigger: CGAGTGTGAGGATGGCTTCATATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAACAGCTGTGTGTGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTaGGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGG +
Preference number: 1 (lower is better)
Translates to: EAVLLVGALRISQLV*AASGILETRIYSAR
Trigger: CCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR TCA 90 bp AATAGTGACATGCCAGGGTGTCCTCTCCTGGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCAGATGGTGTCTGTGAGCTTGGAGAC +
Preference number: 1 (lower is better)
Translates to: NSDMPGCPLLVRGVC*HVPHPADGVCELGD
Trigger: GTCTCCAAGCTCACAGACACCATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR CCA 90 bp TCTTGGCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTaGTCAGAGGCGTTTGCTGACATGTTCCCCACCCCGCAGATGGTG +
Preference number: 1 (lower is better)
Translates to: SWLLGLIVTCQGVLS*SEAFADMFPTPQMV
Trigger: CACCATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGCCAAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR CCA 90 bp CCCTTGCAGGGACTCTCATCCTCCTGGGTCCCACTGCATAGGAACTaGTCTGTCACCACCTCCCTGACATCTGTCAAGTTGGGGAACATG +
Preference number: 1 (lower is better)
Translates to: PLQGLSSSWVPLHRN*SVTTSLTSVKLGNM
Trigger: CATGTTCCCCAACTTGACAGATGTCAGGGAGGTGGTGACAGACCAGTTCCTATGCAGTGGGACCCAGGAGGATGAGAGTCCCTGCAAGGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CCA 90 bp AAAACTGCTCCCCCAGATTCTCCCTTGCAGGGACTCTCATCCTCCTaGGTCCCACTGCATAGGAACTGGTCTGTCACCACCTCCCTGACA +
Preference number: 1 (lower is better)
Translates to: KTAPPDSPLQGLSSS*VPLHRNWSVTTSLT
Trigger: TGTCAGGGAGGTGGTGACAGACCAGTTCCTATGCAGTGGGACCCAGGAGGATGAGAGTCCCTGCAAGGGAGAATCTGGGGGAGCAGTTTT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 90 bp TGTTTGTTCAGCAGTTCATTCTCATGGTCCCTACAGGTGCTGCCTTaGGGTCTCCGCAGAGCCAGATTGGCCTCCATCGTGCAGGGAAGG +
Preference number: 1 (lower is better)
Translates to: CLFSSSFSWSLQVLP*GLRRARLASIVQGR
Trigger: CCTTCCCTGCACGATGGAGGCCAATCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAGGGACCATGAGAATGAACTGCTGAACAAACA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 90 bp ACATCCAGCATATGTTCAAAGACCTGGTGCAGAGCCTTTGTGTCCTaGAGAATGAAGGCATGCCTCTCACCATCCTTCTTGGACCCTAGC +
Preference number: 1 (lower is better)
Translates to: TSSICSKTWCRAFVS*RMKACLSPSFLDPS
Trigger: GCTAGGGTCCAAGAAGGATGGTGAGAGGCATGCCTTCATTCTGCAGGACACAAAGGCTCTGCACCAGGTCTTTGAACATATGCTGGATGT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR GCA 90 bp TTGGACTTTCCATCTGTCAGAAGGATGATGGCATGTCGGATTTCCTaGCAGGCCATCGTTTCCATGCCGAGGAGTCGCATTTGGTTGTTC +
Preference number: 1 (lower is better)
Translates to: LDFPSVRRMMACRIS*QAIVSMPRSRIWLF
Trigger: GAACAACCAAATGCGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGCCATCATCCTTCTGACAGATGGAAAGTCCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 90 bp TCTTGGACCCTAGCTCATTCAGTTCTCTCCAGTCCACATCCAGCTTaGCCACCCCGATGGCATAGATGTCCAGATAGTCATTCCTCTTCT +
Preference number: 1 (lower is better)
Translates to: SWTLAHSVLSSPHPA*PPRWHRCPDSHSSS
Trigger: AGAAGAGGAATGACTATCTGGACATCTATGCCATCGGGGTGGGCAAGCTGGATGTGGACTGGAGAGAACTGAATGAGCTAGGGTCCAAGA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 90 bp TCAAAGACCTGGTGCAGAGCCTTTGTGTCCTGCAGAATGAAGGCATaGCTCTCACCATCCTTCTTGGACCCTAGCTCATTCAGTTCTCTC +
Preference number: 1 (lower is better)
Translates to: SKTWCRAFVSCRMKA*LSPSFLDPSSFSSL
Trigger: GAGAGAACTGAATGAGCTAGGGTCCAAGAAGGATGGTGAGAGGCATGCCTTCATTCTGCAGGACACAAAGGCTCTGCACCAGGTCTTTGA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CCA 90 bp GAACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTaGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCACTG +
Preference number: 1 (lower is better)
Translates to: ELQDSLVLFGKDIKP*GDHRLLNKEFFAPL
Trigger: CAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGTTC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR TCA 90 bp CAGTTCCATTTTCATGATCTTTATAGTTGGCATTTTCCAGGCTGCTaGTCACCTCAGTCATATCCCGGGAGTTGTCGTTCAGGACAGACA +
Preference number: 1 (lower is better)
Translates to: QFHFHDLYSWHFPGC*SPQSYPGSCRSGQT
Trigger: TGTCTGTCCTGAACGACAACTCCCGGGATATGACTGAGGTGATCAGCAGCCTGGAAAATGCCAACTATAAAGATCATGAAAATGGAACTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR TCA 90 bp ATTAATTTCATAACTGGGAAATTCCATGTGAAAGTGAAACAAGCATaGGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAG +
Preference number: 1 (lower is better)
Translates to: INFITGKFHVKVKQA*VKSTREGIWGQAKE
Trigger: CTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTTGTTTCACTTTCACATGGAATTTCCCAGTTATGAAATTAAT
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 37 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR TCA 90 bp ATCTTAAGGTTAATGTTCAGTTTGCTCCCATTCAAGGCGACAAAATaGGCAGGAACACTCTGTTTGTTCAGCAGTTCATTCTCATGGTCC +
Preference number: 1 (lower is better)
Translates to: ILRLMFSLLPFKATK*AGTLCLFSSSFSWS
Trigger: GGACCATGAGAATGAACTGCTGAACAAACAGAGTGTTCCTGCTCATTTTGTCGCCTTGAATGGGAGCAAACTGAACATTAACCTTAAGAT
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR TCA 90 bp AGGACATCCCCCAGGTGCTGCCTCAGCCAGGGCTGCATGCGGAAGAGATTGATGCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 2 (lower is better)
Translates to: RTSPRCCLSQGCMRKRLMPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...CATCAATCTCTTCCGCATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT
67% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp GGTGTCCTCTCCTGGTCAGAGGCGTTTGCTGACATGTTCCCCACCCCGCAGATGCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 2 (lower is better)
Translates to: GVLSWSEAFADMFPTPQMLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...CATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp GATGATGGCATGTCGGATTTCCTGCCAGGCCATCGTTTCCATGCCGAGGAGTCGCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 2 (lower is better)
Translates to: DDGMSDFLPGHRFHAEESHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...CGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGCCATCATC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR TCA 90 bp GGATTTGGGGTCTCCCACATTGACCCTCCACAGGGAGTGGTCGTTGCCATCGCGGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCA +
Preference number: 2 (lower is better)
Translates to: GFGVSHIDPPQGVVVAIAVRGVC*HVPHPA
Trigger: TGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGAC...CGCGATGGCAACGACCACTCCCTGTGGAGGGTCAATGTGGGAGACCCCAAATCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR TCA 90 bp GGTGTCCTCTCCTGGTCAGAGGCGTTTGCTGACATGTTCCCCACCCCGCAGATGCCATCGCGGAAGCAATaGGCTGCTGTCAGGACCCAT +
Preference number: 2 (lower is better)
Translates to: GVLSWSEAFADMFPTPQMPSRKQ*AAVRTH
Trigger: ATGGGTCCTGACAGCAGCTCATTGCTTCCGCGATGG...CATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR TCA 90 bp AGGACATCCCCCAGGTGCTGCCTCAGCCAGGGCTGCATGCGGAAGAGATTGATGGCGAGCCCCGCAATATaGAGCCATCCTCACACTCGA +
Preference number: 2 (lower is better)
Translates to: RTSPRCCLSQGCMRKRLMASPAI*SHPHTR
Trigger: TCGAGTGTGAGGATGGCTTCATATTGCGGGGCTCGC...CATCAATCTCTTCCGCATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGACCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGAC +
Preference number: 2 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGPACVR*LWHPRD
Trigger: GTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGG...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR GCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGCCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGAC +
Preference number: 2 (lower is better)
Translates to: KHESSQPGKESGDRPRSGPACVR*LWHPRD
Trigger: GTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGG...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGATGTGTGCGCTGCCTCTaGCATCCTAGAGACCCGGAT +
Preference number: 2 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGCVRCL*HPRDPD
Trigger: ATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACA...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGTGTGTGCGCTGCCTCTaGCATCCTAGAGACCCGGAT +
Preference number: 2 (lower is better)
Translates to: KHESSQPGKESGDRPRSGCVRCL*HPRDPD
Trigger: ATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACA...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR CAA 90 bp CTGTTTGTTCAGCAGTTCATTCTCATGGTCCCTACAGGTGCTGCCTaGAGGTCTCCGCAGAGCCAGATTGGCCTCCATCGTGCAGGGAAG +
Preference number: 2 (lower is better)
Translates to: LFVQQFILMVPTGAA*RSPQSQIGLHRAGK
Trigger: CTTCCCTGCACGATGGAGGCCAATCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAGGGACCATGAGAATGAACTGCTGAACAAACAG
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp ACATGCCAGGGTGTCCTCTCCTGGTCAGAGGCGTTTGCTGACATGTTCCCCACCTGTTCAAAGACCTGGTaGAGAGCCTTTGTGTCCTGC +
Preference number: 2 (lower is better)
Translates to: TCQGVLSWSEAFADMFPTCSKTW*RAFVSC
Trigger: GCAGGACACAAAGGCTCTGCACCAGGTCTTTGAACA...GGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACCCTGGCATGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR GCA 90 bp TCTCCTGGTCAGAGGCGTTTGCTGACATGTTCCCCACCCCGCAGATGGTGTCTGTGTTCAAAGACCTGGTaGAGAGCCTTTGTGTCCTGC +
Preference number: 2 (lower is better)
Translates to: SPGQRRLLTCSPPRRWCLCSKTW*RAFVSC
Trigger: GCAGGACACAAAGGCTCTGCACCAGGTCTTTGAACA...CAGACACCATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR GCA 90 bp CAGAAGGATGATGGCATGTCGGATTTCCTGCCAGGCCATCGTTTCCATGCCGAGTTTCTCCATCCCACATaGCGTTGGGGCGACACTGAC +
Preference number: 2 (lower is better)
Translates to: QKDDGMSDFLPGHRFHAEFLHPT*RWGDTD
Trigger: GTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAA...CTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGCCATCATCCTTCTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGTTCAGAGGTAGAAGATaGAGGGGCGGCAGATTCTGG +
Preference number: 2 (lower is better)
Translates to: KHESSQPGKESGDRPRSGFRGRR*RGGRFW
Trigger: CCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAA...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTTTCAGAGGTAGAAGATaGAGGGGCGGCAGATTCTGG +
Preference number: 2 (lower is better)
Translates to: SQLVCAASGILETRIYSAFRGRR*RGGRFW
Trigger: CCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAA...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp TTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTTCAGAGGTAGAAGATaGAGGGGCGGCAGATTCTGG +
Preference number: 2 (lower is better)
Translates to: FPACVRCLWHPRDPDLLSFRGRR*RGGRFW
Trigger: CCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAA...GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGATTCAGAGGTAGAAGATaGAGGGGCGGCAGATTCTGG +
Preference number: 2 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGFRGRR*RGGRFW
Trigger: CCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAA...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR TCA 90 bp CTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGATCACGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCA +
Preference number: 2 (lower is better)
Translates to: LQDSLVLFGKDIKPWGDHVRGVC*HVPHPA
Trigger: TGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGAC...GTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR GCA 90 bp GAAACAAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGACCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGAC +
Preference number: 2 (lower is better)
Translates to: ETSMSQVNQGRNLGTGQGPACVR*LWHPRD
Trigger: GTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGG...TCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTTGTTTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp GATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCTTCAGAGGTAGAAGATaGAGGGGCGGCAGATTCTGG +
Preference number: 2 (lower is better)
Translates to: DFPACVRCLWHPRDPDLLFRGRR*RGGRFW
Trigger: CCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAA...GAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp GAAACAAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGATGTGTGCGCTGCCTCTaGCATCCTAGAGACCCGGAT +
Preference number: 2 (lower is better)
Translates to: ETSMSQVNQGRNLGTGQGCVRCL*HPRDPD
Trigger: ATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACA...TCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTTGTTTC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp GGAACACTCTGTTTGTTCAGCAGTTCATTCTCATGGTCCCTACAGGTGCTGCCTCATCCCACATGCCGTTaGGGCGACACTGACGCACAG +
Preference number: 2 (lower is better)
Translates to: GTLCLFSSSFSWSLQVLPHPTCR*GDTDAQ
Trigger: CTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATG...AGGCAGCACCTGTAGGGACCATGAGAATGAACTGCTGAACAAACAGAGTGTTCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CCA 90 bp ATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGATCACCGCCTTCAGGGTTGGCGGCAGATaGGCTCCGTTCCACTCCAGA +
Preference number: 2 (lower is better)
Translates to: IPWFFLAKTSNPGEITAFRVGGR*APFHSR
Trigger: TCTGGAGTGGAACGGAGCCCATCTGCCGCCAACCCT...GAAGGCGGTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAAT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR TCA 90 bp ATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCACTGGGATTTGGGGTCTCCCCGCAGATGGTGTCTGTaGGCTTGGAGACATCCAGCA +
Preference number: 2 (lower is better)
Translates to: ITAFSIRNSLPHWDLGSPRRWCL*AWRHPA
Trigger: TGCTGGATGTCTCCAAGCTCACAGACACCATCTGCG...GGGAGACCCCAAATCCCAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR GCA 90 bp GAAAGTGAAACAAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGAC +
Preference number: 2 (lower is better)
Translates to: ESETSMSQVNQGRNLGTGPACVR*LWHPRD
Trigger: GTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGG...GCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTTGTTTCACTTTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR GCA 90 bp GGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGATCACCGCCTACAGGGAGTGGTCGTTaGCATCGCGGAAGCAATGAG +
Preference number: 2 (lower is better)
Translates to: GFPGSFWQRHQTLGRSPPTGSGR*HRGSNE
Trigger: CTCATTGCTTCCGCGATGGCAACGACCACTCCCTGT...AGGCGGTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCC
53% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp GAAAGTGAAACAAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCTGTGTGCGCTGCCTCTaGCATCCTAGAGACCCGGAT +
Preference number: 2 (lower is better)
Translates to: ESETSMSQVNQGRNLGTGCVRCL*HPRDPD
Trigger: ATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACA...GCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTTGTTTCACTTTC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR CCA 90 bp GCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTGGTCAGAGGCGTTAAAGACATCAAACCCTaGGGAGATCACCGCCTTCTC +
Preference number: 2 (lower is better)
Translates to: ALGLNSDMPGCPLLVRGVKDIKP*GDHRLL
Trigger: GAGAAGGCGGTGATCTCCCCAGGGTTTGATGTCTTT...AACGCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp AGAACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGACCTGGGTTGGGGCAGTaGCCAGCCCCATTATCACAC +
Preference number: 2 (lower is better)
Translates to: RTPGFPGSFWQRHQTLGRPGLGQ*PAPLSH
Trigger: GTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGG...TCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGTTCT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CAA 90 bp TTGGCATTTTCCAGGCTGCTGATCACCTCAGTCATATCCCGGGAGTaGTCGTTCAGGACAGACATGAGGACTTTGGGCTCTGAGGCAAAG +
Preference number: 2 (lower is better)
Translates to: LAFSRLLITSVISRE*SFRTDMRTLGSEAK
Trigger: CTTTGCCTCAGAGCCCAAAGTCCTCATGTCTGTCCTGAACGACAACTCCCGGGATATGACTGAGGTGATCAGCAGCCTGGAAAATGCCAA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR CAA 90 bp ACAGTCCAGGAGCAGGTAGAGGTTCAGATGACCAGAGCGCTGGATTaGGATTTTACGGCCCAGGCTTTCCTTTGTCTTCTGGGTGGGATT +
Preference number: 2 (lower is better)
Translates to: TVQEQVEVQMTRALD*DFTAQAFLCLLGGI
Trigger: AATCCCACCCAGAAGACAAAGGAAAGCCTGGGCCGTAAAATCCAAATCCAGCGCTCTGGTCATCTGAACCTCTACCTGCTCCTGGACTGT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp CTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGATCACGCGGAAGCAATGAGCTaGTGTCAGGACCCATTGGTC +
Preference number: 2 (lower is better)
Translates to: LQDSLVLFGKDIKPWGDHAEAMS*CQDPLV
Trigger: GACCAATGGGTCCTGACAGCAGCTCATTGCTTCCGC...GTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR GCA 90 bp GACATCAAACCCTGGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCAACAGGGAGTGGTCGTTaGCATCGCGGAAGCAATGAG +
Preference number: 2 (lower is better)
Translates to: DIKPWGDHRLLNKEFFAPTGSGR*HRGSNE
Trigger: CTCATTGCTTCCGCGATGGCAACGACCACTCCCTGT...TGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp ATCAAACCCTGGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCACTGCCCCGGCAGGTCTCTTaGCTCTTGGGCTTAATAGTG +
Preference number: 2 (lower is better)
Translates to: IKPWGDHRLLNKEFFAPLPRQVS*LLGLIV
Trigger: CACTATTAAGCCCAAGAGCCAAGAGACCTGCCGGGG...CAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGAT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR TCA 90 bp ATCCTGTCCACCATGAGGGAGGCGCTCTCCTTGAAGATGAGAAAGTCATTTTCCGAGGACTTTGGGCTCTaGGGCAAAGGTGATAATGGC +
Preference number: 2 (lower is better)
Translates to: ILSTMREALSLKMRKSFSEDFGL*GKGDNG
Trigger: GCCATTATCACCTTTGCCTCAGAGCCCAAAGTCCTC...GGAAAATGACTTTCTCATCTTCAAGGAGAGCGCCTCCCTCATGGTGGACAGGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000411571.6
ENST00000482060.5
ENST00000484636.1
3UTR-3UTR GCA 90 bp TGTGAAAGTGAAACAAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACACCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGAC +
Preference number: 2 (lower is better)
Translates to: CESETSMSQVNQGRNLGTPACVR*LWHPRD
Trigger: GTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGG...TGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTTGTTTCACTTTCACA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 37 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR-3UTR GCA 90 bp ATCAAACCCTGGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCACTGAGGCCATCGTTTCCATaGCGAGGAGTCGCATTTGGT +
Preference number: 2 (lower is better)
Translates to: IKPWGDHRLLNKEFFAPLRPSFP*RGVAFG
Trigger: ACCAAATGCGACTCCTCGGCATGGAAACGATGGCCT...CAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp ATCCTGTCCACCATGAGGGAGGCGCTCTCCTTGAAGATGAGAAAGTCATTTTCCGCATGTCGGATTTCCTaGCAGGCCATCGTTTCCATG +
Preference number: 2 (lower is better)
Translates to: ILSTMREALSLKMRKSFSACRIS*QAIVSM
Trigger: CATGGAAACGATGGCCTGGCAGGAAATCCGACATGC...GGAAAATGACTTTCTCATCTTCAAGGAGAGCGCCTCCCTCATGGTGGACAGGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR-3UTR GCA 90 bp ATCTCCGCTCAAGGAAAACTGCTCCCCCAGATTCTCCCTTGCAGGGACTCTCATTGCAGAATGAAGGCATaGCTCTCACCATCCTTCTTG +
Preference number: 2 (lower is better)
Translates to: ISAQGKLLPQILPCRDSHCRMKA*LSPSFL
Trigger: CAAGAAGGATGGTGAGAGGCATGCCTTCATTCTGCA...ATGAGAGTCCCTGCAAGGGAGAATCTGGGGGAGCAGTTTTCCTTGAGCGGAGAT
51% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CCA 90 bp TTTGCTGACATGTTCCCCACCCCGCAGATGGTGTCTGTGAGCTTGGAGACATCCATATGTTCAAAGACCTaGTGCAGAGCCTTTGTGTCC +
Preference number: 2 (lower is better)
Translates to: FADMFPTPQMVSVSLETSICSKT*CRAFVS
Trigger: GGACACAAAGGCTCTGCACCAGGTCTTTGAACATAT...GGATGTCTCCAAGCTCACAGACACCATCTGCGGGGTGGGGAACATGTCAGCAAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp CAGGTCTCTTGGCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTGGATATGTTCAAAGACCTaGTGCAGAGCCTTTGTGTCC +
Preference number: 2 (lower is better)
Translates to: QVSWLLGLIVTCQGVLSWICSKT*CRAFVS
Trigger: GGACACAAAGGCTCTGCACCAGGTCTTTGAACATAT...CCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGCCAAGAGACCTG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp TTGGCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTGGTCAGAGGCAGGATCTCTCTGATATaGTCAACAGCTGTCTTGGGA +
Preference number: 2 (lower is better)
Translates to: LALGLNSDMPGCPLLVRGRISLI*STAVLG
Trigger: TCCCAAGACAGCTGTTGACCATATCAGAGAGATCCT...GCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGCCAA
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CCA 90 bp GACATCAAACCCTGGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCAGCTTGCCCACCCCGATaGCATAGATGTCCAGATAGT +
Preference number: 2 (lower is better)
Translates to: DIKPWGDHRLLNKEFFAPACPPR*HRCPDS
Trigger: ACTATCTGGACATCTATGCCATCGGGGTGGGCAAGC...TGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CAA 90 bp ATCTCAAAGCTGAAGATCCTGTCCACCATGAGGGAGGCGCTCTCCTaGAAGATGAGAAAGTCATTTTCCGACACACTCTGCGAACAGTCC +
Preference number: 2 (lower is better)
Translates to: ISKLKILSTMREALS*KMRKSFSDTLCEQS
Trigger: GGACTGTTCGCAGAGTGTGTCGGAAAATGACTTTCTCATCTTCAAGGAGAGCGCCTCCCTCATGGTGGACAGGATCTTCAGCTTTGAGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000411571.6
ENST00000482060.5
ENST00000484636.1
3UTR CAA 90 bp TCAGTCATATCCCGGGAGTTGTCGTTCAGGACAGACATGAGGACTTaGGGCTCTGAGGCAAAGGTGATAATGGCAACGCTCACATTGATC +
Preference number: 2 (lower is better)
Translates to: SVISRELSFRTDMRT*GSEAKVIMATLTLI
Trigger: GATCAATGTGAGCGTTGCCATTATCACCTTTGCCTCAGAGCCCAAAGTCCTCATGTCTGTCCTGAACGACAACTCCCGGGATATGACTGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR-3UTR GCA 90 bp ATGAGGACTTTGGGCTCTGAGGCAAAGGTGATAATGGCAACGCTCACATTGATCTTTTCCGACACACTCTaGGAACAGTCCAGGAGCAGG +
Preference number: 2 (lower is better)
Translates to: MRTLGSEAKVIMATLTLIFSDTL*EQSRSR
Trigger: CCTGCTCCTGGACTGTTCGCAGAGTGTGTCGGAAAA...GATCAATGTGAGCGTTGCCATTATCACCTTTGCCTCAGAGCCCAAAGTCCTCAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000411571.6
ENST00000482060.5
ENST00000484636.1
3UTR-3UTR GCA 90 bp TCTCTGATATGGTCAACAGCTGTCTTGGGAGAGCCACCCATATTGGACTTTCCAGGCTTAATAGTGACATaGCAGGGTGTCCTCTCCTGG +
Preference number: 2 (lower is better)
Translates to: SLIWSTAVLGEPPILDFPGLIVT*QGVLSW
Trigger: CCAGGAGAGGACACCCTGGCATGTCACTATTAAGCC...TGGAAAGTCCAATATGGGTGGCTCTCCCAAGACAGCTGTTGACCATATCAGAGA
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp ATAGAACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAACTCGAAGCTCACATTaGCACCCACGGGATAGGACC +
Preference number: 2 (lower is better)
Translates to: IELQDSLVLFGKDIKPWGTRSSH*HPRDRT
Trigger: GGTCCTATCCCGTGGGTGGCAATGTGAGCTTCGAGT...TCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGTTCTAT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CCA 90 bp GACATCAAACCCTGGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCAAATTCTTTGCCCCACTaGGATTTGGGGTCTCCCACA +
Preference number: 2 (lower is better)
Translates to: DIKPWGDHRLLNKEFFAPNSLPH*DLGSPT
Trigger: TGTGGGAGACCCCAAATCCCAGTGGGGCAAAGAATT...TGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR GCA 90 bp ACCCATATTGGACTTTCCATCTGTCAGAAGGATGATGGCATGTCGGATTTCCTGTTTTCCGACACACTCTaGGAACAGTCCAGGAGCAGG +
Preference number: 2 (lower is better)
Translates to: THIGLSICQKDDGMSDFLFSDTL*EQSRSR
Trigger: CCTGCTCCTGGACTGTTCGCAGAGTGTGTCGGAAAA...CAGGAAATCCGACATGCCATCATCCTTCTGACAGATGGAAAGTCCAATATGGGT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp GATTTAAATTATTCCACAGGGGCACCAGTATTTTTCTGCTTCACTCCTGTGGGTCAGCCTTTCCATCTTTaGTGTCGCCCAGCCCCAGCA +
Preference number: 2 (lower is better)
Translates to: DLNYSTGAPVFFCFTPVGQPFHL*CRPAPA
Trigger: TGCTGGGGCTGGGCGACAGCAAAGATGGAAAGGCTG...ACCCACAGGAGTGAAGCAGAAAAATACTGGTGCCCCTGTGGAATAATTTAAATC
49% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 1 transcripts:
ENST00000418949.6
3UTR-3UTR CCA 90 bp CTCTTGGCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTGGTCAGAAACTCCAGGATTCCCTaGTTCTTTTTGGCAAAGACA +
Preference number: 2 (lower is better)
Translates to: LLALGLNSDMPGCPLLVRNSRIP*FFLAKT
Trigger: TGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGTT...TCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGCCAAGAG
49% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp ATAGAACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAAATTCTTTGCCCCACTaGGATTTGGGGTCTCCCACA +
Preference number: 2 (lower is better)
Translates to: IELQDSLVLFGKDIKPWGNSLPH*DLGSPT
Trigger: TGTGGGAGACCCCAAATCCCAGTGGGGCAAAGAATT...TCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGTTCTAT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR CAA 90 bp TTCTGGTTGATGTTCAGGATCTCTCTGATATGGTCAACAGCTGTCTaGGGAGAGCCACCCATATTGGACTTTCCATCTGTCAGAAGGATG +
Preference number: 2 (lower is better)
Translates to: FWLMFRISLIWSTAV*GEPPILDFPSVRRM
Trigger: CATCCTTCTGACAGATGGAAAGTCCAATATGGGTGGCTCTCCCAAGACAGCTGTTGACCATATCAGAGAGATCCTGAACATCAACCAGAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR TCA 90 bp AATGAGCAGGAACACTCTGTTTGTTCAGCAGTTCATTCTCATGGTCCCTACAGGCATCTGTCAGAAGGATaGTGGCATGTCGGATTTCCT +
Preference number: 2 (lower is better)
Translates to: NEQEHSVCSAVHSHGPYRHLSEG*WHVGFP
Trigger: AGGAAATCCGACATGCCATCATCCTTCTGACAGATG...CCTGTAGGGACCATGAGAATGAACTGCTGAACAAACAGAGTGTTCCTGCTCATT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp ATAGAACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGATGCAGAATGAAGGCATaGCTCTCACCATCCTTCTTG +
Preference number: 2 (lower is better)
Translates to: IELQDSLVLFGKDIKPWGCRMKA*LSPSFL
Trigger: CAAGAAGGATGGTGAGAGGCATGCCTTCATTCTGCA...TCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGTTCTAT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CCA 90 bp GAACACTCTGTTTGTTCAGCAGTTCATTCTCATGGTCCCTACAGGTGCTGCCTTTCTCACCATCCTTCTTaGACCCTAGCTCATTCAGTT +
Preference number: 2 (lower is better)
Translates to: EHSVCSAVHSHGPYRCCLSHHPS*TLAHSV
Trigger: AACTGAATGAGCTAGGGTCCAAGAAGGATGGTGAGA...AAGGCAGCACCTGTAGGGACCATGAGAATGAACTGCTGAACAAACAGAGTGTTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR GCA 90 bp CACCAGTATTTTTCTGCTTCACTCCTGTGGGTTATCTCACTACCTTTCTGTGGAACAGTGTCCCAACAGTaGTTGTGGAATAAAAATTAT +
Preference number: 2 (lower is better)
Translates to: HQYFSASLLWVISLPFCGTVSQQ*LWNKNY
Trigger: ATAATTTTTATTCCACAAGCACTGTTGGGACACTGT...TCCACAGAAAGGTAGTGAGATAACCCACAGGAGTGAAGCAGAAAAATACTGGTG
40% GC, longest homopolymer 5 nt, total homopolymer stretches 10 nt.
Matches the following 1 transcripts:
ENST00000418949.6
3UTR TCA 72 bp CCCCGTTGCCCTGGCACTCCCGCTCCGAAGACCCCGTaGGCACAAGATTCGAGGAGCAGCGATAGCGGACCT +
Preference number: 3 (lower is better)
Translates to: PRCPGTPAPKTP*AQDSRSSDSGP
Trigger: AGGTCCGCTATCGCTGCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGCGGGAGTGCCAGGGCAACGGGG
65% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CCA 72 bp CAGATGGGCTCCGTTCCACTCCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGACCCCGTGAGCACAAGA +
Preference number: 3 (lower is better)
Translates to: QMGSVPLQTPLP*HSRSEDPVSTR
Trigger: TCTTGTGCTCACGGGGTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTGGAACGGAGCCCATCTG
65% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 72 bp ATGACCAAAGCGGAAGCCTGTCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCAGTGGCCAGCCCCATT +
Preference number: 3 (lower is better)
Translates to: MTKAEACPHCAQ*NAWVGAVASPI
Trigger: AATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGGACAGGCTTCCGCTTTGGTCAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 72 bp CAAAGCGGAAGCCTGTCCGCACTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGCCAGCCCCATTATCAC +
Preference number: 3 (lower is better)
Translates to: QSGSLSALRPVK*LGWGSGQPHYH
Trigger: GTGATAATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGGACAGGCTTCCGCTTTG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CCA 72 bp AGCCTGTCCGCACTGCGCCCAGTGAAATGCCTGGGTTaGGGCAGTGGCCAGCCCCATTATCACACACAGCTG +
Preference number: 3 (lower is better)
Translates to: SLSALRPVKCLG*GSGQPHYHTQL
Trigger: CAGCTGTGTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGGACAGGCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 72 bp GCTGTTTCTCCATCCCACATGCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGCAATATGAAGCCATCC +
Preference number: 3 (lower is better)
Translates to: AVSPSHMPLGRH*RTGEPRNMKPS
Trigger: GGATGGCTTCATATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAACAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 72 bp CCCCATTATCACACACAGCTGTTTCTCCATCCCACATaGCGTTGGGGCGACACTGACGCACAGGCGAGCCCC +
Preference number: 3 (lower is better)
Translates to: PHYHTQLFLHPT*RWGDTDAQASP
Trigger: GGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAACAGCTGTGTGTGATAATGGGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp GCATGTCGGATTTCCTGCCAGGCCATCGTTTCCATGCCGAGGAGTCGCATTTGGTGCTGTCAGGACCCATaGGTCGGAGATGAGGGCCCC +
Preference number: 3 (lower is better)
Translates to: ACRISCQAIVSMPRSRIWCCQDP*VGDEGP
Trigger: GGGGCCCTCATCTCCGACCAATGGGTCCTGACAGCA...CCAAATGCGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 72 bp ATGCCAGGGTGTCCTCTCCTGGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCAGATGGTGTCTGTGAG +
Preference number: 3 (lower is better)
Translates to: MPGCPLLVRGVC*HVPHPADGVCE
Trigger: CTCACAGACACCATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACCCTGGCAT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR TCA 72 bp TGGGGCGACACTGACGCACAGGCGAGCCCCGCAATATaGAGCCATCCTCACACTCGAAGCTCACATTGCCAC +
Preference number: 3 (lower is better)
Translates to: WGDTDAQASPAI*SHPHTRSSHCH
Trigger: GTGGCAATGTGAGCTTCGAGTGTGAGGATGGCTTCATATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp GATGATGGCATGTCGGATTTCCTGCCAGGCCATCGTTTCCATGCCGAGGAGTCGTTGCCCCACTGGGATTaGGGGTCTCCCACATTGACC +
Preference number: 3 (lower is better)
Translates to: DDGMSDFLPGHRFHAEESLPHWD*GSPTLT
Trigger: GGTCAATGTGGGAGACCCCAAATCCCAGTGGGGCAA...CGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGCCATCATC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 72 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGACCCGGATTTACTCAGC +
Preference number: 3 (lower is better)
Translates to: GRSPEDFPACVR*LWHPRDPDLLS
Trigger: GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR CCA 72 bp TATCACACACAGCTGTTTCTCCATCCCACATGCCGTTaGGGCGACACTGACGCACAGGCGAGCCCCGCAATA +
Preference number: 3 (lower is better)
Translates to: YHTQLFLHPTCR*GDTDAQASPAI
Trigger: TATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAACAGCTGTGTGTGATA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp GCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTGGTCAGAGGCGTTCCCCCGGCAGGTCTCTaGGCTCTTGGGCTTAATAGT +
Preference number: 3 (lower is better)
Translates to: ALGLNSDMPGCPLLVRGVPPAGL*ALGLNS
Trigger: ACTATTAAGCCCAAGAGCCAAGAGACCTGCCGGGGG...AACGCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR CCA 72 bp TTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTaGTCAGAGGCGTTTGCTGACATGTTCCCCACCCCG +
Preference number: 3 (lower is better)
Translates to: LGLIVTCQGVLS*SEAFADMFPTP
Trigger: CGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR GCA 72 bp TGTTCAGCAGTTCATTCTCATGGTCCCTACAGGTGCTaGCTTGAGGTCTCCGCAGAGCCAGATTGGCCTCCA +
Preference number: 3 (lower is better)
Translates to: CSAVHSHGPYRC*LEVSAEPDWPP
Trigger: TGGAGGCCAATCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAGGGACCATGAGAATGAACTGCTGAACA
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp ACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGATCATGCTGTCAGGACCCATaGGTCGGAGATGAGGGCCCC +
Preference number: 3 (lower is better)
Translates to: TPGFPGSFWQRHQTLGRSCCQDP*VGDEGP
Trigger: GGGGCCCTCATCTCCGACCAATGGGTCCTGACAGCA...TGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGT
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR GCA 72 bp CCATCTGTCAGAAGGATGATGGCATGTCGGATTTCCTaGCAGGCCATCGTTTCCATGCCGAGGAGTCGCATT +
Preference number: 3 (lower is better)
Translates to: PSVRRMMACRIS*QAIVSMPRSRI
Trigger: AATGCGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGCCATCATCCTTCTGACAGATGG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp GATGATGGCATGTCGGATTTCCTGCCAGGCCATCGTTTCCATGCCGAGGAGTCGATGGTGTCTGTGAGCTaGGAGACATCCAGCATATGT +
Preference number: 3 (lower is better)
Translates to: DDGMSDFLPGHRFHAEESMVSVS*ETSSIC
Trigger: ACATATGCTGGATGTCTCCAAGCTCACAGACACCAT...CGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGCCATCATC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp ACTCCAGGATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTGGGGAGATCATTGGGGTCTCCCACATaGACCCTCCACAGGGAGTGG +
Preference number: 3 (lower is better)
Translates to: TPGFPGSFWQRHQTLGRSLGSPT*TLHREW
Trigger: CCACTCCCTGTGGAGGGTCAATGTGGGAGACCCCAA...TGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATCCTGGAGT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CAA 90 bp CTCAATAAGGAATTCTTTGCCCCACTGGGATTTGGGGTCTCCCACATTGACCCTTTGCCCCACTGGGATTaGGGGTCTCCCACATTGACC +
Preference number: 3 (lower is better)
Translates to: LNKEFFAPLGFGVSHIDPLPHWD*GSPTLT
Trigger: GGTCAATGTGGGAGACCCCAAATCCCAGTGGGGCAA...AGGGTCAATGTGGGAGACCCCAAATCCCAGTGGGGCAAAGAATTCCTTATTGAG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR GCA 72 bp AATTCCTGGAAAGTAAGACCTCAGCCTTTCCATCTTTaGTGTCGCCCAGCCCCAGCACAGTGTCCCAACAGT +
Preference number: 3 (lower is better)
Translates to: NSWKVRPQPFHL*CRPAPAQCPNS
Trigger: ACTGTTGGGACACTGTGCTGGGGCTGGGCGACAGCAAAGATGGAAAGGCTGAGGTCTTACTTTCCAGGAATT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000418949.6
3UTR CCA 72 bp ATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCACTaGGATTTGGGGTCTCCCACATTGACCCTCCACAGG +
Preference number: 3 (lower is better)
Translates to: ITAFSIRNSLPH*DLGSPTLTLHR
Trigger: CCTGTGGAGGGTCAATGTGGGAGACCCCAAATCCCAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CAA 90 bp CGGGAGTTGTCGTTCAGGACAGACATGAGGACTTTGGGCTCTGAGGCAAAGGTGGCCGAGGAGTCGCATTaGGTTGTTCATCATGAGATA +
Preference number: 3 (lower is better)
Translates to: RELSFRTDMRTLGSEAKVAEESH*VVHHEI
Trigger: TATCTCATGATGAACAACCAAATGCGACTCCTCGGC...CACCTTTGCCTCAGAGCCCAAAGTCCTCATGTCTGTCCTGAACGACAACTCCCG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR-3UTR CAA 90 bp TTGGCTCTTGGGCTTAATAGTGACATGCCAGGGTGTCCTCTCCTGGTCAGAGGCATGGTGTCTGTGAGCTaGGAGACATCCAGCATATGT +
Preference number: 3 (lower is better)
Translates to: LALGLNSDMPGCPLLVRGMVSVS*ETSSIC
Trigger: ACATATGCTGGATGTCTCCAAGCTCACAGACACCAT...GCCTCTGACCAGGAGAGGACACCCTGGCATGTCACTATTAAGCCCAAGAGCCAA
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CAA 90 bp GCAAAGACATCAAACCCTGGGGAGATCACCGCCTTCTCAATAAGGAATTCTTTGCCTGGTCAGAGGCGTTaGCTGACATGTTCCCCACCC +
Preference number: 3 (lower is better)
Translates to: AKTSNPGEITAFSIRNSLPGQRR*LTCSPP
Trigger: GGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGG...CAAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTCTTTGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR-3UTR CAA 90 bp ATCACCGCCTTCTCAATAAGGAATTCTTTGCCCCACTGGGATTTGGGGTCTCCCCAGGTCTCTTGGCTCTaGGGCTTAATAGTGACATGC +
Preference number: 3 (lower is better)
Translates to: ITAFSIRNSLPHWDLGSPQVSWL*GLIVTC
Trigger: GCATGTCACTATTAAGCCCAAGAGCCAAGAGACCTG...GGGAGACCCCAAATCCCAGTGGGGCAAAGAATTCCTTATTGAGAAGGCGGTGAT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR TCA 72 bp TTGCTGACATGTTCCCCACCCCGCAGATGGTGTCTGTaGGCTTGGAGACATCCAGCATATGTTCAAAGACCT +
Preference number: 3 (lower is better)
Translates to: LLTCSPPRRWCL*AWRHPAYVQRP
Trigger: AGGTCTTTGAACATATGCTGGATGTCTCCAAGCTCACAGACACCATCTGCGGGGTGGGGAACATGTCAGCAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR TCA 72 bp AGCCACCCATATTGGACTTTCCATCTGTCAGAAGGATaGTGGCATGTCGGATTTCCTGCCAGGCCATCGTTT +
Preference number: 3 (lower is better)
Translates to: SHPYWTFHLSEG*WHVGFPARPSF
Trigger: AAACGATGGCCTGGCAGGAAATCCGACATGCCATCATCCTTCTGACAGATGGAAAGTCCAATATGGGTGGCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR CCA 72 bp CCACAGGGGCACCAGTATTTTTCTGCTTCACTCCTGTaGGTTATCTCACTACCTTTCTGTGGAGACCACTGT +
Preference number: 3 (lower is better)
Translates to: PQGHQYFSASLL*VISLPFCGDHC
Trigger: ACAGTGGTCTCCACAGAAAGGTAGTGAGATAACCCACAGGAGTGAAGCAGAAAAATACTGGTGCCCCTGTGG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000418949.6
3UTR-3UTR CAA 90 bp ATCCTGTCCACCATGAGGGAGGCGCTCTCCTTGAAGATGAGAAAGTCATTTTCCGCCGAGGAGTCGCATTaGGTTGTTCATCATGAGATA +
Preference number: 3 (lower is better)
Translates to: ILSTMREALSLKMRKSFSAEESH*VVHHEI
Trigger: TATCTCATGATGAACAACCAAATGCGACTCCTCGGC...GGAAAATGACTTTCTCATCTTCAAGGAGAGCGCCTCCCTCATGGTGGACAGGAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR-3UTR CAA 90 bp GCTCCCATTCAAGGCGACAAAATGAGCAGGAACACTCTGTTTGTTCAGCAGTTCCAGGTCTCTTGGCTCTaGGGCTTAATAGTGACATGC +
Preference number: 3 (lower is better)
Translates to: APIQGDKMSRNTLFVQQFQVSWL*GLIVTC
Trigger: GCATGTCACTATTAAGCCCAAGAGCCAAGAGACCTG...GAACTGCTGAACAAACAGAGTGTTCCTGCTCATTTTGTCGCCTTGAATGGGAGC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR-3UTR CAA 90 bp GTTGATGTTCAGGATCTCTCTGATATGGTCAACAGCTGTCTTGGGAGAGCCACCTCAATAAGGAATTCTTaGCCCCACTGGGATTTGGGG +
Preference number: 3 (lower is better)
Translates to: VDVQDLSDMVNSCLGRATSIRNS*PHWDLG
Trigger: CCCCAAATCCCAGTGGGGCAAAGAATTCCTTATTGA...GGTGGCTCTCCCAAGACAGCTGTTGACCATATCAGAGAGATCCTGAACATCAAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 72 bp GTTGTCGTTCAGGACAGACATGAGGACTTTGGGCTCTaGGGCAAAGGTGATAATGGCAACGCTCACATTGAT +
Preference number: 3 (lower is better)
Translates to: VVVQDRHEDFGL*GKGDNGNAHID
Trigger: ATCAATGTGAGCGTTGCCATTATCACCTTTGCCTCAGAGCCCAAAGTCCTCATGTCTGTCCTGAACGACAAC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR CCA 72 bp TTCCTCTTCTGGTTGATGTTCAGGATCTCTCTGATATaGTCAACAGCTGTCTTGGGAGAGCCACCCATATTG +
Preference number: 3 (lower is better)
Translates to: FLFWLMFRISLI*STAVLGEPPIL
Trigger: CAATATGGGTGGCTCTCCCAAGACAGCTGTTGACCATATCAGAGAGATCCTGAACATCAACCAGAAGAGGAA
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR TCA 72 bp TTTCATGATCTTTATAGTTGGCATTTTCCAGGCTGCTaGTCACCTCAGTCATATCCCGGGAGTTGTCGTTCA +
Preference number: 3 (lower is better)
Translates to: FHDLYSWHFPGC*SPQSYPGSCRS
Trigger: TGAACGACAACTCCCGGGATATGACTGAGGTGATCAGCAGCCTGGAAAATGCCAACTATAAAGATCATGAAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
3UTR CCA 72 bp GATTCCCTGGTTCTTTTTGGCAAAGACATCAAACCCTaGGGAGATCACCGCCTTCTCAATAAGGAATTCTTT +
Preference number: 3 (lower is better)
Translates to: DSLVLFGKDIKP*GDHRLLNKEFF
Trigger: AAAGAATTCCTTATTGAGAAGGCGGTGATCTCCCCAGGGTTTGATGTCTTTGCCAAAAAGAACCAGGGAATC
44% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 2 transcripts:
ENST00000482060.5
ENST00000485690.5
3UTR TCA 72 bp TTAATGTTCAGTTTGCTCCCATTCAAGGCGACAAAATaGGCAGGAACACTCTGTTTGTTCAGCAGTTCATTC +
Preference number: 3 (lower is better)
Translates to: LMFSLLPFKATK*AGTLCLFSSSF
Trigger: GAATGAACTGCTGAACAAACAGAGTGTTCCTGCTCATTTTGTCGCCTTGAATGGGAGCAAACTGAACATTAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
3UTR GCA 72 bp GATTTAAATTATTCCACAGGGGCACCAGTATTTTTCTaGTTCACTCCTGTGGGTTATCTCACTACCTTTCTG +
Preference number: 3 (lower is better)
Translates to: DLNYSTGAPVFF*FTPVGYLTTFL
Trigger: CAGAAAGGTAGTGAGATAACCCACAGGAGTGAAGCAGAAAAATACTGGTGCCCCTGTGGAATAATTTAAATC
42% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000418949.6
3UTR-3UTR CAA 90 bp GATTTAAATTATTCCACAGGGGCACCAGTATTTTTCTGCTTCACTCCTGTGGGTGTGTCCCAACAGTGCTaGTGGAATAAAAATTATGAT +
Preference number: 3 (lower is better)
Translates to: DLNYSTGAPVFFCFTPVGVSQQC*WNKNYD
Trigger: ATCATAATTTTTATTCCACAAGCACTGTTGGGACAC...ACCCACAGGAGTGAAGCAGAAAAATACTGGTGCCCCTGTGGAATAATTTAAATC
40% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 1 transcripts:
ENST00000418949.6
3UTR CAA 72 bp TGGCGGCAGATGGGCTCCGTTCCACTCCAGACCCCGTaGCCCTGGCACTCCCGCTCCGAAGACCCCGTGAGC +
Preference number: 4 (lower is better)
Translates to: WRQMGSVPLQTP*PWHSRSEDPVS
Trigger: GCTCACGGGGTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTGGAACGGAGCCCATCTGCCGCCA
69% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
68% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
67% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCTGGGTTGGGGCAGTaGCCAGCCTTCCTGCGGGAC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPGLGQ*PAFLRD
Trigger: GTCCCGCAGGAAGGCTGGCCACTGCCCCAACCCAGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000452323.6
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGACCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTGTCCTCTCCTGGTCAGAGGCGTTTGCTGACATGTTCCCCACCCCGCAGATGCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: GVLSWSEAFADMFPTPQMHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...CATCTGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGACCAGGAGAGGACACC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCAGACCGGGTGGCTCCTaGGGTCTGCCACTGTCCGCT +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAARPGGS*GLPLSA
Trigger: AGCGGACAGTGGCAGACCCCAGGAGCCACCCGGTCT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
64% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
3UTR CAA 72 bp TCTCGTGGCGGCGGGACCTTGCTACGAGGGGCCCTTTaGCGGGAGTTTTTGTCAGCAGAGCCAAGGCAGGGG +
Preference number: 4 (lower is better)
Translates to: SRGGGTLLRGAL*REFLSAEPRQG
Trigger: CCCCTGCCTTGGCTCTGCTGACAAAAACTCCCGCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCACGAGA
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAALRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGACACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCACATCCCCCAGGTGCTaGCTCAGCCAGGGCTGCATG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAATSPRC*LSQGCM
Trigger: CATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCARTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
63% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTAGACCGGGTGGCTCCTaGGGTCTGCCACTGTCCGCT +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCARPGGS*GLPLSA
Trigger: AGCGGACAGTGGCAGACCCCAGGAGCCACCCGGTCT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGGGGCAGTGGCCAGCTaGGTACAGGAACAGCAGGCA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAGAVAS*VQEQQA
Trigger: TGCCTGCTGTTCCTGTACCCAGCTGGCCACTGCCCC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000383177.7
ENST00000383359.7
ENST00000383367.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000452763.5
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
CDS-3UTR CCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACCTGGGTTGGGGCAGTaGCCAGCCTTCCTGCGGGAC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRPGLGQ*PAFLRD
Trigger: GTCCCGCAGGAAGGCTGGCCACTGCCCCAACCCAGG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000452323.6
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACAGAGACGCCACACCTaGGCCCAGGCGTGTCTCGCC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRQRRHT*AQACLA
Trigger: GGCGAGACACGCCTGGGCCCAGGTGTGGCGTCTCTG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000469372.5
ENST00000613837.3
ENST00000614291.3
ENST00000615801.3
ENST00000618948.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGCTCTTGCACAGCCGTaGTGCTGGGGATGGGTACAG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAALAQP*CWGWVQ
Trigger: CTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp ATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCACCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: ISQLVCAASGILETRIYSPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...TGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAAT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGCTCCGAAGACCCCGTaGGCACAAGATTCGAGGAGC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAAPKTP*AQDSRS
Trigger: GCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAVRGVC*HVPHPA
Trigger: TGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGAC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCTACAGGTGCTGCCTTaGGGTCTCCGCAGAGCCAGA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAALQVLP*GLRRAR
Trigger: TCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGACACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSAHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: KHESSQPGKESGDRPRSGHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGATTGGCCTCCATCGTaGAGGGAAGGCAGATGGGCC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAADWPPS*REGRWA
Trigger: GGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGGTCCCTACAGGTGCTaGCTTGAGGTCTCCGCAGAG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAGPYRC*LEVSAE
Trigger: CTCTGCGGAGACCTCAAGGCAGCACCTGTAGGGACC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTACATCCCCCAGGTGCTaGCTCAGCCAGGGCTGCATG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCATSPRC*LSQGCM
Trigger: CATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGACATCCCCCAGGTGCTaGCTCAGCCAGGGCTGCATG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWTSPRC*LSQGCM
Trigger: CATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGT...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp CGCAGAGCCAGATTGGCCTCCATCGTGCAGGGAAGGCAGATGGGCCTGGCATGGCGAGTCTGCCAGACCTaGGTACAGGAACAGCAGGCA +
Preference number: 4 (lower is better)
Translates to: RRARLASIVQGRQMGLAWRVCQT*VQEQQA
Trigger: TGCCTGCTGTTCCTGTACCCAGGTCTGGCAGACTCG...CCATGCCAGGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATCTGGCTCTGCG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR CCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAAGACCGGGTGGCTCCTaGGGTCTGCCACTGTCCGCT +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRRPGGS*GLPLSA
Trigger: AGCGGACAGTGGCAGACCCCAGGAGCCACCCGGTCT...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp GTAAGACCTCAGCCTTTCCATCTTTGCTGTCGCCCAGCCCCAGCACAGTGTCCCAGACCGGGTGGCTCCTaGGGTCTGCCACTGTCCGCT +
Preference number: 4 (lower is better)
Translates to: VRPQPFHLCCRPAPAQCPRPGGS*GLPLSA
Trigger: AGCGGACAGTGGCAGACCCCAGGAGCCACCCGGTCT...GGGACACTGTGCTGGGGCTGGGCGACAGCAAAGATGGAAAGGCTGAGGTCTTAC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000418949.6
CDS-3UTR CCA 90 bp GGGGTCTCCCACATTGACCCTCCACAGGGAGTGGTCGTTGCCATCGCGGAAGCACATCCCACATGCCGTTaGGGCGACACTGACGCACAG +
Preference number: 4 (lower is better)
Translates to: GVSHIDPPQGVVVAIAEAHPTCR*GDTDAQ
Trigger: CTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATG...TGCTTCCGCGATGGCAACGACCACTCCCTGTGGAGGGTCAATGTGGGAGACCCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCTGGGTTGGGGCAGTaGCCAGCCCCATTATCACAC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPGLGQ*PAPLSH
Trigger: GTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGACAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCAGGGTTGGCGGCAGATaGGCTCCGTTCCACTCCAGA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAARVGGR*APFHSR
Trigger: TCTGGAGTGGAACGGAGCCCATCTGCCGCCAACCCT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGTGGCCCCAAGCATGTaGGAGAAGGAAGTGCCCAGG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAVAPSM*EKEVPR
Trigger: CCTGGGCACTTCCTTCTCCCACATGCTTGGGGCCAC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCACCCTCCACAGGGAGTaGTCGTTGCCATCGCGGAAG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAATLHRE*SLPSRK
Trigger: CTTCCGCGATGGCAACGACCACTCCCTGTGGAGGGT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTGCAGGGAAGGCAGATaGGCCTGGCATGGGTGGACA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAACREGR*AWHGWT
Trigger: TGTCCACCCATGCCAGGCCCATCTGCCTTCCCTGCA...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCACCAGGGAAGGAATCTaGGGACAGGCCAAGGAGCGG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAATREGI*GQAKER
Trigger: CCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGGGGCAGTGGCCAGCTaGGTACAGGAACAGCAGGCA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAGAVAS*VQEQQA
Trigger: TGCCTGCTGTTCCTGTACCCAGCTGGCCACTGCCCC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000383177.7
ENST00000383359.7
ENST00000383367.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000452763.5
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGGGGCAGTGGCCAGCTaGGTACAGGAACAGCAGGCA +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWGAVAS*VQEQQA
Trigger: TGCCTGCTGTTCCTGTACCCAGCTGGCCACTGCCCC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
62% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 14 transcripts:
ENST00000383177.7
ENST00000383359.7
ENST00000383367.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000452763.5
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCCTGGGTTGGGGCAGTaGCCAGCTGGGTACAGGAAC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAPGLGQ*PAGYRN
Trigger: GTTCCTGTACCCAGCTGGCCACTGCCCCAACCCAGG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000383177.7
ENST00000383359.7
ENST00000383367.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000452763.5
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
CDS-3UTR CCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTCCTGGGTTGGGGCAGTaGCCAGCCTTCCTGCGGGAC +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSAPGLGQ*PAFLRD
Trigger: GTCCCGCAGGAAGGCTGGCCACTGCCCCAACCCAGG...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000452323.6
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGACAGAGACGCCACACCTaGGCCCAGGCGTGTCTCGCC +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGQRRHT*AQACLA
Trigger: GGCGAGACACGCCTGGGCCCAGGTGTGGCGTCTCTG...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 4 transcripts:
ENST00000613837.3
ENST00000614291.3
ENST00000615801.3
ENST00000618948.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGAGATATTCACGTTCTaGGGGCAGGAGGGAGCCGAG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAEIFTF*GQEGAE
Trigger: CTCGGCTCCCTCCTGCCCTCAGAACGTGAATATCTC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCTCTTGCACAGCCGTaGTGCTGGGGATGGGTACAG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAALAQP*CWGWVQ
Trigger: CTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp AGGACATCCCCCAGGTGCTGCCTCAGCCAGGGCTGCATGCGGAAGAGATTGATGGCTCTTGCACAGCCGTaGTGCTGGGGATGGGTACAG +
Preference number: 4 (lower is better)
Translates to: RTSPRCCLSQGCMRKRLMALAQP*CWGWVQ
Trigger: CTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGC...CATCAATCTCTTCCGCATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR TCA 90 bp CGGATTTACTCAGCTAGGAGAGAGGATGGATCACAGGGTCTAAGGGTGGCCATTCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: RIYSARREDGSQGLRVAIPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...AATGGCCACCCTTAGACCCTGTGATCCATCCTCTCTCCTAGCTGAGTAAATCCG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp CTAGAGACCCGGATTTACTCAGCTAGGAGAGAGGATGGATCACAGGGTCTAAGGCCGTTGGGGCGACACTaGCGCACAGGCGAGCCCCGC +
Preference number: 4 (lower is better)
Translates to: LETRIYSARREDGSQGLRPLGRH*RTGEPR
Trigger: GCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGG...CCTTAGACCCTGTGATCCATCCTCTCTCCTAGCTGAGTAAATCCGGGTCTCTAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGACCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp CAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: QLVCAASGILETRIYSARPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...CCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp TTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: FPACVRCLWHPRDPDLLSPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSAPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: KHESSQPGKESGDRPRSGPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCGGACCTTGTCCCCATaGCCAAAGCGGAAGCCTGTC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWRTLSP*PKRKPV
Trigger: GACAGGCTTCCGCTTTGGTCATGGGGACAAGGTCCG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCGGACCTTGTCCCCATaGCCAAAGCGGAAGCCTGTC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCARTLSP*PKRKPV
Trigger: GACAGGCTTCCGCTTTGGTCATGGGGACAAGGTCCG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCTCCGAAGACCCCGTaGGCACAAGATTCGAGGAGC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAAPKTP*AQDSRS
Trigger: GCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGCTCCGAAGACCCCGTaGGCACAAGATTCGAGGAGC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWAPKTP*AQDSRS
Trigger: GCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAVRGVC*HVPHPA
Trigger: TGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGAC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCATCGCGGAAGCAATaGGCTGCTGTCAGGACCCAT +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPSRKQ*AAVRTH
Trigger: ATGGGTCCTGACAGCAGCTCATTGCTTCCGCGATGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCTACAGGTGCTGCCTTaGGGTCTCCGCAGAGCCAGA +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWLQVLP*GLRRAR
Trigger: TCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCTACAGGTGCTGCCTTaGGGTCTCCGCAGAGCCAGA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCALQVLP*GLRRAR
Trigger: TCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCGGAAGAGATTGATGTaGAAGTCTCGTGGCGGCGGG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAARKRLM*KSRGGG
Trigger: CCCGCCGCCACGAGACTTTCACATCAATCTCTTCCG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGGAGGGAGCCGAGTCTaGCAGACCTGGGTACAGGAA +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWGGSRV*QTWVQE
Trigger: TTCCTGTACCCAGGTCTGGCAGACTCGGCTCCCTCC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTACTGTCCGCTGCTCTTaGACAGCCGTGATGCTGGGG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCATVRCS*TAVMLG
Trigger: CCCCAGCATCACGGCTGTGCAAGAGCAGCGGACAGT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGCCACTGTCCGCTaGTCTTGCACAGCCGTGATG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAASATVR*SCTAVM
Trigger: CATCACGGCTGTGCAAGAGCAGCGGACAGTGGCAGA...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GTAAGACCTCAGCCTTTCCATCTTTGCTGTCGCCCAGCCCCAGCACAGTGTCCCGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: VRPQPFHLCCRPAPAQCPVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...GGGACACTGTGCTGGGGCTGGGCGACAGCAAAGATGGAAAGGCTGAGGTCTTAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000418949.6
CDS-3UTR GCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp CGCAGAGCCAGATTGGCCTCCATCGTGCAGGGAAGGCAGATGGGCCTGGCATGGTTTCTCCATCCCACATaGCGTTGGGGCGACACTGAC +
Preference number: 4 (lower is better)
Translates to: RRARLASIVQGRQMGLAWFLHPT*RWGDTD
Trigger: GTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAA...CCATGCCAGGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATCTGGCTCTGCG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR GCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGACTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGAGAGAGGATGGACACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: AASGILETRIYSARREDGHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...TCCATCCTCTCTCCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: DFPACVRCLWHPRDPDLLHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...GAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGATTGGCCTCCATCGTaGAGGGAAGGCAGATGGGCC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWDWPPS*REGRWA
Trigger: GGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGATTGGCCTCCATCGTaGAGGGAAGGCAGATGGGCC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCADWPPS*REGRWA
Trigger: GGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGGTCCCTACAGGTGCTaGCTTGAGGTCTCCGCAGAG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWGPYRC*LEVSAE
Trigger: CTCTGCGGAGACCTCAAGGCAGCACCTGTAGGGACC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGGTCCCTACAGGTGCTaGCTTGAGGTCTCCGCAGAG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAGPYRC*LEVSAE
Trigger: CTCTGCGGAGACCTCAAGGCAGCACCTGTAGGGACC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCATGGTCCCTACAGGTaGTGCCTTGAGGTCTCCGCA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAHGPYR*CLEVSA
Trigger: TGCGGAGACCTCAAGGCAGCACCTGTAGGGACCATG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGAGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: FPACVRCLWHPRDPDLLSVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSAVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp CAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGGTGGCGGCGGGACCTTaGTACGAGGGGCCCTTTTGC +
Preference number: 4 (lower is better)
Translates to: QLVCAASGILETRIYSARVAAGP*YEGPFC
Trigger: GCAAAAGGGCCCCTCGTAGCAAGGTCCCGCCGCCAC...CCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAACATCCCCCAGGTGCTaGCTCAGCCAGGGCTGCATG +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRTSPRC*LSQGCM
Trigger: CATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGT...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAACATCCCCCAGGTGCTaGCTCAGCCAGGGCTGCATG +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRTSPRC*LSQGCM
Trigger: CATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGT...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp ACACACAGCTGTTTCTCCATCCCACATGCCGTTGGGGCGACACTGACGCACAGGACATCCCCCAGGTGCTaGCTCAGCCAGGGCTGCATG +
Preference number: 4 (lower is better)
Translates to: THSCFSIPHAVGATLTHRTSPRC*LSQGCM
Trigger: CATGCAGCCCTGGCTGAGGCAGCACCTGGGGGATGT...CCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAACAGCTGTGTGT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR GCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSARTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: KHESSQPGKESGDRPRSGRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: FPACVRCLWHPRDPDLLSRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGAAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp CAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGAGGACATCCCCCAGGTaGTGCCTCAGCCAGGGCTGC +
Preference number: 4 (lower is better)
Translates to: QLVCAASGILETRIYSARRTSPR*CLSQGC
Trigger: GCAGCCCTGGCTGAGGCAGCACCTGGGGGATGTCCT...CCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCAGCTTGTGTGCGCTaGCTCTGGCATCCTAGAGAC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPACVR*LWHPRD
Trigger: GTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGACTTGCTCCTCTCCTaGTACACGGGCGCCTTGGAA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAADLLLS*YTGALE
Trigger: TTCCAAGGCGCCCGTGTAGCAGGAGAGGAGCAAGTC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 5 transcripts:
ENST00000452323.6
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCTCGCCCTCGGTCCCTaGAGAACTGAGGCCAGGAAT +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWLALGP*RTEARN
Trigger: ATTCCTGGCCTCAGTTCTGCAGGGACCGAGGGCGAG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 4 transcripts:
ENST00000613837.3
ENST00000614291.3
ENST00000615801.3
ENST00000618948.4
CDS-3UTR CCA 90 bp CAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGAGACCGGGTGGCTCCTaGGGTCTGCCACTGTCCGCT +
Preference number: 4 (lower is better)
Translates to: QLVCAASGILETRIYSARRPGGS*GLPLSA
Trigger: AGCGGACAGTGGCAGACCCCAGGAGCCACCCGGTCT...CCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCCTGGGTTGGGGCAGTaGCCAGCCCCATTATCACAC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWPGLGQ*PAPLSH
Trigger: GTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCCTGGGTTGGGGCAGTaGCCAGCCCCATTATCACAC +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAPGLGQ*PAPLSH
Trigger: GTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp CCACTGGGATTTGGGGTCTCCCACATTGACCCTCCACAGGGAGTGGTCGTTGCCCCTGGGTTGGGGCAGTaGCCAGCCCCATTATCACAC +
Preference number: 4 (lower is better)
Translates to: PLGFGVSHIDPPQGVVVAPGLGQ*PAPLSH
Trigger: GTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGG...GGCAACGACCACTCCCTGTGGAGGGTCAATGTGGGAGACCCCAAATCCCAGTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR CCA 90 bp CCACTGGGATTTGGGGTCTCCCACATTGACCCTCCACAGGGAGTGGTCGTTGCCGTGAAATGCCTGGGTTaGGGCAGTGGCCAGCCCCAT +
Preference number: 4 (lower is better)
Translates to: PLGFGVSHIDPPQGVVVAVKCLG*GSGQPH
Trigger: ATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCAC...GGCAACGACCACTCCCTGTGGAGGGTCAATGTGGGAGACCCCAAATCCCAGTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGTGAAATGCCTGGGTTaGGGCAGTGGCCAGCCCCAT +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAVKCLG*GSGQPH
Trigger: ATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCAC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR CCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSAQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp TTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: FPACVRCLWHPRDPDLLSQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGCAGACCCCGTTGCCCTaGCACTCCCGCTCCGAAGAC +
Preference number: 4 (lower is better)
Translates to: KHESSQPGKESGDRPRSGQTPLP*HSRSED
Trigger: GTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTG...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGAGGGTTGGCGGCAGATaGGCTCCGTTCCACTCCAGA +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWRVGGR*APFHSR
Trigger: TCTGGAGTGGAACGGAGCCCATCTGCCGCCAACCCT...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTAGGGTTGGCGGCAGATaGGCTCCGTTCCACTCCAGA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCARVGGR*APFHSR
Trigger: TCTGGAGTGGAACGGAGCCCATCTGCCGCCAACCCT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGGTGGCCCCAAGCATGTaGGAGAAGGAAGTGCCCAGG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWVAPSM*EKEVPR
Trigger: CCTGGGCACTTCCTTCTCCCACATGCTTGGGGCCAC...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGTGGCCCCAAGCATGTaGGAGAAGGAAGTGCCCAGG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAVAPSM*EKEVPR
Trigger: CCTGGGCACTTCCTTCTCCCACATGCTTGGGGCCAC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTTCTGGGTGGGATTaGTGGCCCCAAGCATGTGGG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAASSGWD*WPQACG
Trigger: CCCACATGCTTGGGGCCACCAATCCCACCCAGAAGA...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 32 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000615380.4
ENST00000618254.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GGGGTCTCCCACATTGACCCTCCACAGGGAGTGGTCGTTGCCATCGCGGAAGCATCTTCTGGGTGGGATTaGTGGCCCCAAGCATGTGGG +
Preference number: 4 (lower is better)
Translates to: GVSHIDPPQGVVVAIAEASSGWD*WPQACG
Trigger: CCCACATGCTTGGGGCCACCAATCCCACCCAGAAGA...TGCTTCCGCGATGGCAACGACCACTCCCTGTGGAGGGTCAATGTGGGAGACCCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCAGGGTGTCCTCTCCTaGTCAGAGGCGTTTGCTGAC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAQGVLS*SEAFAD
Trigger: GTCAGCAAACGCCTCTGACCAGGAGAGGACACCCTG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGACCCTCCACAGGGAGTaGTCGTTGCCATCGCGGAAG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWTLHRE*SLPSRK
Trigger: CTTCCGCGATGGCAACGACCACTCCCTGTGGAGGGT...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTACCCTCCACAGGGAGTaGTCGTTGCCATCGCGGAAG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCATLHRE*SLPSRK
Trigger: CTTCCGCGATGGCAACGACCACTCCCTGTGGAGGGT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTTGCAGGGAAGGCAGATaGGCCTGGCATGGGTGGACA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCACREGR*AWHGWT
Trigger: TGTCCACCCATGCCAGGCCCATCTGCCTTCCCTGCA...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGTGCAGGGAAGGCAGATaGGCCTGGCATGGGTGGACA +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWCREGR*AWHGWT
Trigger: TGTCCACCCATGCCAGGCCCATCTGCCTTCCCTGCA...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCCGCAGAGCCAGATTaGCCTCCATCGTGCAGGGAA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAASAEPD*PPSCRE
Trigger: TTCCCTGCACGATGGAGGCCAATCTGGCTCTGCGGA...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGATGTGAAAGTCTCGTaGCGGCGGGACCTTGCTACG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAADVKVS*RRDLAT
Trigger: CGTAGCAAGGTCCCGCCGCCACGAGACTTTCACATC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTACCAGGGAAGGAATCTaGGGACAGGCCAAGGAGCGG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCATREGI*GQAKER
Trigger: CCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGT...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGACCAGGGAAGGAATCTaGGGACAGGCCAAGGAGCGG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWTREGI*GQAKER
Trigger: CCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGT...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCCTGGGTTGGGGCAGTaGCCAGCTAAAACCAGATGG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAPGLGQ*PAKTRW
Trigger: CCATCTGGTTTTAGCTGGCCACTGCCCCAACCCAGG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 4 transcripts:
ENST00000613837.3
ENST00000614291.3
ENST00000615801.3
ENST00000618948.4
CDS-3UTR CCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGAAGATGGCGGCAGATaGGCTCCGTTCCACTCCAGA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAEDGGR*APFHSR
Trigger: TCTGGAGTGGAACGGAGCCCATCTGCCGCCATCTTC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000548250.5
ENST00000548500.4
ENST00000613837.3
ENST00000614291.3
ENST00000615801.3
ENST00000618948.4
CDS-3UTR CCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGAAAGGAGACAGGGGCTaGACAGCGCACAGCCTGAGC +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWKGDRG*TAHSLS
Trigger: GCTCAGGCTGTGCGCTGTCCAGCCCCTGTCTCCTTT...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000547984.3
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
3UTR CAA 72 bp AAGCCTGTCCGCACTGCGCCCAGTGAAATGCCTGGGTaGGGGCAGTGGCCAGCCCCATTATCACACACAGCT +
Preference number: 4 (lower is better)
Translates to: KPVRTAPSEMPG*GQWPAPLSHTA
Trigger: AGCTGTGTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGGACAGGCTT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000482060.5
CDS-3UTR TCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAGCTCTTGCACAGCCGTaGTGCTGGGGATGGGTACAG +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRALAQP*CWGWVQ
Trigger: CTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGC...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGCTCTTGCACAGCCGTaGTGCTGGGGATGGGTACAG +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRALAQP*CWGWVQ
Trigger: CTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGC...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCGAGCCCCGCAATATaGAGCCATCCTCACACTCGA +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAASPAI*SHPHTR
Trigger: TCGAGTGTGAGGATGGCTTCATATTGCGGGGCTCGC...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR TCA 90 bp GATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: DFPACVRCLWHPRDPDLLPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...GAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp TTCCTGGAAAGTAAGACCTCAGCCTTTCCATCTTTGCTGTCGCCCAGCCCCAGCCCGCACTGCGCCCAGTaGAATGCCTGGGTTGGGGCA +
Preference number: 4 (lower is better)
Translates to: FLESKTSAFPSLLSPSPSPHCAQ*NAWVGA
Trigger: TGCCCCAACCCAGGCATTTCACTGGGCGCAGTGCGG...GCTGGGGCTGGGCGACAGCAAAGATGGAAAGGCTGAGGTCTTACTTTCCAGGAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000418949.6
CDS-3UTR TCA 90 bp GTAAGACCTCAGCCTTTCCATCTTTGCTGTCGCCCAGCCCCAGCACAGTGTCCCCGGACCTTGTCCCCATaGCCAAAGCGGAAGCCTGTC +
Preference number: 4 (lower is better)
Translates to: VRPQPFHLCCRPAPAQCPRTLSP*PKRKPV
Trigger: GACAGGCTTCCGCTTTGGTCATGGGGACAAGGTCCG...GGGACACTGTGCTGGGGCTGGGCGACAGCAAAGATGGAAAGGCTGAGGTCTTAC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 1 transcripts:
ENST00000418949.6
CDS-3UTR TCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGACGGACCTTGTCCCCATaGCCAAAGCGGAAGCCTGTC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRRTLSP*PKRKPV
Trigger: GACAGGCTTCCGCTTTGGTCATGGGGACAAGGTCCG...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGACGGACCTTGTCCCCATaGCCAAAGCGGAAGCCTGTC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRRTLSP*PKRKPV
Trigger: GACAGGCTTCCGCTTTGGTCATGGGGACAAGGTCCG...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAGCTCCGAAGACCCCGTaGGCACAAGATTCGAGGAGC +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRAPKTP*AQDSRS
Trigger: GCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGC...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGCTCCGAAGACCCCGTaGGCACAAGATTCGAGGAGC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRAPKTP*AQDSRS
Trigger: GCTCCTCGAATCTTGTGCTCACGGGGTCTTCGGAGC...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCGTTCAGGACAGACATaGGGACTTTGGGCTCTGAGG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAARSGQT*GLWALR
Trigger: CCTCAGAGCCCAAAGTCCTCATGTCTGTCCTGAACG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 26 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000442278.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000613837.3
ENST00000614291.3
ENST00000615801.3
ENST00000618948.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCGCAGATGGTGTCTGTaGGCTTGGAGACATCCAGCA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAARRWCL*AWRHPA
Trigger: TGCTGGATGTCTCCAAGCTCACAGACACCATCTGCG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp TGGCCATTCAGAGGTAGAAGATGGAGGGGCGGCAGATTCTGGCAGGGCAGCAGAGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCA +
Preference number: 4 (lower is better)
Translates to: WPFRGRRWRGGRFWQGSRVRGVC*HVPHPA
Trigger: TGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGAC...TCTGCTGCCCTGCCAGAATCTGCCGCCCCTCCATCTTCTACCTCTGAATGGCCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGTCAGAGGCGTTTGCTaGCATGTTCCCCACCCCGCA +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRVRGVC*HVPHPA
Trigger: TGCGGGGTGGGGAACATGTCAGCAAACGCCTCTGAC...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCCATCGCGGAAGCAATaGGCTGCTGTCAGGACCCAT +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWPSRKQ*AAVRTH
Trigger: ATGGGTCCTGACAGCAGCTCATTGCTTCCGCGATGG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCCATCGCGGAAGCAATaGGCTGCTGTCAGGACCCAT +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCAPSRKQ*AAVRTH
Trigger: ATGGGTCCTGACAGCAGCTCATTGCTTCCGCGATGG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGACTACAGGTGCTGCCTTaGGGTCTCCGCAGAGCCAGA +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRLQVLP*GLRRAR
Trigger: TCTGGCTCTGCGGAGACCTCAAGGCAGCACCTGTAG...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCCTGTCACCACCTCCCTaGCATCTGTCAAGTTGGGGA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAALSPPP*HLSSWG
Trigger: TCCCCAACTTGACAGATGTCAGGGAGGTGGTGACAG...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGCGAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTCGGAAGAGATTGATGTaGAAGTCTCGTGGCGGCGGG +
Preference number: 4 (lower is better)
Translates to: SEAVLLVGALRISQLVCARKRLM*KSRGGG
Trigger: CCCGCCGCCACGAGACTTTCACATCAATCTCTTCCG...AGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTCGCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR TCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCGGAAGAGATTGATGTaGAAGTCTCGTGGCGGCGGG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWRKRLM*KSRGGG
Trigger: CCCGCCGCCACGAGACTTTCACATCAATCTCTTCCG...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAACTGTCCGCTGCTCTTaGACAGCCGTGATGCTGGGG +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRTVRCS*TAVMLG
Trigger: CCCCAGCATCACGGCTGTGCAAGAGCAGCGGACAGT...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp AGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGTCTGCCACTGTCCGCTaGTCTTGCACAGCCGTGATG +
Preference number: 4 (lower is better)
Translates to: SPAGRSPEDFPACVRCLWSATVR*SCTAVM
Trigger: CATCACGGCTGTGCAAGAGCAGCGGACAGTGGCAGA...CCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp AGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGAGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: SMSQVNQGRNLGTGQGAGVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...TCCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: KHESSQPGKESGDRPRSGVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTGTGGCTCCTGGGGTCTaGCACTGTCCGCTGCTCTTG +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSAVAPGV*HCPLLL
Trigger: CAAGAGCAGCGGACAGTGGCAGACCCCAGGAGCCAC...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTTTCTCCATCCCACATaGCGTTGGGGCGACACTGAC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAFLHPT*RWGDTD
Trigger: GTCAGTGTCGCCCCAACGGCATGTGGGATGGAGAAA...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383362.8
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000448206.6
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000552638.3
CDS-3UTR GCA 90 bp GCATGTCGGATTTCCTGCCAGGCCATCGTTTCCATGCCGAGGAGTCGCATTTGGCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: ACRISCQAIVSMPRSRIWLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...CCAAATGCGACTCCTCGGCATGGAAACGATGGCCTGGCAGGAAATCCGACATGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000411571.6
ENST00000482060.5
CDS-3UTR GCA 90 bp TCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: SQLVCAASGILETRIYSALRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...AGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: FPACVRCLWHPRDPDLLSLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...GCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp AAGCATGAGTCAAGTCAACCAGGGAAGGAATCTGGGGACAGGCCAAGGAGCGGGCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: KHESSQPGKESGDRPRSGLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...CCCGCTCCTTGGCCTGTCCCCAGATTCCTTCCCTGGTTGACTTGACTCATGCTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp CAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCAGCTAGGCTGCGCCCAGTGAAATaGCTGGGTTGGGGCAGTGGC +
Preference number: 4 (lower is better)
Translates to: QLVCAASGILETRIYSARLRPVK*LGWGSG
Trigger: GCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAG...CCTAGCTGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp TACTCAGCTAGGAGAGAGGATGGATCACAGGGTCTAAGGGTGGCCATTCAGAGGCACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: YSARREDGSQGLRVAIQRHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...CCTCTGAATGGCCACCCTTAGACCCTGTGATCCATCCTCTCTCCTAGCTGAGTA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp ATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGACCCGGATTTACTCACACTCCAGACCCCGTTaGCCTGGCACTCCCGCTCCG +
Preference number: 4 (lower is better)
Translates to: ISQLVCAASGILETRIYSHSRPR*PGTPAP
Trigger: CGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTG...TGAGTAAATCCGGGTCTCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAAT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 39 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000469372.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCAGTCCACATCCAGCTTaGCCACCCCGATGGCATAGA +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAASPHPA*PPRWHR
Trigger: TCTATGCCATCGGGGTGGGCAAGCTGGATGTGGACT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCGCGGAAGCAATGAGCTaGTGTCAGGACCCATTGGTC +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAAAEAMS*CQDPLV
Trigger: GACCAATGGGTCCTGACAGCAGCTCATTGCTTCCGC...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GAGGCAGTCCTGCTGGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCACAGGGAGTGGTCGTTaGCATCGCGGAAGCAATGAG +
Preference number: 4 (lower is better)
Translates to: EAVLLVGALRISQLVCAATGSGR*HRGSNE
Trigger: CTCATTGCTTCCGCGATGGCAACGACCACTCCCTGT...GGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACCAGCAGGACTGCCTC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6
ENST00000411803.6
ENST00000413548.6
ENST00000416252.6
ENST00000419062.5
ENST00000423826.5
ENST00000428140.5
ENST00000442278.6
ENST00000448206.6
ENST00000452323.6
ENST00000452763.5
ENST00000547984.3
ENST00000548250.5
ENST00000548500.4
ENST00000548828.4
ENST00000548973.5
ENST00000548995.3
ENST00000549972.3
ENST00000549997.5
ENST00000550045.5
ENST00000550363.4
ENST00000550682.5
ENST00000551081.4
ENST00000551648.5
ENST00000552638.3
ENST00000612228.1
ENST00000613837.3
ENST00000614291.3
ENST00000615380.4
ENST00000615801.3
ENST00000618254.4
ENST00000618948.4
ENST00000621558.4
CDS-3UTR GCA 90 bp GGTAGGAGCCCTGAGGATTTCCCAGCTTGTGTGCGCTGCCTCTGGCATCCTAGAGATTGGCCTCCATCGTaGAGGGAAGGCAGATGGGCC +
Preference number: 4 (lower is better)
Translates to: GRSPEDFPACVRCLWHPRDWPPS*REGRWA
Trigger: GGCCCATCTGCCTTCCCTGCACGATGGAGGCCAATC...TCTAGGATGCCAGAGGCAGCGCACACAAGCTGGGAAATCCTCAGGGCTCCTACC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 38 transcripts:
ENST00000299367.10
ENST00000375510.8
ENST00000383177.7
ENST00000383359.7
ENST00000383362.8
ENST00000383367.6