RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ABCF1 (Homo sapiens)

Ensembl gene IDs: ENSG00000204574, ENSG00000206490, ENSG00000236149

Ensembl transcript IDs: ENST00000326195.13, ENST00000376545.7, ENST00000383587.8, ENST00000383588.8, ENST00000400609.3, ENST00000412443.6, ENST00000416932.2, ENST00000418552.5, ENST00000419893.6, ENST00000420257.6, ENST00000421042.6, ENST00000421608.2, ENST00000423030.5, ENST00000423247.6, ENST00000424994.5, ENST00000426219.6, ENST00000426591.5, ENST00000429395.5, ENST00000441688.5, ENST00000441867.6, ENST00000448939.6, ENST00000452530.6, ENST00000454094.2, ENST00000456791.2, ENST00000457078.6, ENST00000457111.6, ENST00000457970.2, ENST00000461877.1, ENST00000470464.5, ENST00000472245.5, ENST00000475528.1, ENST00000475993.1, ENST00000479321.5, ENST00000479542.1, ENST00000485585.5, ENST00000486105.1, ENST00000490343.1, ENST00000491571.5, ENST00000494321.1, ENST00000494413.1, ENST00000495194.5, ENST00000542772.1

Found 2111 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp CCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTaGCAGGTCAGCTGCAGGCCAGAGGCAGTCTTCAGAGGAGGGGAG +
Preference number: 1 (lower is better)
Translates to: PVTSRSHSTFMCLNG*QVSCRPEAVFRGGE
Trigger: CTCCCCTCCTCTGAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR TCA 90 bp GTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTaGATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCAGTCTTCAGAG +
Preference number: 1 (lower is better)
Translates to: VGSRSHQGHTPPSCA*MVARSAAGQRQSSE
Trigger: CTCTGAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR GCA 90 bp CAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCAGTCTTC +
Preference number: 1 (lower is better)
Translates to: QSGIPVTSRSHSTFM*LNGCQVSCRPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR GCA 90 bp AGCAGCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTaGAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAA +
Preference number: 1 (lower is better)
Translates to: SSIPFLPQVLNQTRG*RHQILGWIMAKASE
Trigger: TTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGCTGCT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR GCA 90 bp CTTCCCCTTGTAAAGGGAAATTCAAGTTCAGCAGCATTCCTTTCCTaGCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCT +
Preference number: 1 (lower is better)
Translates to: LPLVKGNSSSAAFLS*PKSSTRQEAAGTKS
Trigger: AGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGCTGCTGAACTTGAATTTCCCTTTACAAGGGGAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR TCA 90 bp TTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGTACCAGTGAGTCAGCATTAAATCCA +
Preference number: 1 (lower is better)
Translates to: LGWIMAKASEAHLQL*ASTAVCTSESALNP
Trigger: TGGATTTAATGCTGACTCACTGGTACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR TCA 90 bp AGAAGCTCACCTCCAGCTCTGAGCTTCAACAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACCAGAAAAGAACAGCACCACCCAAAG +
Preference number: 1 (lower is better)
Translates to: RSSPPALSFNSCLYQ*VSIKSTRKEQHHPK
Trigger: CTTTGGGTGGTGCTGTTCTTTTCTGGTGGATTTAATGCTGACTCACTGGTACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR TCA 90 bp AAGACTCCGTCTCCAGCTCTGAGCTTCAACAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACCAGAAAAGAACAGCACCACCCAAAG +
Preference number: 1 (lower is better)
Translates to: KTPSPALSFNSCLYQ*VSIKSTRKEQHHPK
Trigger: CTTTGGGTGGTGCTGTTCTTTTCTGGTGGATTTAATGCTGACTCACTGGTACAAACAGCTGTTGAAGCTCAGAGCTGGAGACGGAGTCTT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000475993.1
3UTR CCA 90 bp GAAGCAGAACAAACAAGTCTTTCAGAGAAATGGATGCAATCAGAGTaGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCT +
Preference number: 1 (lower is better)
Translates to: EAEQTSLSEKWMQSE*DPGHIKVTLHLHVP
Trigger: AGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAAAGACTTGTTTGTTCTGCTTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR CCA 90 bp AGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGGCTGGATaGAACCTCACAATAAGGTGGTCACCTCTTGTTTGTTTAGGGGGA +
Preference number: 1 (lower is better)
Translates to: SDESPETIGHINLAG*NLTIRWSPLVCLGG
Trigger: TCCCCCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 2 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 2 (lower is better)
Translates to: GCRHQILGWIMAKASEAHGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 2 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
58% GC, longest homopolymer 7 nt, total homopolymer stretches 11 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GTAATCCCAACACTCTGGGAGGCCGAGGCGGGCAAATCCCAAGGTCAGGAGATGAGGCAGAGGTTGCAGTaGGCCGAGATAACGCTACTG +
Preference number: 2 (lower is better)
Translates to: VIPTLWEAEAGKSQGQEMRQRLQ*AEITLL
Trigger: CAGTAGCGTTATCTCGGCTCACTGCAACCTCTGCCT...CATCTCCTGACCTTGGGATTTGCCCGCCTCGGCCTCCCAGAGTGTTGGGATTAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000475993.1
3UTR-3UTR TCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTCCACCTTCATGTGCCTaGATGGTTGCCAGGTCAGCT +
Preference number: 2 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAPPSCA*MVARSA
Trigger: AGCTGACCTGGCAACCATTCAGGCACATGAAGGTGG...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCCCACCTTCATGTGCCTaGATGGTTGCCAGGTCAGCT +
Preference number: 2 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGPPSCA*MVARSA
Trigger: AGCTGACCTGGCAACCATTCAGGCACATGAAGGTGG...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 2 (lower is better)
Translates to: CRHQILGWIMAKASEAHLGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 2 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 2 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 2 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTCAGAGGCAGGCTTCTaGGTGATGAGAGTCCTGAGA +
Preference number: 2 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGSEAGF*VMRVLR
Trigger: TCTCAGGACTCTCATCACTCAGAAGCCTGCCTCTGA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGT +
Preference number: 2 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAAHLQL*ASTAVC
Trigger: ACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp GATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTGAGCTTCAACAGCTGTGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 2 (lower is better)
Translates to: DNGKGLRSSPPALSFNSCGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...ACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATC
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp ATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCAGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 2 (lower is better)
Translates to: MDAIRVGSRSHQGHTPPSGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...TGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCAT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR GCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCAGAGGCAGGCTTCTaGGTGATGAGAGTCCTGAGA +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKSEAGF*VMRVLR
Trigger: TCTCAGGACTCTCATCACTCAGAAGCCTGCCTCTGA...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGT +
Preference number: 2 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGAHLQL*ASTAVC
Trigger: ACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGC...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: GCRHQILGWIMAKASEAHHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGCTTCATGTGCCTGAATaGTTGCCAGGTCAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWLHVPE*LPGQLQ
Trigger: CTGCAGCTGACCTGGCAACCATTCAGGCACATGAAG...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCATCAGAGGCAGGCTTCTaGGTGATGAGAGTCCTGAGA +
Preference number: 2 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPSEAGF*VMRVLR
Trigger: TCTCAGGACTCTCATCACTCAGAAGCCTGCCTCTGA...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp AGTCTTTCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 2 (lower is better)
Translates to: SLSEKWMQSEWDPGHIKVGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...GACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR GCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: RHQILGWIMAKASEAHLQHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTTCATGTGCCTGAATaGTTGCCAGGTCAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: RHQILGWIMAKASEAHLQLHVPE*LPGQLQ
Trigger: CTGCAGCTGACCTGGCAACCATTCAGGCACATGAAG...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTGAGCTTCAACAGCTGTTCAGAGGCAGGCTTCTaGGTGATGAGAGTCCTGAGA +
Preference number: 2 (lower is better)
Translates to: DNGKGLRSSPPALSFNSCSEAGF*VMRVLR
Trigger: TCTCAGGACTCTCATCACTCAGAAGCCTGCCTCTGA...ACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AAGGTGGTCACCTCTTGTTTGTTTAGGGGGATGCCAAGGATAAGGCCAGCTCAGCTTCATGTGCCTGAATaGTTGCCAGGTCAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: KVVTSCLFRGMPRIRPAQLHVPE*LPGQLQ
Trigger: CTGCAGCTGACCTGGCAACCATTCAGGCACATGAAG...CTGAGCTGGCCTTATCCTTGGCATCCCCCTAAACAAACAAGAGGTGACCACCTT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTTGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: GCRHQILGWIMAKASEAHSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGT +
Preference number: 2 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATAHLQL*ASTAVC
Trigger: ACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGC...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTGCAGCATTCCTTTCCTaGCCCAAGTCCTCAACCAGA +
Preference number: 2 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATAAFLS*PKSSTR
Trigger: TCTGGTTGAGGACTTGGGGCAGGAAAGGAATGCTGC...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: GCRHQILGWIMAKASEAHASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: RHQILGWIMAKASEAHLQSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp AGGCCACATAAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: RPHKLGWMEPHNKVVTSCHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...ACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR GCA 90 bp AGTCTTTCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: SLSEKWMQSEWDPGHIKVHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...GACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp AGGCCACATAAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTCTTCATGTGCCTGAATaGTTGCCAGGTCAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: RPHKLGWMEPHNKVVTSCLHVPE*LPGQLQ
Trigger: CTGCAGCTGACCTGGCAACCATTCAGGCACATGAAG...ACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGCCACATAAACTTGGCTaGATGGAACCTCACAATAAG +
Preference number: 2 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWPHKLG*MEPHNK
Trigger: CTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGG...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAACCACATAAACTTGGCTaGATGGAACCTCACAATAAG +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKPHKLG*MEPHNK
Trigger: CTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGG...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp AAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTTGTTTAGGCCACCTTCATGTGCCTaGATGGTTGCCAGGTCAGCT +
Preference number: 2 (lower is better)
Translates to: KLGWMEPHNKVVTSCLFRPPSCA*MVARSA
Trigger: AGCTGACCTGGCAACCATTCAGGCACATGAAGGTGG...CCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp AACAAGTCTTTCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAACCACCTTCATGTGCCTaGATGGTTGCCAGGTCAGCT +
Preference number: 2 (lower is better)
Translates to: NKSFREMDAIRVGSRSHQPPSCA*MVARSA
Trigger: AGCTGACCTGGCAACCATTCAGGCACATGAAGGTGG...TTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAAAGACTTGTT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCAGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAAGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGT +
Preference number: 2 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKAHLQL*ASTAVC
Trigger: ACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGC...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp GGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGTTCAGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 2 (lower is better)
Translates to: GSNSFPLFLPLVKGNSSSGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...TGAACTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGAGGCAGGCTTCTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGTGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: RGRLLSDESPETIGHINLWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...CAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAGAAGCCTGCCTCT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCCACATAAACTTGGCTaGATGGAACCTCACAATAAG +
Preference number: 2 (lower is better)
Translates to: CRHQILGWIMAKASEAHLPHKLG*MEPHNK
Trigger: CTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGG...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCACATAAACTTGGCTaGATGGAACCTCACAATAAG +
Preference number: 2 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSPHKLG*MEPHNK
Trigger: CTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGG...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp ACCTCTTGTTTGTTTAGGGGGATGCCAAGGATAAGGCCAGCTCAGTTATATGAACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: TSCLFRGMPRIRPAQLYEHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...TTCATATAACTGAGCTGGCCTTATCCTTGGCATCCCCCTAAACAAACAAGAGGT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR GCA 90 bp GGGATGCCAAGGATAAGGCCAGCTCAGTTATATGAAGAGAAGCAGAACAAACAACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: GMPRIRPAQLYEEKQNKQHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...TTGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGCCTTATCCTTGGCATCCC
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR GCA 90 bp GGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: GRQQLLSFISSPCKGKFKHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...CTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp AACAAGTCTTTCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 2 (lower is better)
Translates to: NKSFREMDAIRVGSRSHQHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...TTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAAAGACTTGTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR GCA 90 bp CAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAACCAGACAAGAGGCTaGAGGCACCAAATCTTGGGC +
Preference number: 2 (lower is better)
Translates to: QVGSNSFPLFLPLVKGNSNQTRG*RHQILG
Trigger: GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTT...TGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR GCA 90 bp ACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAACCAGACAAGAGGCTaGAGGCACCAAATCTTGGGC +
Preference number: 2 (lower is better)
Translates to: TGRQQLLSFISSPCKGKFNQTRG*RHQILG
Trigger: GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTT...GAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGT
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AACAAGTCTTTCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAACTTCATGTGCCTGAATaGTTGCCAGGTCAGCTGCAG +
Preference number: 2 (lower is better)
Translates to: NKSFREMDAIRVGSRSHQLHVPE*LPGQLQ
Trigger: CTGCAGCTGACCTGGCAACCATTCAGGCACATGAAG...TTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAAAGACTTGTT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp ATAGGCCACATAAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTTGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: IGHINLAGWNLTIRWSPLWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...AAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: CRHQILGWIMAKASEAHLSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR CAA 90 bp AGGCTTCTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTaGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTTGT +
Preference number: 2 (lower is better)
Translates to: RLLSDESPETIGHIN*AGWNLTIRWSPLVC
Trigger: ACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAGAAGCCT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp ATAAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTTGTTTACCACCTTCATGTGCCTaGATGGTTGCCAGGTCAGCT +
Preference number: 2 (lower is better)
Translates to: INLAGWNLTIRWSPLVCLPPSCA*MVARSA
Trigger: AGCTGACCTGGCAACCATTCAGGCACATGAAGGTGG...TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTAT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp AAGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACTCAGAGGCAGGCTTCTaGGTGATGAGAGTCCTGAGA +
Preference number: 2 (lower is better)
Translates to: KQIKTENSSNSHQSPNSDSEAGF*VMRVLR
Trigger: TCTCAGGACTCTCATCACTCAGAAGCCTGCCTCTGA...GTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTTGTTTAGGTGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: KLGWMEPHNKVVTSCLFRWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...CCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp ACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCTGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: TGRQQLLSFISSPCKGKFWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...GAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AAGGTGGTCACCTCTTGTTTGTTTAGGGGGATGCCAAGGATAAGGCCAGCTCAGAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: KVVTSCLFRGMPRIRPAQSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...CTGAGCTGGCCTTATCCTTGGCATCCCCCTAAACAAACAAGAGGTGACCACCTT
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: RHQILGWIMAKASEAHLQNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCAAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTCCACATAAACTTGGCTaGATGGAACCTCACAATAAG +
Preference number: 2 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATPHKLG*MEPHNK
Trigger: CTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGG...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAACACCAAATCTTGGGCTaGATAATGGCAAAGGCCTCA +
Preference number: 2 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKHQILG*IMAKAS
Trigger: TGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTG...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR CAA 90 bp AAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGGATAAGGCCAGCTCAGTTATATGAA +
Preference number: 2 (lower is better)
Translates to: KLGWMEPHNKVVTSC*FRGMPRIRPAQLYE
Trigger: TTCATATAACTGAGCTGGCCTTATCCTTGGCATCCCCCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp GATGAGAGTCCTGAGACAATAGGCCACATAAACTTGGCTGGATGGAACCTCACAGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: DESPETIGHINLAGWNLTASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAAAGCTGTTTGTACCAGTaGGTCAGCATTAAATCCACC +
Preference number: 2 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKSCLYQ*VSIKST
Trigger: GGTGGATTTAATGCTGACTCACTGGTACAAACAGCT...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACATGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: SKSRLRTVPTPINLQTVTWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...TGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCT
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTGAGCTTCAACAGCTGTAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: DNGKGLRSSPPALSFNSCNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...ACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATC
46% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAAGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp AACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTTGTTTAGGGGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: NLAGWNLTIRWSPLVCLGASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...CCCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp GGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGTTCATGGATGCAATCAGAGTaGGATCCCGGTCACATCAAG +
Preference number: 2 (lower is better)
Translates to: GSNSFPLFLPLVKGNSSSWMQSE*DPGHIK
Trigger: CTTGATGTGACCGGGATCCCACTCTGATTGCATCCA...TGAACTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGAGGCAGGCTTCTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: RGRLLSDESPETIGHINLSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...CAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAGAAGCCTGCCTCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp AGGCCACATAAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: RPHKLGWMEPHNKVVTSCSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...ACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp GATGAGAGTCCTGAGACAATAGGCCACATAAACTTGGCTGGATGGAACCTCACAAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: DESPETIGHINLAGWNLTSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACACACCAAATCTTGGGCTaGATAATGGCAAAGGCCTCA +
Preference number: 2 (lower is better)
Translates to: SKSRLRTVPTPINLQTVTHQILG*IMAKAS
Trigger: TGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTG...TGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR TCA 90 bp AAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTTGTTTAGGGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: KLGWMEPHNKVVTSCLFRASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...CCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR TCA 90 bp GGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGGCCAGCTCAGTTATATaGAGAGAAGCAGAACAAACA +
Preference number: 2 (lower is better)
Translates to: GRQQLLSFISSPCKGKFKASSVI*REAEQT
Trigger: TGTTTGTTCTGCTTCTCTTCATATAACTGAGCTGGC...CTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGGGGGATGCCAAGGATAAGGCCAGCTCAGTTATATGAAGAGAAGCAGAACAAAAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: RGMPRIRPAQLYEEKQNKSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...TTTGTTCTGCTTCTCTTCATATAACTGAGCTGGCCTTATCCTTGGCATCCCCCT
43% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp AGAGGCAGGCTTCTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: RGRLLSDESPETIGHINLNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...CAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAGAAGCCTGCCTCT
43% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CCA 90 bp GGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGCCACATAAACTTGGCTaGATGGAACCTCACAATAAG +
Preference number: 2 (lower is better)
Translates to: GRQQLLSFISSPCKGKFKPHKLG*MEPHNK
Trigger: CTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGG...CTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp GGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGTTCACACCAAATCTTGGGCTaGATAATGGCAAAGGCCTCA +
Preference number: 2 (lower is better)
Translates to: GSNSFPLFLPLVKGNSSSHQILG*IMAKAS
Trigger: TGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTG...TGAACTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AAGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: KQIKTENSSNSHQSPNSDSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...GTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCTT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAAGTCTTTCAGAGAAATaGATGCAATCAGAGTGGGAT +
Preference number: 2 (lower is better)
Translates to: SKSRLRTVPTPINLQTVTSLSEK*MQSEWD
Trigger: ATCCCACTCTGATTGCATCCATTTCTCTGAAAGACT...TGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCT
41% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp ACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: TGRQQLLSFISSPCKGKFNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...GAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGT
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AAGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: KQIKTENSSNSHQSPNSDNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...GTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCTT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CCA 90 bp AGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTA +
Preference number: 2 (lower is better)
Translates to: SKSRLRTVPTPINLQTVTNLTIR*SPLVCL
Trigger: TAAACAAACAAGAGGTGACCACCTTATTGTGAGGTT...TGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCT
40% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAACATGTGCCTGAATGGTaGCCAGGTCAGCTGCAGGCC +
Preference number: 3 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKHVPEW*PGQLQA
Trigger: GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATG...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR GCA 72 bp ATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAG +
Preference number: 3 (lower is better)
Translates to: IPVTSRSHSTFM*LNGCQVSCRPE
Trigger: CTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
56% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR GCA 72 bp TCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTaGCAGGTCAGCTGCAGGCCAGAGGCAGTCTTCAGA +
Preference number: 3 (lower is better)
Translates to: SRSHSTFMCLNG*QVSCRPEAVFR
Trigger: TCTGAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGA
56% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTCATGTGCCTGAATGGTaGCCAGGTCAGCTGCAGGCC +
Preference number: 3 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATHVPEW*PGQLQA
Trigger: GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATG...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR GCA 72 bp CCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTaGAGGCACCAAATCTTGGGCTGGATAATGGCAAAG +
Preference number: 3 (lower is better)
Translates to: PFLPQVLNQTRG*RHQILGWIMAK
Trigger: CTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR CCA 72 bp AACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTaGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAG +
Preference number: 3 (lower is better)
Translates to: NQTRGCRHQILG*IMAKASEAHLQ
Trigger: CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp AGAGGCAGGCTTCTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGCATGTGCCTGAATGGTaGCCAGGTCAGCTGCAGGCC +
Preference number: 3 (lower is better)
Translates to: RGRLLSDESPETIGHINLHVPEW*PGQLQA
Trigger: GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATG...CAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAGAAGCCTGCCTCT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: CRHQILGWIMAKASEAHLVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: RHQILGWIMAKASEAHLQVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
53% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp AGGGGGATGCCAAGGATAAGGCCAGCTCAGTTATATGAAGAGAAGCAGAACAAACATGTGCCTGAATGGTaGCCAGGTCAGCTGCAGGCC +
Preference number: 3 (lower is better)
Translates to: RGMPRIRPAQLYEEKQNKHVPEW*PGQLQA
Trigger: GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATG...TTTGTTCTGCTTCTCTTCATATAACTGAGCTGGCCTTATCCTTGGCATCCCCCT
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCAATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR GCA 72 bp GTAAAGGGAAATTCAAGTTCAGCAGCATTCCTTTCCTaGCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGC +
Preference number: 3 (lower is better)
Translates to: VKGNSSSAAFLS*PKSSTRQEAAG
Trigger: GCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGCTGCTGAACTTGAATTTCCCTTTAC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp AAGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACCATGTGCCTGAATGGTaGCCAGGTCAGCTGCAGGCC +
Preference number: 3 (lower is better)
Translates to: KQIKTENSSNSHQSPNSDHVPEW*PGQLQA
Trigger: GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATG...GTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCTT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GATGAGAGTCCTGAGACAATAGGCCACATAAACTTGGCTGGATGGAACCTCACAGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: DESPETIGHINLAGWNLTVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATC
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp CTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGGCTGGATGGAACGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: LSDESPETIGHINLAGWNVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...GTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAG
50% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp GATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTGAGCTTCAACAGCTGTATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: DNGKGLRSSPPALSFNSCIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...ACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTTGCAGGCACCAAATCTaGGGCTGGATAATGGCAAAG +
Preference number: 3 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATCRHQI*GWIMAK
Trigger: CTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR TCA 72 bp ATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGTACCAGTGAGTCAGCA +
Preference number: 3 (lower is better)
Translates to: IMAKASEAHLQL*ASTAVCTSESA
Trigger: TGCTGACTCACTGGTACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTAT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp ACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCGTGGTCACCTCTTGTTaGTTTAGGGGGATGCCAAGG +
Preference number: 3 (lower is better)
Translates to: TGRQQLLSFISSPCKGKFVVTSC*FRGMPR
Trigger: CCTTGGCATCCCCCTAAACAAACAAGAGGTGACCAC...GAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGT
48% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GTGACAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAAATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: VTGRQQLLSFISSPCKGKIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...TTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTGTCAC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGTGCAGGCACCAAATCTaGGGCTGGATAATGGCAAAG +
Preference number: 3 (lower is better)
Translates to: GRQQLLSFISSPCKGKFKCRHQI*GWIMAK
Trigger: CTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA...CTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp CAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCATGCAGGCACCAAATCTaGGGCTGGATAATGGCAAAG +
Preference number: 3 (lower is better)
Translates to: QVGSNSFPLFLPLVKGNSCRHQI*GWIMAK
Trigger: CTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA...TGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTG
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR CCA 72 bp CACATAAACTTGGCTGGATGGAACCTCACAATAAGGTaGTCACCTCTTGTTTGTTTAGGGGGATGCCAAGGA +
Preference number: 3 (lower is better)
Translates to: HINLAGWNLTIR*SPLVCLGGCQG
Trigger: TCCTTGGCATCCCCCTAAACAAACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTG
47% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
3UTR-3UTR CAA 90 bp CAGGTCGGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: QVGSNSFPLFLPLVKGNSIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...TGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCCGACCTG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp AAGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: KQIKTENSSNSHQSPNSDIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...GTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCTT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp AGCAAATCAAGACTGAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAATAGGCCACATAAACTaGGCTGGATGGAACCTCACA +
Preference number: 3 (lower is better)
Translates to: SKSRLRTVPTPINLQTVTIGHIN*AGWNLT
Trigger: TGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCTAT...TGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCT
44% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR-3UTR CAA 90 bp GGCAGCAACTCCTTTCCTTTATTTCTTCCCCTTGTAAAGGGAAATTCAAGTTCATGCAGGCACCAAATCTaGGGCTGGATAATGGCAAAG +
Preference number: 3 (lower is better)
Translates to: GSNSFPLFLPLVKGNSSSCRHQI*GWIMAK
Trigger: CTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA...TGAACTTGAATTTCCCTTTACAAGGGGAAGAAATAAAGGAAAGGAGTTGCTGCC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
3UTR TCA 72 bp AAAGCTGCTAGAAAACTGAATAAAGCAAATCAAGACTaGGAACAGTTCCAACTCCCATCAATCTCCAAACAG +
Preference number: 3 (lower is better)
Translates to: KAARKLNKANQD*EQFQLPSISKQ
Trigger: CTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTCAGTCTTGATTTGCTTTATTCAGTTTTCTAGCAGCTTT
39% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAGCTGGCTCTCCAAGCTaGCGCGGCCAACCCCGCCCC +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKAGSPS*RGQPRP
Trigger: GGGGCGGGGTTGGCCGCGCCAGCTTGGAGAGCCAGC...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGCTGGCTCTCCAAGCTaGCGCGGCCAACCCCGCCCC +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRAGSPS*RGQPRP
Trigger: GGGGCGGGGTTGGCCGCGCCAGCTTGGAGAGCCAGC...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTGCTGGCTCTCCAAGCTaGCGCGGCCAACCCCGCCCC +
Preference number: 4 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPAGSPS*RGQPRP
Trigger: GGGGCGGGGTTGGCCGCGCCAGCTTGGAGAGCCAGC...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGAACCCCGATGGGGCTaGCTCTCCAAGCTGGCGCGG +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAEPRWG*LSKLAR
Trigger: CCGCGCCAGCTTGGAGAGCCAGCCCCATCGGGGTTC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCCCTGGTAGGGCAGGTTaGAGCCCCGCTGCAGGTACT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGPGRAG*SPAAGT
Trigger: AGTACCTGCAGCGGGGCTTCAACCTGCCCTACCAGG...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: GCRHQILGWIMAKASEAHPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQASGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: GCRHQILGWIMAKASEAHCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp CCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: PGHIKVTLHLHVPEWLPGGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...ACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: GCRHQILGWIMAKASEAHGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCATGCAGACCCAGCACTaGAGGGCTGAGTGGTGGGGG +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGMQTQH*RAEWWG
Trigger: CCCCCACCACTCAGCCCTCCAGTGCTGGGTCTGCAT...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
61% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp GGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTCTGCTGGCTCTCCAAGCTaGCGCGGCCAACCCCGCCCC +
Preference number: 4 (lower is better)
Translates to: GRPQRTSRPHKYVSRETSAGSPS*RGQPRP
Trigger: GGGGCGGGGTTGGCCGCGCCAGCTTGGAGAGCCAGC...AGAAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAGAACCCCGATGGGGCTaGCTCTCCAAGCTGGCGCGG +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKEPRWG*LSKLAR
Trigger: CCGCGCCAGCTTGGAGAGCCAGCCCCATCGGGGTTC...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAAGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp CCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: PGHIKVTLHLHVPEWLPGWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...ACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: PGHIKVTLHLHVPEWLPGFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...ACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCCCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp GTAATCCCAACACTCTGGGAGGCCGAGGCGGGCAAATCCCAAGGTCAGGAGATGGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: VIPTLWEAEAGKSQGQEMGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...CATCTCCTGACCTTGGGATTTGCCCGCCTCGGCCTCCCAGAGTGTTGGGATTAC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000475993.1
CDS-3UTR GCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: RHQILGWIMAKASEAHLQCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: WDPGHIKVTLHLHVPEWLGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...CAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp GATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: DPGHIKVTLHLHVPEWLPGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...TGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATC
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: CRHQILGWIMAKASEAHLGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp AGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTGAACCCCGATGGGGCTaGCTCTCCAAGCTGGCGCGG +
Preference number: 4 (lower is better)
Translates to: SGIPVTSRSHSTFMCLNGEPRWG*LSKLAR
Trigger: CCGCGCCAGCTTGGAGAGCCAGCCCCATCGGGGTTC...ACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTGAACCCCGATGGGGCTaGCTCTCCAAGCTGGCGCGG +
Preference number: 4 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPEPRWG*LSKLAR
Trigger: CCGCGCCAGCTTGGAGAGCCAGCCCCATCGGGGTTC...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000383588.8
ENST00000419893.6
ENST00000423247.6
ENST00000426219.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: RHQILGWIMAKASEAHLQGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCAGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: CRHQILGWIMAKASEAHLGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGTGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCCTGGTAGGGCAGGTTaGAGCCCCGCTGCAGGTACT +
Preference number: 4 (lower is better)
Translates to: GCRHQILGWIMAKASEAHPGRAG*SPAAGT
Trigger: AGTACCTGCAGCGGGGCTTCAACCTGCCCTACCAGG...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAACCTGGTAGGGCAGGTTaGAGCCCCGCTGCAGGTACT +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKPGRAG*SPAAGT
Trigger: AGTACCTGCAGCGGGGCTTCAACCTGCCCTACCAGG...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCATGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp AGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: SGIPVTSRSHSTFMCLNGWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...ACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp GATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCATGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: DPGHIKVTLHLHVPEWLPWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...TGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATC
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCGTCGGGCATCATGGCTaGCAACGATCACAGCACCCT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGVGHHG*QRSQHP
Trigger: AGGGTGCTGTGATCGTTGTCAGCCATGATGCCCGAC...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCATTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp AGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: SGIPVTSRSHSTFMCLNGFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...ACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp ACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: TSRSHSTFMCLNGCQVSCFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...GCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp ATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCACCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: MDAIRVGSRSHQGHTPPSPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...TGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCAT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAACCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAACCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGCCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCTGGGCGTCTCCTCCATaGGCAGCTGCTCTGCATACT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGWASPP*AAALHT
Trigger: AGTATGCAGAGCAGCTGCGCATGGAGGAGACGCCCA...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: RHQILGWIMAKASEAHLQSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp GATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: DPGHIKVTLHLHVPEWLPSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...TGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATC
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp AGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: SGIPVTSRSHSTFMCLNGSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...ACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp ACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: TSRSHSTFMCLNGCQVSCSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...GCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
59% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR CCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCCCTTCGGCATCGCGGTaGCAGTTACAGCTACTGTGG +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGPSASR*QLQLLW
Trigger: CCACAGTAGCTGTAACTGCCACCGCGATGCCGAAGG...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR CCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGCCCTCCGCGGGGTTTTaGGGCGGGTACTTCATCCTC +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWPSAGF*GGYFIL
Trigger: GAGGATGAAGTACCCGCCCCAAAACCCCGCGGAGGG...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCGTTTTTCCGCCTGCTTaGTGGACTTCCCGCCTGCCT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGVFPPA*WTSRLP
Trigger: AGGCAGGCGGGAAGTCCACCAAGCAGGCGGAAAAAC...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp CCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTATGCAGACCCAGCACTaGAGGGCTGAGTGGTGGGGG +
Preference number: 4 (lower is better)
Translates to: PGHIKVTLHLHVPEWLPGMQTQH*RAEWWG
Trigger: CCCCCACCACTCAGCCCTCCAGTGCTGGGTCTGCAT...ACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGATGCAGACCCAGCACTaGAGGGCTGAGTGGTGGGGG +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWMQTQH*RAEWWG
Trigger: CCCCCACCACTCAGCCCTCCAGTGCTGGGTCTGCAT...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp AGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTGGCGGGGAACCCCGATaGGGCTGGCTCTCCAAGCTG +
Preference number: 4 (lower is better)
Translates to: RGDHRGLLGHTNMSLGRLGGEPR*GWLSKL
Trigger: CAGCTTGGAGAGCCAGCCCCATCGGGGTTCCCCGCC...AAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 13 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp ACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCTGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: TSRSHSTFMCLNGCQVSCCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...GCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp GATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCATGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: DPGHIKVTLHLHVPEWLPCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...TGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp GTTGCAGTGAGCCGAGATAACGCTACTGCATTCCAGGATGGCGACAGAGCAAGATGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: VAVSRDNATAFQDGDRARCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...TCTTGCTCTGTCGCCATCCTGGAATGCAGTAGCGTTATCTCGGCTCACTGCAAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000475993.1
CDS-3UTR TCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCATGCGCCAGCCCCCTaGGAACTTCTGTGTGGGTCG +
Preference number: 4 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPHAPAP*ELLCGS
Trigger: CGACCCACACAGAAGTTCTCAGGGGGCTGGCGCATG...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp AGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCATGCGCCAGCCCCCTaGGAACTTCTGTGTGGGTCG +
Preference number: 4 (lower is better)
Translates to: RHQILGWIMAKASEAHLQHAPAP*ELLCGS
Trigger: CGACCCACACAGAAGTTCTCAGGGGGCTGGCGCATG...CTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACATGCGCCAGCCCCCTaGGAACTTCTGTGTGGGTCG +
Preference number: 4 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSHAPAP*ELLCGS
Trigger: CGACCCACACAGAAGTTCTCAGGGGGCTGGCGCATG...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCGGGGGTCTGGAAAAGTaGAGCGCACAGTGTACTCCT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGGGLEK*SAQCTP
Trigger: AGGAGTACACTGTGCGCTTCACTTTTCCAGACCCCC...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp AAGGTGGTCACCTCTTGTTTGTTTAGGGGGATGCCAAGGATAAGGCCAGCTCAGTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: KVVTSCLFRGMPRIRPAQWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...CTGAGCTGGCCTTATCCTTGGCATCCCCCTAAACAAACAAGAGGTGACCACCTT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp ATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: MDAIRVGSRSHQGHTPPSWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...TGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCAT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp AATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: NGCNQSGIPVTSRSHSTFWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...GAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCTTGGCTCGTCCAAGATaGGGACATCAGGTTCCCGAC +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGLARPR*GHQVPD
Trigger: GTCGGGAACCTGATGTCCTCATCTTGGACGAGCCAA...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCGTCGGGCATCATGGCTaGCAACGATCACAGCACCCT +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAVGHHG*QRSQHP
Trigger: AGGGTGCTGTGATCGTTGTCAGCCATGATGCCCGAC...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAAGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
58% GC, longest homopolymer 8 nt, total homopolymer stretches 12 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGCCTGGTAGGGCAGGTTaGAGCCCCGTGAGAGCTTCT +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGPGRAG*SPVRAS
Trigger: AGAAGCTCTCACGGGGCTTCAACCTGCCCTACCAGG...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000400609.3
ENST00000416932.2
ENST00000421608.2
ENST00000454094.2
ENST00000456791.2
ENST00000457970.2
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCCCCTTGAGTGCAGGCTaGTGTTCCTCAGATACGGCC +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAPLSAG*CSSDTA
Trigger: GGCCGTATCTGAGGAACAGCAGCCTGCACTCAAGGG...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp GGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTCTTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: GRPQRTSRPHKYVSRETSFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...AGAAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp TCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: SEKWMQSEWDPGHIKVTLPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...GAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp ACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: TSRSHSTFMCLNGCQVSCSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...GCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp GTTGCAGTGAGCCGAGATAACGCTACTGCATTCCAGGATGGCGACAGAGCAAGAAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: VAVSRDNATAFQDGDRARSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...TCTTGCTCTGTCGCCATCCTGGAATGCAGTAGCGTTATCTCGGCTCACTGCAAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000475993.1
CDS-3UTR GCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGCCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCGGGTCGGTGTCAGCTTaGCAGTCAGCAGCAGGAGTA +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAGSVSA*QSAAGV
Trigger: TACTCCTGCTGCTGACTGGCAAGCTGACACCGACCC...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGGGTCGGTGTCAGCTTaGCAGTCAGCAGCAGGAGTA +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAGSVSA*QSAAGV
Trigger: TACTCCTGCTGCTGACTGGCAAGCTGACACCGACCC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCTCCTCCATGCGCAGCTaGTCTGCATACTGCTGGTTG +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGSSMRS*SAYCWL
Trigger: CAACCAGCAGTATGCAGAGCAGCTGCGCATGGAGGA...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
58% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGGGCGTCTCCTCCATaGGCAGCTGCTCTGCATACT +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGWASPP*AAALHT
Trigger: AGTATGCAGAGCAGCTGCGCATGGAGGAGACGCCCA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAAGGTTGAAGCCCCGCTaGAGGTACTCAGTGGGCGTC +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKRLKPR*RYSVGV
Trigger: GACGCCCACTGAGTACCTGCAGCGGGGCTTCAACCT...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGAGGTTGAAGCCCCGCTaGAGGTACTCAGTGGGCGTC +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWRLKPR*RYSVGV
Trigger: GACGCCCACTGAGTACCTGCAGCGGGGCTTCAACCT...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp AATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: NGCNQSGIPVTSRSHSTFSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...GAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp GGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTCTAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: GRPQRTSRPHKYVSRETSSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...AGAAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAAGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp TCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: SEKWMQSEWDPGHIKVTLCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...GAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCCAGTTACAGCTACTGTaGCGGCGCCCGGTGCTATTT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGQLQLL*RRPVLF
Trigger: AAATAGCACCGGGCGCCGCCACAGTAGCTGTAACTG...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGCCCTCCGCGGGGTTTTaGGGCGGGTACTTCATCCTC +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRPSAGF*GGYFIL
Trigger: GAGGATGAAGTACCCGCCCCAAAACCCCGCGGAGGG...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp AGGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCCTCCGCGGGGTTTTaGGGCGGGTACTTCATCCTC +
Preference number: 4 (lower is better)
Translates to: RLQAPNLGLDNGKGLRSSPSAGF*GGYFIL
Trigger: GAGGATGAAGTACCCGCCCCAAAACCCCGCGGAGGG...TGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp ACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCCCCTCCGCGGGGTTTTaGGGCGGGTACTTCATCCTC +
Preference number: 4 (lower is better)
Translates to: TSRSHSTFMCLNGCQVSCPSAGF*GGYFIL
Trigger: GAGGATGAAGTACCCGCCCCAAAACCCCGCGGAGGG...GCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCCTCCGCGGGGTTTTaGGGCGGGTACTTCATCCTC +
Preference number: 4 (lower is better)
Translates to: WDPGHIKVTLHLHVPEWLPSAGF*GGYFIL
Trigger: GAGGATGAAGTACCCGCCCCAAAACCCCGCGGAGGG...CAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCCCTCCGCGGGGTTTTaGGGCGGGTACTTCATCCTC +
Preference number: 4 (lower is better)
Translates to: CRHQILGWIMAKASEAHLPSAGF*GGYFIL
Trigger: GAGGATGAAGTACCCGCCCCAAAACCCCGCGGAGGG...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTCTTGCCCTTGCCATTaGGTCCTACCAGCCCGTAGC +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGSCPCH*VLPARS
Trigger: GCTACGGGCTGGTAGGACCCAATGGCAAGGGCAAGA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTTCTTGCCCTTGCCATTaGGTCCTACCAGCCCGTAGC +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWASCPCH*VLPARS
Trigger: GCTACGGGCTGGTAGGACCCAATGGCAAGGGCAAGA...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCGGATCCGCCGTGCTTTaGCCTCTGCAGCTGCCGCCC +
Preference number: 4 (lower is better)
Translates to: SEKWMQSEWDPGHIKVTLGSAVL*PLQLPP
Trigger: GGGCGGCAGCTGCAGAGGCCAAAGCACGGCGGATCC...GAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR CCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTTTCCGCCTGCTTGGTaGACTTCCCGCCTGCCTTCA +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGFPPAW*TSRLPS
Trigger: TGAAGGCAGGCGGGAAGTCCACCAAGCAGGCGGAAA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGTTTTTCCGCCTGCTTaGTGGACTTCCCGCCTGCCT +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAVFPPA*WTSRLP
Trigger: AGGCAGGCGGGAAGTCCACCAAGCAGGCGGAAAAAC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR CCA 90 bp TGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGATGCAGACCCAGCACTaGAGGGCTGAGTGGTGGGGG +
Preference number: 4 (lower is better)
Translates to: WDPGHIKVTLHLHVPEWLMQTQH*RAEWWG
Trigger: CCCCCACCACTCAGCCCTCCAGTGCTGGGTCTGCAT...CAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp TCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTGGTTGGCAATGTGCTTaGGGAGTGTGGTCTTGCCCT +
Preference number: 4 (lower is better)
Translates to: SCPKSSTRQEAAGTKSWAGWQCA*GVWSCP
Trigger: AGGGCAAGACCACACTCCTCAAGCACATTGCCAACC...AGCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR TCA 90 bp ATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTTCCAGCTGTCCCTaGAGCCGCCGCTCCTCTTCC +
Preference number: 4 (lower is better)
Translates to: MDAIRVGSRSHQGHTPPSCSSCP*SRRSSS
Trigger: GGAAGAGGAGCGGCGGCTTCAGGGACAGCTGGAACA...TGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp AATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCCATGCGCCAGCCCCCTaGGAACTTCTGTGTGGGTCG +
Preference number: 4 (lower is better)
Translates to: NGCNQSGIPVTSRSHSTFHAPAP*ELLCGS
Trigger: CGACCCACACAGAAGTTCTCAGGGGGCTGGCGCATG...GAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp GGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTCTCCTGGTAGGGCAGGTTaGAGCCCCGCTGCAGGTACT +
Preference number: 4 (lower is better)
Translates to: GRPQRTSRPHKYVSRETSPGRAG*SPAAGT
Trigger: AGTACCTGCAGCGGGGCTTCAACCTGCCCTACCAGG...AGAAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp AGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTCCTGGTAGGGCAGGTTaGAGCCCCGCTGCAGGTACT +
Preference number: 4 (lower is better)
Translates to: RGDHRGLLGHTNMSLGRLPGRAG*SPAAGT
Trigger: AGTACCTGCAGCGGGGCTTCAACCTGCCCTACCAGG...AAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR TCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTTGGATGGTGTGGGCGTaGCTCTCCAGGCCGAAGCGG +
Preference number: 4 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATWMVWA*LSRPKR
Trigger: CCGCTTCGGCCTGGAGAGTCACGCCCACACCATCCA...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCACAACTCGCGCCTTCTaGCCACCAGAGAGTTTGCAG +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGTTRAF*PPESLQ
Trigger: CTGCAAACTCTCTGGTGGTCAGAAGGCGCGAGTTGT...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp TTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCTTGGCTCGTCCAAGATaGGGACATCAGGTTCCCGAC +
Preference number: 4 (lower is better)
Translates to: FLPQVLNQTRGCRHQILGLARPR*GHQVPD
Trigger: GTCGGGAACCTGATGTCCTCATCTTGGACGAGCCAA...GCCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCTTGGCTCGTCCAAGATaGGGACATCAGGTTCCCGAC +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQALARPR*GHQVPD
Trigger: GTCGGGAACCTGATGTCCTCATCTTGGACGAGCCAA...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp GCATTCCTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAAGTCGGGCATCATGGCTaGCAACGATCACAGCACCCT +
Preference number: 4 (lower is better)
Translates to: AFLSCPKSSTRQEAAGTKVGHHG*QRSQHP
Trigger: AGGGTGCTGTGATCGTTGTCAGCCATGATGCCCGAC...TTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAGGAATGC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp TGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGGGGGGCAGCTGGGCCTaGAGCTGTAGGGTAAATCAG +
Preference number: 4 (lower is better)
Translates to: WDPGHIKVTLHLHVPEWLGGSWA*SCRVNQ
Trigger: CTGATTTACCCTACAGCTTCAGGCCCAGCTGCCCCC...CAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCA
57% GC, longest homopolymer 6 nt, total homopolymer stretches 6 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR TCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCGCTCACCTCCAGCTCTaGGCTTCAACAGCTGTTTGT +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGAHLQL*ASTAVC
Trigger: ACAAACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGC...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCTCAATCTCCAAACAGTaGCAGGTCGGCAGCAACTCC +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGSISKQ*QVGSNS
Trigger: GGAGTTGCTGCCGACCTGTCACTGTTTGGAGATTGA...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 20 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR TCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCACCTGGTAGGGCAGGTTaGAGCCCCGTGAGAGCTTCT +
Preference number: 4 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPPGRAG*SPVRAS
Trigger: AGAAGCTCTCACGGGGCTTCAACCTGCCCTACCAGG...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000400609.3
ENST00000416932.2
ENST00000421608.2
ENST00000454094.2
ENST00000456791.2
ENST00000457970.2
CDS-3UTR TCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCTGGTAGGGCAGGTTaGAGCCCCGTGAGAGCTTCT +
Preference number: 4 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPPGRAG*SPVRAS
Trigger: AGAAGCTCTCACGGGGCTTCAACCTGCCCTACCAGG...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000400609.3
ENST00000416932.2
ENST00000421608.2
ENST00000454094.2
ENST00000456791.2
ENST00000457970.2
CDS-3UTR GCA 90 bp CCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCCCTTGAGTGCAGGCTaGTGTTCCTCAGATACGGCC +
Preference number: 4 (lower is better)
Translates to: PGHIKVTLHLHVPEWLPGPLSAG*CSSDTA
Trigger: GGCCGTATCTGAGGAACAGCAGCCTGCACTCAAGGG...ACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp GAGAACAGTTCCAACTCCCATCAATCTCCAAACAGTGACAGGTCGGCAGCAACTTTTGGCCTCTGCAGCTaGCGCCCCAGTGGCCCGCAA +
Preference number: 4 (lower is better)
Translates to: ENSSNSHQSPNSDRSAATFGLCS*RPSGPQ
Trigger: TTGCGGGCCACTGGGGCGGCAGCTGCAGAGGCCAAA...AGTTGCTGCCGACCTGTCACTGTTTGGAGATTGATGGGAGTTGGAACTGTTCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 14 transcripts:
ENST00000326195.13
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp TTCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: FREMDAIRVGSRSHQGHTPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...AGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp AGAGGCAGGCTTCTGAGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGCCGTGCTTTGGCCTCTaGAGCTGCCGCCCCAGTGGC +
Preference number: 4 (lower is better)
Translates to: RGRLLSDESPETIGHINLPCFGL*SCRPSG
Trigger: GCCACTGGGGCGGCAGCTGCAGAGGCCAAAGCACGG...CAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACTCAGAAGCCTGCCTCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp AAGGTGGTCACCTCTTGTTTGTTTAGGGGGATGCCAAGGATAAGGCCAGCTCAGAGCCAGGATCCGCCGTaGTTTGGCCTCTGCAGCTGC +
Preference number: 4 (lower is better)
Translates to: KVVTSCLFRGMPRIRPAQSQDPP*FGLCSC
Trigger: GCAGCTGCAGAGGCCAAAGCACGGCGGATCCTGGCT...CTGAGCTGGCCTTATCCTTGGCATCCCCCTAAACAAACAAGAGGTGACCACCTT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp ATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCACCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: MDAIRVGSRSHQGHTPPSPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...TGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCAT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp GATAATGGCAAAGGCCTCAGAAGCTCACCTCCAGCTCTGAGCTTCAACAGCTGTCCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: DNGKGLRSSPPALSFNSCPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...ACAGCTGTTGAAGCTCAGAGCTGGAGGTGAGCTTCTGAGGCCTTTGCCATTATC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp AATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCCCAGGGAGACACGCATaGGCCAGCCCCCTGAGAACT +
Preference number: 4 (lower is better)
Translates to: NGCNQSGIPVTSRSHSTFPGRHA*ASPLRT
Trigger: AGTTCTCAGGGGGCTGGCGCATGCGTGTCTCCCTGG...GAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATT
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAAGGTGGACTTCCCGCCTaGCTTCAGCTCCTTCAGCTT +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKGGLPA*LQLLQL
Trigger: AAGCTGAAGGAGCTGAAGGCAGGCGGGAAGTCCACC...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp GGCGGGCAAATCCCAAGGTCAGGAGATGGAGACCATCCTAGCCAACATGGTGAAGGTGGACTTCCCGCCTaGCTTCAGCTCCTTCAGCTT +
Preference number: 4 (lower is better)
Translates to: GGQIPRSGDGDHPSQHGEGGLPA*LQLLQL
Trigger: AAGCTGAAGGAGCTGAAGGCAGGCGGGAAGTCCACC...TTCACCATGTTGGCTAGGATGGTCTCCATCTCCTGACCTTGGGATTTGCCCGCC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000475993.1
CDS-3UTR GCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGCGTCGGCATTTCTGCTaGTTCCGAGTCAGGGCTTCC +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGRRHFC*FRVRAS
Trigger: GGAAGCCCTGACTCGGAAGCAGCAGAAATGCCGACG...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CTTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGCGTCGGCATTTCTGCTaGTTCCGAGTCAGGGCTTCC +
Preference number: 4 (lower is better)
Translates to: LSCPKSSTRQEAAGTKSWRRHFC*FRVRAS
Trigger: GGAAGCCCTGACTCGGAAGCAGCAGAAATGCCGACG...CCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAAG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAACGTCGGCATTTCTGCTaGTTCCGAGTCAGGGCTTCC +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKRRHFC*FRVRAS
Trigger: GGAAGCCCTGACTCGGAAGCAGCAGAAATGCCGACG...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp AAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCTTCCGTCGGCATTTCTaGTGCTTCCGAGTCAGGGCT +
Preference number: 4 (lower is better)
Translates to: KVTLHLHVPEWLPGQLQAFRRHF*CFRVRA
Trigger: AGCCCTGACTCGGAAGCAGCAGAAATGCCGACGGAA...GGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp GGCTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCCGAATGTCACACCATaGAGACCCAGCACTGGAGGG +
Preference number: 4 (lower is better)
Translates to: GCRHQILGWIMAKASEAHPNVTP*RPSTGG
Trigger: CCCTCCAGTGCTGGGTCTGCATGGTGTGACATTCGG...GTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAGCC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGCCGAATGTCACACCATaGAGACCCAGCACTGGAGGG +
Preference number: 4 (lower is better)
Translates to: QRRGDHRGLLGHTNMSLGPNVTP*RPSTGG
Trigger: CCCTCCAGTGCTGGGTCTGCATGGTGTGACATTCGG...CCCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGCCGAATGTCACACCATaGAGACCCAGCACTGGAGGG +
Preference number: 4 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGPNVTP*RPSTGG
Trigger: CCCTCCAGTGCTGGGTCTGCATGGTGTGACATTCGG...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGGGGTCGGTGTCAGCTTaGCAGTCAGCAGCAGGAGTA +
Preference number: 4 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGGSVSA*QSAAGV
Trigger: TACTCCTGCTGCTGACTGGCAAGCTGACACCGACCC...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
57% GC, longest homopolymer 6 nt, total homopolymer stretches 10 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp CAGAGGCAGTCTTCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATGGGCGTCTCCTCCATaGGCAGCTGCTCTGCATACT +
Preference number: 4 (lower is better)
Translates to: QRQSSEEGRPQRTSRPHKWASPP*AAALHT
Trigger: AGTATGCAGAGCAGCTGCGCATGGAGGAGACGCCCA...TTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGAAGACTGCCTCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp TTTCCTGCCCCAAGTCCTCAACCAGACAAGAGGCTGCAGGCACCAAATCTTGGGTGGGCGTCTCCTCCATaGGCAGCTGCTCTGCATACT +
Preference number: 4 (lower is better)
Translates to: FPAPSPQPDKRLQAPNLGWASPP*AAALHT
Trigger: AGTATGCAGAGCAGCTGCGCATGGAGGAGACGCCCA...CCCAAGATTTGGTGCCTGCAGCCTCTTGTCTGGTTGAGGACTTGGGGCAGGAAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGAGGTTGAAGCCCCGCTaGAGGTACTCAGTGGGCGTC +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRRLKPR*RYSVGV
Trigger: GACGCCCACTGAGTACCTGCAGCGGGGCTTCAACCT...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp CAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCCAAGGTTGAAGCCCCGCTaGAGGTACTCAGTGGGCGTC +
Preference number: 4 (lower is better)
Translates to: QAPNLGLDNGKGLRSSPPRLKPR*RYSVGV
Trigger: GACGCCCACTGAGTACCTGCAGCGGGGCTTCAACCT...TGGAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp TGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTCAGGTTGAAGCCCCGCTaGAGGTACTCAGTGGGCGTC +
Preference number: 4 (lower is better)
Translates to: CRHQILGWIMAKASEAHLRLKPR*RYSVGV
Trigger: GACGCCCACTGAGTACCTGCAGCGGGGCTTCAACCT...GAGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 15 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp GATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAAGGTTGAAGCCCCGCTaGAGGTACTCAGTGGGCGTC +
Preference number: 4 (lower is better)
Translates to: DPGHIKVTLHLHVPEWLPRLKPR*RYSVGV
Trigger: GACGCCCACTGAGTACCTGCAGCGGGGCTTCAACCT...TGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 16 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
ENST00000475993.1
CDS-3UTR GCA 90 bp AGGACTTCTAGGCCACACAAATATGTCTCTCGGGAGACTTCTGGGAAGGAAAGCAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: RTSRPHKYVSRETSGKESSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...GCTTTCCTTCCCAGAAGTCTCCCGAGAGACATATTTGTGTGGCCTAGAAGTCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp TCAGAGAAATGGATGCAATCAGAGTGGGATCCCGGTCACATCAAGGTCACACTCAGCGGCCCAGGCACTTaGGGGCATCCTGGTAGGGCA +
Preference number: 4 (lower is better)
Translates to: SEKWMQSEWDPGHIKVTLSGPGT*GHPGRA
Trigger: TGCCCTACCAGGATGCCCGCAAGTGCCTGGGCCGCT...GAGTGTGACCTTGATGTGACCGGGATCCCACTCTGATTGCATCCATTTCTCTGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp GATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: DPGHIKVTLHLHVPEWLPGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...TGGCAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp TGGGATCCCGGTCACATCAAGGTCACACTCCACCTTCATGTGCCTGAATGGTTGGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: WDPGHIKVTLHLHVPEWLGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...CAACCATTCAGGCACATGAAGGTGGAGTGTGACCTTGATGTGACCGGGATCCCA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp CTGCAGGCACCAAATCTTGGGCTGGATAATGGCAAAGGCCTCAGAAGCTCACCTGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: LQAPNLGLDNGKGLRSSPGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...AGGTGAGCTTCTGAGGCCTTTGCCATTATCCAGCCCAAGATTTGGTGCCTGCAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 21 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
CDS-3UTR GCA 90 bp TCAGAGGAGGGGAGACCACAGAGGACTTCTAGGCCACACAAATATGTCTCTCGGGGTTGCCAGGTCAGCTaGAGGCCAGAGGCAGTCTTC +
Preference number: 4 (lower is better)
Translates to: SEEGRPQRTSRPHKYVSRGCQVS*RPEAVF
Trigger: GAAGACTGCCTCTGGCCTGCAGCTGACCTGGCAACC...CCGAGAGACATATTTGTGTGGCCTAGAAGTCCTCTGTGGTCTCCCCTCCTCTGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp ACACTCCACCTTCATGTGCCTGAATGGTTGCCAGGTCAGCTGCAGGCCAGAGGCCACTCCACCTTCATGTaGCTGAATGGTTGCCAGGTC +
Preference number: 4 (lower is better)
Translates to: TLHLHVPEWLPGQLQARGHSTFM*LNGCQV
Trigger: GACCTGGCAACCATTCAGGCACATGAAGGTGGAGTG...GCCTCTGGCCTGCAGCTGACCTGGCAACCATTCAGGCACATGAAGGTGGAGTGT
57% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 22 transcripts:
ENST00000326195.13
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000400609.3
ENST00000412443.6
ENST00000416932.2
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000421608.2
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000454094.2
ENST00000456791.2
ENST00000457078.6
ENST00000457111.6
ENST00000457970.2
ENST00000475993.1
CDS-3UTR GCA 90 bp AGGCCACATAAACTTGGCTGGATGGAACCTCACAATAAGGTGGTCACCTCTTGTTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: RPHKLGWMEPHNKVVTSCCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...ACAAGAGGTGACCACCTTATTGTGAGGTTCCATCCAGCCAAGTTTATGTGGCCT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6
ENST00000452530.6
ENST00000457078.6
ENST00000457111.6
CDS-3UTR GCA 90 bp AGTGATGAGAGTCCTGAGACAATAGGCCACATAAACTTGGCTGGATGGAACCTCTGTGGCGGCGCCCGGTaGTATTTCCGCTTCCGGCGG +
Preference number: 4 (lower is better)
Translates to: SDESPETIGHINLAGWNLCGGAR*YFRFRR
Trigger: CCGCCGGAAGCGGAAATAGCACCGGGCGCCGCCACA...GAGGTTCCATCCAGCCAAGTTTATGTGGCCTATTGTCTCAGGACTCTCATCACT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 14 transcripts:
ENST00000376545.7
ENST00000383587.8
ENST00000383588.8
ENST00000412443.6
ENST00000419893.6
ENST00000420257.6
ENST00000421042.6
ENST00000423247.6
ENST00000426219.6
ENST00000441867.6
ENST00000448939.6