RADAR | Search for sensor designs | Human genes | Mouse genes | Code

Pregenerated sensors for ABCC1 (Homo sapiens)

Ensembl gene IDs: ENSG00000103222, ENSG00000278183

Ensembl transcript IDs: ENST00000399408.7, ENST00000399410.8, ENST00000572882.3, ENST00000574224.2, ENST00000574761.1, ENST00000575422.5, ENST00000576557.1, ENST00000621144.4, ENST00000621659.2, ENST00000622828.3, ENST00000632338.1, ENST00000632908.1, ENST00000633802.1, ENST00000634072.1, ENST00000676806.1, ENST00000677164.1, ENST00000678422.1, ENST00000679043.1

Found 1733 sensor candidate(s). Results are sorted by "preference number" (better first), and then by GC (higher first).

Type Sensor Details
3UTR GCA 90 bp GCAGGCAGTAGTTCCGGAATTCCACTCGGCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCTGGATTTGCCAGGGCGCCTCCTTCT +
Preference number: 1 (lower is better)
Translates to: AGSSSGIPLGPPGAS*WAELSPGFARAPPS
Trigger: AGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGAATTCCGGAACTACTGCCTGC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR CCA 90 bp GGCAGTAGTTCCGGAATTCCACTCGGCCCACCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGATTTGCCAGGGCGCCTCCTTCTCAG +
Preference number: 1 (lower is better)
Translates to: GSSSGIPLGPPGASC*AELSPGFARAPPSQ
Trigger: CTGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGAATTCCGGAACTACTGCC
66% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 90 bp TGGTTCTCGTCCACCTTCAGGTCACTCTGGTGGATGAAGCGCTCCTaGTCCTCGAAGGCTCGAATGACGCTGACCCCCAGCAAGGTCTCG +
Preference number: 1 (lower is better)
Translates to: WFSSTFRSLWWMKRS*SSKARMTLTPSKVS
Trigger: CGAGACCTTGCTGGGGGTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGTGGACGAGAACCA
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 90 bp TTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTaGAGTTCTGACCAGATATGCCAGCTCTGGGGCTCACACCAAGCC +
Preference number: 1 (lower is better)
Translates to: LPGVLTPPWALAYRP*SSDQICQLWGSHQA
Trigger: GGCTTGGTGTGAGCCCCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR CCA 90 bp AGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGACAGGCGTaGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGA +
Preference number: 1 (lower is better)
Translates to: RLAVSPTRSLPGGQA*ECRGCLWPKTRTGR
Trigger: TCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCTGTCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR GCA 90 bp GCCTCCATCAGCTTCCAGGTCTCCTCCTTCTTGGCCTCAGCTTTCTaGAGTTCTGCGGTGCTGTTGTGGTGCCTGCTGATGTCCCCACTA +
Preference number: 1 (lower is better)
Translates to: ASISFQVSSFLASAF*SSAVLLWCLLMSPL
Trigger: TAGTGGGGACATCAGCAGGCACCACAACAGCACCGCAGAACTGCAGAAAGCTGAGGCCAAGAAGGAGGAGACCTGGAAGCTGATGGAGGC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 90 bp GAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTTTTGAGTaGCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGGCCCTG +
Preference number: 1 (lower is better)
Translates to: ELVELALRCWFPAFE*LEDQMLVRGPSRAL
Trigger: CAGGGCCCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 90 bp TTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAG +
Preference number: 1 (lower is better)
Translates to: FQCGRLGLPGVLTPP*ALAYRPCSSDQICQ
Trigger: CTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 90 bp TCATGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCAGGTaGGCCAGCTCCAGGGACGTCCAGACTTCTTCATCCGAGTACTGG +
Preference number: 1 (lower is better)
Translates to: SWSSLSGRADTKSFR*ASSRDVQTSSSEYW
Trigger: CCAGTACTCGGATGAAGAAGTCTGGACGTCCCTGGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCATGA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 90 bp GCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATaGTGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTA +
Preference number: 1 (lower is better)
Translates to: AASGPKRELVELALR*WFPAFECLEDQMLV
Trigger: TACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 90 bp TATACAACCAATTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCT +
Preference number: 1 (lower is better)
Translates to: YTTNSSRSLAAKTPP*EAPGNHLHSWGREA
Trigger: AGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAATTGGTTGTATA
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 90 bp GCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTaGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGA +
Preference number: 1 (lower is better)
Translates to: ASGPKRELVELALRC*FPAFECLEDQMLVR
Trigger: TCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGC
54% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 90 bp TTTGGCCATGCTGTAGAAAAGACCTCTCTGCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCAC +
Preference number: 1 (lower is better)
Translates to: FGHAVEKTSLLQEVR*GAVLLDFSFVQDDH
Trigger: GTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTTCTACAGCATGGCCAAA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 90 bp ACAAGGATGTTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTG +
Preference number: 1 (lower is better)
Translates to: TRMLEVMGARSISKT*SPQTSAGEIRGSRL
Trigger: CAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAACATCCTTGT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR TCA 90 bp CTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTaGATTTGGTCACTAGGATCTTCTATACAACCAATTCCTCCAGAA +
Preference number: 1 (lower is better)
Translates to: LAVHRLRLERSEAVG*IWSLGSSIQPIPPE
Trigger: TTCTGGAGGAATTGGTTGTATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAG
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 90 bp ATTTGGTCACTAGGATCTTCTATACAACCAATTCCTCCAGAAGTCTaGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGC +
Preference number: 1 (lower is better)
Translates to: IWSLGSSIQPIPPEV*LPKLLRGKHQETTC
Trigger: GCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAATTGGTTGTATAGAAGATCCTAGTGACCAAAT
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 2 (lower is better)
Translates to: WSSLSGRADTKSFRWASSPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...GGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 2 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEADHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCC +
Preference number: 2 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLVLTPP*ALAYRP
Trigger: GGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 2 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEARPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGAT +
Preference number: 2 (lower is better)
Translates to: RRGSAEAASGPKRELVELLQEVR*GAVLLD
Trigger: ATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAG...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCCAGATATGCCAGCTCTaGGGCTCACACCAAGCCGGC +
Preference number: 2 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEAQICQL*GSHQAG
Trigger: GCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTG...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 2 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CAA 90 bp AGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTaGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACC +
Preference number: 2 (lower is better)
Translates to: SLAAKTPPWEAPGNH*HSWGREAVCLSQGT
Trigger: GGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPAVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPAVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCCTTCGGCAGACTCGTTaGTCCGAAATAAGCCCAGGG +
Preference number: 2 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEALRQTR*SEISPG
Trigger: CCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAG...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTG +
Preference number: 2 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLSLSSG*LPDSTL
Trigger: CAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 2 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEAAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGAGCAAGTCTGAGTCTTaGGGCAGCCTCAGCTCTGGC +
Preference number: 2 (lower is better)
Translates to: RRGSAEAASGPKRELVELSKSES*GSLSSG
Trigger: GCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTG +
Preference number: 2 (lower is better)
Translates to: RRGSAEAASGPKRELVELSLSSG*LPDSTL
Trigger: CAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCT...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCC +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPAVLTPP*ALAYRP
Trigger: GGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGAGGGTGTGCGTGTTTTaGGTGGTTCGCATCTCTGTC +
Preference number: 2 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLRVCVF*VVRISV
Trigger: GACAGAGATGCGAACCACCCAAAACACGCACACCCT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 2 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CAA 90 bp ATCACCCTGAGGTTCTCCCCGCCTTCTGCACATTCATGGTCTAGCTaGTCAGGAAGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCC +
Preference number: 2 (lower is better)
Translates to: ITLRFSPPSAHSWSS*SGRADTKSFRWASS
Trigger: GGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCATGAATGTGCAGAAGGCGGGGAGAACCTCAGGGTGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 2 (lower is better)
Translates to: RRGSAEAASGPKRELVELDALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCTGGCATATAGGCCCTaGAGTTCTGACCAGATATGC +
Preference number: 2 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLLAYRP*SSDQIC
Trigger: GCATATCTGGTCAGAACTGCAGGGCCTATATGCCAG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGAGCTGGCGCTGAGATaGTGGTTCCCAGCTTTTGAG +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSELALR*WFPAFE
Trigger: CTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCATGGGTGACCGCAGGATaGTGTGCAGCAGGTCCACGT +
Preference number: 2 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPWVTAG*CAAGPR
Trigger: ACGTGGACCTGCTGCACAGCATCCTGCGGTCACCCA...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp CGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACCCTGAGCCAGCACTGAGGCTGTaGCTGGAGATCACCGCAAAC +
Preference number: 2 (lower is better)
Translates to: RWGAVLLDFSFVQDDHPEPALRL*LEITAN
Trigger: GTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGG...CTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp TCCTCGAAGGCTCGAATGACGCTGACCCCCAGCAAGGTCTCGTTGAAATGGGAAGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCC +
Preference number: 2 (lower is better)
Translates to: SSKARMTLTPSKVSLKWEVLTPP*ALAYRP
Trigger: GGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC...TTCCCATTTCAACGAGACCTTGCTGGGGGTCAGCGTCATTCGAGCCTTCGAGGA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CAA 90 bp GCGATGGGCGTGGCCAGCAGGATAACGATGCAGGCACCAATGACGTaGAACAGGGAGCCCATGAACATCTTGATGACCTCCGGGATCATG +
Preference number: 2 (lower is better)
Translates to: AMGVASRITMQAPMT*NREPMNILMTSGIM
Trigger: CATGATCCCGGAGGTCATCAAGATGTTCATGGGCTCCCTGTTCAACGTCATTGGTGCCTGCATCGTTATCCTGCTGGCCACGCCCATCGC
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTCCGAGGCAGTAGGCTaGATTTGGTCACTAGGATCT +
Preference number: 2 (lower is better)
Translates to: RRGSAEAASGPKRELVELSEAVG*IWSLGS
Trigger: AGATCCTAGTGACCAAATTCAGCCTACTGCCTCGGA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp CCTTCTGCACATTCATGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 2 (lower is better)
Translates to: PSAHSWSSLSGRADTKSFVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...GAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCATGAATGTGCAGAAGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSDALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp CGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACCCTGAGAGGAGGAGGAGCTGCTaGGCTGTCCATGAGATCTGT +
Preference number: 2 (lower is better)
Translates to: RWGAVLLDFSFVQDDHPERRRSC*AVHEIC
Trigger: ACAGATCTCATGGACAGCTCAGCAGCTCCTCCTCCT...CTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 2 (lower is better)
Translates to: PEASQRLAVHRLRLERSEAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCATGGGAGTGCAGAGGCTaGCTCTGGCCCAAAACGAGA +
Preference number: 2 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPWECRG*LWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCA...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTG +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPASLSSG*LPDSTL
Trigger: CAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCT...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACCCTGAGACGGAAAGCTTGACCTaGCCTGTCTGCGCCTTGTCA +
Preference number: 2 (lower is better)
Translates to: RWGAVLLDFSFVQDDHPETESLT*PVCALS
Trigger: TGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGT...CTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp ATCAGTCCAGAGGCTGAGCCAATAGTTGGAAGCCAGCGCGGACACATGGTTACACTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 2 (lower is better)
Translates to: ISPEAEPIVGSQRGHMVTLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...TGTAACCATGTGTCCGCGCTGGCTTCCAACTATTGGCTCAGCCTCTGGACTGAT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: RRGSAEAASGPKRELVELCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTTGCAGAGGCTGCCTCTaGCCCAAAACGAGAACTGGT +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPACRGCL*PKTRTG
Trigger: ACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCA...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GAGGTCCGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACTGCAGAGGCTGCCTCTaGCCCAAAACGAGAACTGGT +
Preference number: 2 (lower is better)
Translates to: EVRWGAVLLDFSFVQDDHCRGCL*PKTRTG
Trigger: ACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCA...GTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp GAGGTCCGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACACCTTCAGGTCACTCTaGTGGATGAAGCGCTCCTGC +
Preference number: 2 (lower is better)
Translates to: EVRWGAVLLDFSFVQDDHTFRSL*WMKRSC
Trigger: GCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGT...GTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp TGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCCTGTTGGCCACGATGCTaGGGTAATAGGCCTTCTGGT +
Preference number: 2 (lower is better)
Translates to: WSSLSGRADTKSFRWASSCWPRC*GNRPSG
Trigger: ACCAGAAGGCCTATTACCCCAGCATCGTGGCCAACA...GGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 2 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCGAGTACTGGCTGAATaGGTCCAGGTTCATTCGGAG +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSRVLAE*VQVHSE
Trigger: CTCCGAATGAACCTGGACCCATTCAGCCAGTACTCG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 2 (lower is better)
Translates to: TETNTVSNTGRASHYFLGVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 2 (lower is better)
Translates to: TETNTVSNTGRASHYFLGVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPADALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTaGAGTTCTGACCAGATATGC +
Preference number: 2 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWALAYRP*SSDQIC
Trigger: GCATATCTGGTCAGAACTGCAGGGCCTATATGCCAG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCCGGATGGCGGTGGCTaGTGCTTTGAATATGTTTTG +
Preference number: 2 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRPDGGG*CFEYVL
Trigger: CAAAACATATTCAAAGCAGCAGCCACCGCCATCCGG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGA +
Preference number: 2 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPLQKSG*QNSSVG
Trigger: TCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAG...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp AGTGATCTCTACAACTTGCCCTTTCTGGCAACAGCTCCCACTAGAGGCGACTTGCTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 2 (lower is better)
Translates to: SDLYNLPFLATAPTRGDLLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...CAAGTCGCCTCTAGTGGGAGCTGTTGCCAGAAAGGGCAAGTTGTAGAGATCACT
56% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCC +
Preference number: 2 (lower is better)
Translates to: WFPAFECLEDQMLVRGPSVLTPP*ALAYRP
Trigger: GGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC...GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
56% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 2 (lower is better)
Translates to: TQRPTRFQTQGELLTISWDHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 2 (lower is better)
Translates to: TETNTVSNTGRASHYFLGDHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAAGAGGGAAGCCCCAGGTaGAACGTCGGCCCTGAGACA +
Preference number: 2 (lower is better)
Translates to: QRPTRFQTQGELLTISWEEGSPR*NVGPET
Trigger: TGTCTCAGGGCCGACGTTCCACCTGGGGCTTCCCTC...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
56% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCTCTTCATCCGAGTACTaGCTGAATGGGTCCAGGTTC +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSSSSEY*LNGSRF
Trigger: GAACCTGGACCCATTCAGCCAGTACTCGGATGAAGA...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR CAA 90 bp ACGATGCAGGCACCAATGACGTTGAACAGGGAGCCCATGAACATCTaGATGACCTCCGGGATCATGGAGTCCACTGTGTCCAGCTCCTTG +
Preference number: 2 (lower is better)
Translates to: TMQAPMTLNREPMNI*MTSGIMESTVSSSL
Trigger: CAAGGAGCTGGACACAGTGGACTCCATGATCCCGGAGGTCATCAAGATGTTCATGGGCTCCCTGTTCAACGTCATTGGTGCCTGCATCGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 2 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGACTGGTTCCCAGCTTTTaGGTGCCTGGAAGACCAGAT +
Preference number: 2 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGLVPSF*VPGRPD
Trigger: ATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAG...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGCTTGTCAGGAAGGGCTaGCACGAAGTCCTTCAGGTG +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLLVRKG*HEVLQV
Trigger: CACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAG...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGCTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 2 (lower is better)
Translates to: LEVMGARSISKTCSPQTSLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGCTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 2 (lower is better)
Translates to: TQRPTRFQTQGELLTISWLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 2 (lower is better)
Translates to: PEASQRLAVHRLRLERSEAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCTTCTCACTATTTCCTaGGAATGTTACTTCTCAGCC +
Preference number: 2 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLLLTIS*ECYFSA
Trigger: GGCTGAGAAGTAACATTCCCAGGAAATAGTGAGAAG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
54% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CAA 90 bp ATGGTGATCTTGAAGCGGAGGTCGTGCAGGCCGATCTTGGCGATGTaGATGCCATCGATGATGATCTCTCCTTCGGCAGACTCGTTGATC +
Preference number: 2 (lower is better)
Translates to: MVILKRRSCRPILAM*MPSMMISPSADSLI
Trigger: GATCAACGAGTCTGCCGAAGGAGAGATCATCATCGATGGCATCAACATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAAGATCACCAT
53% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 2 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp GGAAGCCACGTAGAACCTCTGGACGAAGAAGTAGATGAGGCCAAGGGGCGGGATCGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 2 (lower is better)
Translates to: GSHVEPLDEEVDEAKGRDRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...ATCCCGCCCCTTGGCCTCATCTACTTCTTCGTCCAGAGGTTCTACGTGGCTTCC
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLDALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 2 (lower is better)
Translates to: LEVMGARSISKTCSPQTSTFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGCTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGA +
Preference number: 2 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGLQKSG*QNSSVG
Trigger: TCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAG...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCGCCTAAAAGAAAGATaGTCTCTGGGTTTGAAGTCG +
Preference number: 2 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSRLKER*SLGLKS
Trigger: CGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGTTGGCCTCAGCTTTCTaGAGTTCTGCGGTGCTGTTG +
Preference number: 2 (lower is better)
Translates to: PEASQRLAVHRLRLERSELASAF*SSAVLL
Trigger: CAACAGCACCGCAGAACTGCAGAAAGCTGAGGCCAA...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp GATAACGATGCAGGCACCAATGACGTTGAACAGGGAGCCCATGAACATCTTGATGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 2 (lower is better)
Translates to: DNDAGTNDVEQGAHEHLDDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...ATCAAGATGTTCATGGGCTCCCTGTTCAACGTCATTGGTGCCTGCATCGTTATC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGAGTTCTGACCAGATATaGCAGCTCTGGGGCTCACAC +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLSSDQI*QLWGSH
Trigger: GTGTGAGCCCCAGAGCTGGCATATCTGGTCAGAACT...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTACTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAACCACTTGCATTCCTaGGGGCGTGAGGCTGTGTGT +
Preference number: 2 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGNHLHS*GREAVC
Trigger: ACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTT...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 2 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGTGCAGAGGCTGCCTCTaGCCCAAAACGAGAACTGGT +
Preference number: 2 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGCRGCL*PKTRTG
Trigger: ACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCA...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACCCTGAGCCACGGCCACGATGTTaGTTTCCATTTCAGATGACA +
Preference number: 2 (lower is better)
Translates to: RWGAVLLDFSFVQDDHPEPRPRC*FPFQMT
Trigger: TGTCATCTGAAATGGAAACCAACATCGTGGCCGTGG...CTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGACGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 2 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGTCCGAGGCAGTAGGCTaGATTTGGTCACTAGGATCT +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLSEAVG*IWSLGS
Trigger: AGATCCTAGTGACCAAATTCAGCCTACTGCCTCGGA...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAAAAAGAAGCTCATGGGTaGCCGCAGGATGCTGTGCAG +
Preference number: 2 (lower is better)
Translates to: QRPTRFQTQGELLTISWEKEAHG*PQDAVQ
Trigger: CTGCACAGCATCCTGCGGTCACCCATGAGCTTCTTT...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
52% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTCTGGCATATAGGCCCTaGAGTTCTGACCAGATATGC +
Preference number: 2 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVLAYRP*SSDQIC
Trigger: GCATATCTGGTCAGAACTGCAGGGCCTATATGCCAG...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTATGGGAGTGCAGAGGCTaGCTCTGGCCCAAAACGAGA +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALWECRG*LWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCA...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTACCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
52% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTACGATGGACACGGCCATaGAGTAGCCAAACACGGCGA +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALRWTRP*SSQTRR
Trigger: TCGCCGTGTTTGGCTACTCCATGGCCGTGTCCATCG...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp CCTTCTGCACATTCATGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCCTGCTGAGCTGTCCATaGGATCTGTGCAAAGGTCTT +
Preference number: 2 (lower is better)
Translates to: PSAHSWSSLSGRADTKSFLLSCP*DLCKGL
Trigger: AAGACCTTTGCACAGATCTCATGGACAGCTCAGCAG...GAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCATGAATGTGCAGAAGG
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCT +
Preference number: 2 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLSISKT*SPQTSA
Trigger: AGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCT...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGACCTGTTGGCCACGATaGTGGGGTAATAGGCCTTCT +
Preference number: 2 (lower is better)
Translates to: TQRPTRFQTQGELLTISWTCWPR*WGNRPS
Trigger: AGAAGGCCTATTACCCCAGCATCGTGGCCAACAGGT...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGAGGGTGTGCGTGTTTTaGGTGGTTCGCATCTCTGTC +
Preference number: 2 (lower is better)
Translates to: LEVMGARSISKTCSPQTSRVCVF*VVRISV
Trigger: GACAGAGATGCGAACCACCCAAAACACGCACACCCT...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTAAACCACTTGCATTCCTaGGGGCGTGAGGCTGTGTGT +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALNHLHS*GREAVC
Trigger: ACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTT...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGATCCGAGGCAGTAGGCTaGATTTGGTCACTAGGATCT +
Preference number: 2 (lower is better)
Translates to: TETNTVSNTGRASHYFLGSEAVG*IWSLGS
Trigger: AGATCCTAGTGACCAAATTCAGCCTACTGCCTCGGA...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp CCTTCTGCACATTCATGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCGGTTTCCATTTCAGATaGCATCCGAACCAGCCAGTT +
Preference number: 2 (lower is better)
Translates to: PSAHSWSSLSGRADTKSFGFHFR*HPNQPV
Trigger: AACTGGCTGGTTCGGATGTCATCTGAAATGGAAACC...GAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCATGAATGTGCAGAAGG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAACTGGCATATAGGCCCTaGAGTTCTGACCAGATATGC +
Preference number: 2 (lower is better)
Translates to: QRPTRFQTQGELLTISWELAYRP*SSDQIC
Trigger: GCATATCTGGTCAGAACTGCAGGGCCTATATGCCAG...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGATGGCGGTGGCTGCTaGTTTGAATATGTTTTGGTT +
Preference number: 2 (lower is better)
Translates to: PEASQRLAVHRLRLERSEDGGGC*FEYVLV
Trigger: AACCAAAACATATTCAAAGCAGCAGCCACCGCCATC...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ATCAGTCCAGAGGCTGAGCCAATAGTTGGAAGCCAGCGCGGACACATGGTTACAGATGGCGGTGGCTGCTaGTTTGAATATGTTTTGGTT +
Preference number: 2 (lower is better)
Translates to: ISPEAEPIVGSQRGHMVTDGGGC*FEYVLV
Trigger: AACCAAAACATATTCAAAGCAGCAGCCACCGCCATC...TGTAACCATGTGTCCGCGCTGGCTTCCAACTATTGGCTCAGCCTCTGGACTGAT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAACCGGATGGCGGTGGCTaGTGCTTTGAATATGTTTTG +
Preference number: 2 (lower is better)
Translates to: QRPTRFQTQGELLTISWEPDGGG*CFEYVL
Trigger: CAAAACATATTCAAAGCAGCAGCCACCGCCATCCGG...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGCCGGATGGCGGTGGCTaGTGCTTTGAATATGTTTTG +
Preference number: 2 (lower is better)
Translates to: TQRPTRFQTQGELLTISWPDGGG*CFEYVL
Trigger: CAAAACATATTCAAAGCAGCAGCCACCGCCATCCGG...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCT +
Preference number: 2 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGSISKT*SPQTSA
Trigger: AGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCT...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCT +
Preference number: 2 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRSISKT*SPQTSA
Trigger: AGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCT...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTACAGGCTTTAAAAGATaGTGCTTCCCTGTTTTCTTC +
Preference number: 2 (lower is better)
Translates to: SGPKRELVELALRCWFPATGFKR*CFPVFF
Trigger: GAAGAAAACAGGGAAGCAGCATCTTTTAAAGCCTGT...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 2 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGATGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: TETNTVSNTGRASHYFLGCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 2 (lower is better)
Translates to: TQRPTRFQTQGELLTISWCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTAAGGGTGTGCGTGTTTTaGGTGGTTCGCATCTCTGTC +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALRVCVF*VVRISV
Trigger: GACAGAGATGCGAACCACCCAAAACACGCACACCCT...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CAA 90 bp AGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTaGGTCACTAGGATCTTCTATACAACCAATTCCTCCAGAAGTCTG +
Preference number: 2 (lower is better)
Translates to: SPQTSAGEIRGSRLN*VTRIFYTTNSSRSL
Trigger: CAGACTTCTGGAGGAATTGGTTGTATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACT
49% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGCTGGTTCCCAGCTTTTaGGTGCCTGGAAGACCAGAT +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKLVPSF*VPGRPD
Trigger: ATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAG...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 2 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLDALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGGATGGCGGTGGCTGCTaGTTTGAATATGTTTTGGTT +
Preference number: 2 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGDGGGC*FEYVLV
Trigger: AACCAAAACATATTCAAAGCAGCAGCCACCGCCATC...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCT +
Preference number: 2 (lower is better)
Translates to: TETNTVSNTGRASHYFLGSISKT*SPQTSA
Trigger: AGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCT...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAACCTCAACCACAAAACTaGAGCCCCAAGGAAATGAAG +
Preference number: 2 (lower is better)
Translates to: QRPTRFQTQGELLTISWEPQPQN*SPKEMK
Trigger: CTTCATTTCCTTGGGGCTGCAGTTTTGTGGTTGAGG...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTACGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 2 (lower is better)
Translates to: AFRIPLWALTRHLKEQALRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGCTCCTTCTCAGTCTCTaGATACTCCTTGAGCCTCTC +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKLLLSL*ILLEPL
Trigger: GAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAG...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CCA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTGCTCAAAGAAGCTCATaGGTGACCGCAGGATGCTGT +
Preference number: 2 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILAQRSS*VTAGCC
Trigger: ACAGCATCCTGCGGTCACCCATGAGCTTCTTTGAGC...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
48% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR TCA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCCGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 2 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTCCGGATGGCGGTGGCTaGTGCTTTGAATATGTTTTG +
Preference number: 2 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILPDGGG*CFEYVL
Trigger: CAAAACATATTCAAAGCAGCAGCCACCGCCATCCGG...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCCTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGA +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLLQKSG*QNSSVG
Trigger: TCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAG...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCT +
Preference number: 2 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLSISKT*SPQTSA
Trigger: AGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCT...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTG +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLSLSSG*LPDSTL
Trigger: CAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCT...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCAACCACTTGCATTCCTaGGGGCGTGAGGCTGTGTGT +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLNHLHS*GREAVC
Trigger: ACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTT...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TCATTGATATTCAAAGATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 2 (lower is better)
Translates to: SLIFKDGFFSCPGRASVTPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...AGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATCTTTGAATATCAATGA
47% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTCGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 2 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR TCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCCATCAGTCCAGAGGCTaGGCCAATAGTTGGAAGCCA +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLHQSRG*ANSWKP
Trigger: TGGCTTCCAACTATTGGCTCAGCCTCTGGACTGATG...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR GCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGGATGGCGGTGGCTGCTaGTTTGAATATGTTTTGGTT +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKDGGGC*FEYVLV
Trigger: AACCAAAACATATTCAAAGCAGCAGCCACCGCCATC...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCCGCCTAAAAGAAAGATaGTCTCTGGGTTTGAAGTCG +
Preference number: 2 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLRLKER*SLGLKS
Trigger: CGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCG...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TCATTGATATTCAAAGATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAACCACTTGCATTCCTaGGGGCGTGAGGCTGTGTGT +
Preference number: 2 (lower is better)
Translates to: SLIFKDGFFSCPGRASVTNHLHS*GREAVC
Trigger: ACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTT...AGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATCTTTGAATATCAATGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp TCATTGATATTCAAAGATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 2 (lower is better)
Translates to: SLIFKDGFFSCPGRASVTAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...AGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATCTTTGAATATCAATGA
46% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCCTGGCATATAGGCCCTaGAGTTCTGACCAGATATGC +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLLAYRP*SSDQIC
Trigger: GCATATCTGGTCAGAACTGCAGGGCCTATATGCCAG...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTGATGGCGGTGGCTGCTaGTTTGAATATGTTTTGGTT +
Preference number: 2 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILDGGGC*FEYVLV
Trigger: AACCAAAACATATTCAAAGCAGCAGCCACCGCCATC...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
44% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGATTGATATTCAAAGATaGGTTCTTTTCGTGTCCTGG +
Preference number: 2 (lower is better)
Translates to: TQRPTRFQTQGELLTISWIDIQR*VLFVSW
Trigger: CCAGGACACGAAAAGAACCCATCTTTGAATATCAAT...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCCCTCAACCACAAAACTaGAGCCCCAAGGAAATGAAG +
Preference number: 2 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLPQPQN*SPKEMK
Trigger: CTTCATTTCCTTGGGGCTGCAGTTTTGTGGTTGAGG...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR GCA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTACAGGCTTTAAAAGATaGTGCTTCCCTGTTTTCTTC +
Preference number: 2 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILTGFKR*CFPVFF
Trigger: GAAGAAAACAGGGAAGCAGCATCTTTTAAAGCCTGT...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
42% GC, longest homopolymer 4 nt, total homopolymer stretches 16 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CCA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGATTGATATTCAAAGATaGGTTCTTTTCGTGTCCTGG +
Preference number: 2 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKIDIQR*VLFVSW
Trigger: CCAGGACACGAAAAGAACCCATCTTTGAATATCAAT...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
42% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 72 bp CCAGCCGCACGGCCAGCCACCTGTTGGCCACGATGCTaGGGTAATAGGCCTTCTGGTTCTCGTCCACCTTCA +
Preference number: 3 (lower is better)
Translates to: PAARPATCWPRC*GNRPSGSRPPS
Trigger: TGAAGGTGGACGAGAACCAGAAGGCCTATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCGTGCGGCTGG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCGGGATGATGGTGATCTaGAAGCGGAGGTCGTGCAGG +
Preference number: 3 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEAGMMVI*KRRSCR
Trigger: CCTGCACGACCTCCGCTTCAAGATCACCATCATCCC...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 72 bp TCCACCTTCAGGTCACTCTGGTGGATGAAGCGCTCCTaGTCCTCGAAGGCTCGAATGACGCTGACCCCCAGC +
Preference number: 3 (lower is better)
Translates to: STFRSLWWMKRS*SSKARMTLTPS
Trigger: GCTGGGGGTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGTGGA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR CCA 72 bp GGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAG +
Preference number: 3 (lower is better)
Translates to: GRLGLPGVLTPP*ALAYRPCSSDQ
Trigger: CTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 72 bp GTTAGTCCAACCAGGTCCCTTCCAGGAGGACAGGCGTaGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGA +
Preference number: 3 (lower is better)
Translates to: VSPTRSLPGGQA*ECRGCLWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCTGTCCTCCTGGAAGGGACCTGGTTGGACTAAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 72 bp AGCCCCAGGTGGAACGTCGGCCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGT +
Preference number: 3 (lower is better)
Translates to: SPRWNVGPETIP*PYSSRSRLAVS
Trigger: ACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCACCTGGGGCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCAGGGTGTGCGTGTTTaGGGTGGTTCGCATCTCTGT +
Preference number: 3 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLQGVRV*GGSHLC
Trigger: ACAGAGATGCGAACCACCCAAAACACGCACACCCTG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTCGTGCAGGCCGATCTaGGCGATGTTGATGCCATCG +
Preference number: 3 (lower is better)
Translates to: RRGSAEAASGPKRELVELSCRPI*AMLMPS
Trigger: CGATGGCATCAACATCGCCAAGATCGGCCTGCACGA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR TCA 72 bp GGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGGCATATAGGCCCTGCA +
Preference number: 3 (lower is better)
Translates to: GFSVGGLVYQGY*LLPGRWHIGPA
Trigger: TGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR GCA 72 bp GCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATaGCAGCTCTGGGGCTCACACCAAGCCGGCGTCTTT +
Preference number: 3 (lower is better)
Translates to: ALAYRPCSSDQI*QLWGSHQAGVF
Trigger: AAAGACGCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 72 bp GTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTaGAGTTCTGACCAGATATGCCAGCTCTGGGGCTCA +
Preference number: 3 (lower is better)
Translates to: VLTPPWALAYRP*SSDQICQLWGS
Trigger: TGAGCCCCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR CCA 72 bp CTCTGCTGCAGGAGGTCCGATGGGGCGCCGTACTCCTaGATTTCTCCTTTGTCCAAGACGATCACCCTGAGG +
Preference number: 3 (lower is better)
Translates to: LCCRRSDGAPYS*ISPLSKTITLR
Trigger: CCTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAGCAGAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCCTGGAAGACCAGATGTaGGTAAGAGGACCATCCAGG +
Preference number: 3 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEALEDQM*VRGPSR
Trigger: CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAG...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp AGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCCAGGGACGTCCAGACTTCTGAGCCCATGAACATCTaGATGACCTCCGGGATCATG +
Preference number: 3 (lower is better)
Translates to: RADTKSFRWASSRDVQTSEPMNI*MTSGIM
Trigger: CATGATCCCGGAGGTCATCAAGATGTTCATGGGCTC...AGAAGTCTGGACGTCCCTGGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR CCA 72 bp GCCTTCTGGTTCTCGTCCACCTTCAGGTCACTCTGGTaGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATG +
Preference number: 3 (lower is better)
Translates to: AFWFSSTFRSLW*MKRSCSSKARM
Trigger: CATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGTGGACGAGAACCAGAAGGC
58% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGAAGCATCTCAAAGACTaGCAGTCCACAGACTTCGGC +
Preference number: 3 (lower is better)
Translates to: RRGSAEAASGPKRELVELKHLKD*QSTDFG
Trigger: GCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTT...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTGGAAGACCAGATGTaGGTAAGAGGACCATCCAGG +
Preference number: 3 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSLEDQM*VRGPSR
Trigger: CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGCAGTACACGGAAAGCTaGACCTGCCCTGTCTGCGCC +
Preference number: 3 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLQYTES*TCPVCA
Trigger: GGCGCAGACAGGGCAGGTCAAGCTTTCCGTGTACTG...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 72 bp CAGCCAGTTCCAGGCAGGGGACCGGATGGCGGTGGCTaGTGCTTTGAATATGTTTTGGTTGTCTGGGTTTGG +
Preference number: 3 (lower is better)
Translates to: QPVPGRGPDGGG*CFEYVLVVWVW
Trigger: CCAAACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCTGCCTGGAACTGGCTG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR GCA 72 bp GGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATaGTGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAG +
Preference number: 3 (lower is better)
Translates to: GPKRELVELALR*WFPAFECLEDQ
Trigger: CTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR GCA 72 bp AGCAAGTCTGAGTCTTGGGGCAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTGGGCTCTAACGAGACA +
Preference number: 3 (lower is better)
Translates to: SKSESWGSLSSG*LPDSTLGSNET
Trigger: TGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTCTTCCGGATTCCACTTaGGGCTCTAACGAGACACCT +
Preference number: 3 (lower is better)
Translates to: SGPKRELVELALRCWFPALPDST*GSNETP
Trigger: AGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAG...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR GCA 72 bp GAGCTGGCGCTGAGATGCTGGTTCCCAGCTTTTGAGTaGCTGGAAGACCAGATGTTGGTAAGAGGACCATCC +
Preference number: 3 (lower is better)
Translates to: ELALRCWFPAFE*LEDQMLVRGPS
Trigger: GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CCA 72 bp GCTGTAGAAAAGACCTCTCTGCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAA +
Preference number: 3 (lower is better)
Translates to: AVEKTSLLQEVR*GAVLLDFSFVQ
Trigger: TTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTTCTACAGC
56% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGCGGTGGCTGCTGCTTaGAATATGTTTTGGTTGTCT +
Preference number: 3 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPAVAAA*NMFWLS
Trigger: AGACAACCAAAACATATTCAAAGCAGCAGCCACCGC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
54% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTAAGCATCTCAAAGACTaGCAGTCCACAGACTTCGGC +
Preference number: 3 (lower is better)
Translates to: SGPKRELVELALRCWFPAKHLKD*QSTDFG
Trigger: GCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTT...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
54% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp CTGACACGAAGTCCTTCAGGTGGGCCAGCTCCAGGGACGTCCAGACTTCTTCATTCCACGGCCACGATGTaGGTTTCCATTTCAGATGAC +
Preference number: 3 (lower is better)
Translates to: LTRSPSGGPAPGTSRLLHSTATM*VSISDD
Trigger: GTCATCTGAAATGGAAACCAACATCGTGGCCGTGGA...ATGAAGAAGTCTGGACGTCCCTGGAGCTGGCCCACCTGAAGGACTTCGTGTCAG
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 72 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTaGAGTCCACAGACTTCGGCTGGAGAGATCCGAGGC +
Preference number: 3 (lower is better)
Translates to: LEVMGARSISKT*SPQTSAGEIRG
Trigger: GCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
54% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGCAGGGTGTGCGTGTTTaGGGTGGTTCGCATCTCTGT +
Preference number: 3 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRQGVRV*GGSHLC
Trigger: ACAGAGATGCGAACCACCCAAAACACGCACACCCTG...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAAAGCATCTCAAAGACTaGCAGTCCACAGACTTCGGC +
Preference number: 3 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGKHLKD*QSTDFG
Trigger: GCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTT...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGCTTCCGGATTCCACTTaGGGCTCTAACGAGACACCT +
Preference number: 3 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLLPDST*GSNETP
Trigger: AGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAG...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAAAGTTCTGCGGTGCTGTaGTGGTGCCTGCTGATGTCC +
Preference number: 3 (lower is better)
Translates to: QRPTRFQTQGELLTISWESSAVL*WCLLMS
Trigger: GGACATCAGCAGGCACCACAACAGCACCGCAGAACT...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp AGTGATCTCTACAACTTGCCCTTTCTGGCAACAGCTCCCACTAGAGGCGACTTGCAGGCACCAATGACGTaGAACAGGGAGCCCATGAAC +
Preference number: 3 (lower is better)
Translates to: SDLYNLPFLATAPTRGDLQAPMT*NREPMN
Trigger: GTTCATGGGCTCCCTGTTCAACGTCATTGGTGCCTG...CAAGTCGCCTCTAGTGGGAGCTGTTGCCAGAAAGGGCAAGTTGTAGAGATCACT
53% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp CGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACCCTGAGCCATTGATCGTGACATaGATGTGCCTGAGAACGAAG +
Preference number: 3 (lower is better)
Translates to: RWGAVLLDFSFVQDDHPEPLIVT*MCLRTK
Trigger: CTTCGTTCTCAGGCACATCAATGTCACGATCAATGG...CTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCG
53% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGCAGGGTGTGCGTGTTTaGGGTGGTTCGCATCTCTGT +
Preference number: 3 (lower is better)
Translates to: TQRPTRFQTQGELLTISWQGVRV*GGSHLC
Trigger: ACAGAGATGCGAACCACCCAAAACACGCACACCCTG...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
52% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTACAGGGTGTGCGTGTTTaGGGTGGTTCGCATCTCTGT +
Preference number: 3 (lower is better)
Translates to: AFRIPLWALTRHLKEQALQGVRV*GGSHLC
Trigger: ACAGAGATGCGAACCACCCAAAACACGCACACCCTG...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGAAGCATCTCAAAGACTaGCAGTCCACAGACTTCGGC +
Preference number: 3 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRKHLKD*QSTDFG
Trigger: GCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTT...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGCTGGAAGACCAGATGTaGGTAAGAGGACCATCCAGG +
Preference number: 3 (lower is better)
Translates to: TQRPTRFQTQGELLTISWLEDQM*VRGPSR
Trigger: CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAG...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
51% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TTTTCGCCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTTGCCCTGTCTGCGCCTaGTCAGCCTCCATCAGCTTC +
Preference number: 3 (lower is better)
Translates to: FSPKRKMLSGFEVGGVILCPVCA*SASISF
Trigger: GAAGCTGATGGAGGCTGACAAGGCGCAGACAGGGCA...AAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGGCGAAAA
51% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp CCTAAAAGAAAGATGCTCTCTGGGTTTGAAGTCGGCGGCGTAATTCTTAGCAAGCAGGGTGTGCGTGTTTaGGGTGGTTCGCATCTCTGT +
Preference number: 3 (lower is better)
Translates to: PKRKMLSGFEVGGVILSKQGVRV*GGSHLC
Trigger: ACAGAGATGCGAACCACCCAAAACACGCACACCCTG...CTTGCTAAGAATTACGCCGCCGACTTCAAACCCAGAGAGCATCTTTCTTTTAGG
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGAAGCATCTCAAAGACTaGCAGTCCACAGACTTCGGC +
Preference number: 3 (lower is better)
Translates to: TQRPTRFQTQGELLTISWKHLKD*QSTDFG
Trigger: GCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTT...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
50% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp AGTGATCTCTACAACTTGCCCTTTCTGGCAACAGCTCCCACTAGAGGCGACTTGACCTTTTCTCCCCCATaGATCGTGACATTGATGTGC +
Preference number: 3 (lower is better)
Translates to: SDLYNLPFLATAPTRGDLTFSPP*IVTLMC
Trigger: GCACATCAATGTCACGATCAATGGGGGAGAAAAGGT...CAAGTCGCCTCTAGTGGGAGCTGTTGCCAGAAAGGGCAAGTTGTAGAGATCACT
50% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR GCA 72 bp GATCTTCTATACAACCAATTCCTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGAAGCACCAGGAAACCA +
Preference number: 3 (lower is better)
Translates to: DLLYNQFLQKSG*QNSSVGSTRKP
Trigger: TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAATTGGTTGTATAGAAGATC
50% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCATTTGGTTTTTATGTTTaGGTTTCAGTGTGGGAGGCT +
Preference number: 3 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPFGFYV*VSVWEA
Trigger: AGCCTCCCACACTGAAACCAAAACATAAAAACCAAA...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
49% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCGGTGGCTGCTGCTTaGAATATGTTTTGGTTGTCT +
Preference number: 3 (lower is better)
Translates to: LEVMGARSISKTCSPQTSAVAAA*NMFWLS
Trigger: AGACAACCAAAACATATTCAAAGCAGCAGCCACCGC...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCGGCAGTAGGCTGAATTaGGTCACTAGGATCTTCTAT +
Preference number: 3 (lower is better)
Translates to: WFPAFECLEDQMLVRGPSGSRLN*VTRIFY
Trigger: ATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCC...GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGGGCAGTAGGCTGAATTaGGTCACTAGGATCTTCTAT +
Preference number: 3 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRGSRLN*VTRIFY
Trigger: ATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCC...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
49% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCCTTCCGGATTCCACTTaGGGCTCTAACGAGACACCT +
Preference number: 3 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLLPDST*GSNETP
Trigger: AGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAG...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
49% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGTTTGGTTTTTATGTTTaGGTTTCAGTGTGGGAGGCT +
Preference number: 3 (lower is better)
Translates to: PEASQRLAVHRLRLERSEFGFYV*VSVWEA
Trigger: AGCCTCCCACACTGAAACCAAAACATAAAAACCAAA...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
48% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAAGGCAGTAGGCTGAATTaGGTCACTAGGATCTTCTAT +
Preference number: 3 (lower is better)
Translates to: QRPTRFQTQGELLTISWEGSRLN*VTRIFY
Trigger: ATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCC...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
48% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCAACAGAACGATGCAGTaGCCCACACACTCCAGCCGC +
Preference number: 3 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLNRTMQ*PTHSSR
Trigger: GCGGCTGGAGTGTGTGGGCAACTGCATCGTTCTGTT...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCGTCTCTGAATACTCCTaGAGCCTCTCCACGGCCACG +
Preference number: 3 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLVSEYS*SLSTAT
Trigger: CGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGAC...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
48% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGTTACTTCTCGCGGTGGCTGCTGCTTaGAATATGTTTTGGTTGTCT +
Preference number: 3 (lower is better)
Translates to: TVSNTGRASHYFLGMLLLAVAAA*NMFWLS
Trigger: AGACAACCAAAACATATTCAAAGCAGCAGCCACCGC...GAGAAGTAACATTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGT
47% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR TCA 72 bp CACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTaGATTTGGTCACTAGGATCTTCTATACAACCAATT +
Preference number: 3 (lower is better)
Translates to: HRLRLERSEAVG*IWSLGSSIQPI
Trigger: AATTGGTTGTATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTG
47% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGATTTGGTTTTTATGTTTaGGTTTCAGTGTGGGAGGCT +
Preference number: 3 (lower is better)
Translates to: TETNTVSNTGRASHYFLGFGFYV*VSVWEA
Trigger: AGCCTCCCACACTGAAACCAAAACATAAAAACCAAA...TCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp ACACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGTTTGGTTTTTATGTTTaGGTTTCAGTGTGGGAGGCT +
Preference number: 3 (lower is better)
Translates to: TQRPTRFQTQGELLTISWFGFYV*VSVWEA
Trigger: AGCCTCCCACACTGAAACCAAAACATAAAAACCAAA...CCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTGT
46% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCCTGGAAGACCAGATGTaGGTAAGAGGACCATCCAGG +
Preference number: 3 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLLEDQM*VRGPSR
Trigger: CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAG...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
46% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCAAGCATCTCAAAGACTaGCAGTCCACAGACTTCGGC +
Preference number: 3 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLKHLKD*QSTDFG
Trigger: GCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTT...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
44% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCGCGGTGGCTGCTGCTTaGAATATGTTTTGGTTGTCT +
Preference number: 3 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLAVAAA*NMFWLS
Trigger: AGACAACCAAAACATATTCAAAGCAGCAGCCACCGC...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
43% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp GATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTAAATATCAAGTTCTCGGCAGTAGGCTGAATTaGGTCACTAGGATCTTCTAT +
Preference number: 3 (lower is better)
Translates to: DGFFSCPGRASVTKYQVLGSRLN*VTRIFY
Trigger: ATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCC...GAGAACTTGATATTTAGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATC
42% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TCATTGATATTCAAAGATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTGGCAGTAGGCTGAATTaGGTCACTAGGATCTTCTAT +
Preference number: 3 (lower is better)
Translates to: SLIFKDGFFSCPGRASVTGSRLN*VTRIFY
Trigger: ATAGAAGATCCTAGTGACCAAATTCAGCCTACTGCC...AGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATCTTTGAATATCAATGA
41% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR-3UTR CAA 90 bp TCATTGATATTCAAAGATGGGTTCTTTTCGTGTCCTGGAAGAGCATCAGTAACTTTTGGTTTTTATGTTTaGGTTTCAGTGTGGGAGGCT +
Preference number: 3 (lower is better)
Translates to: SLIFKDGFFSCPGRASVTFGFYV*VSVWEA
Trigger: AGCCTCCCACACTGAAACCAAAACATAAAAACCAAA...AGTTACTGATGCTCTTCCAGGACACGAAAAGAACCCATCTTTGAATATCAATGA
39% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
66% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
66% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGCGTGCAGACCCAGGTaGAGGTGCCCACGGCTGACA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGACRPR*RCPRLT
Trigger: TGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASCPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCGGAGCCATCGGCGCTaGAGAAGCCCCGGAGCGCCA +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSRSHRR*RSPGAP
Trigger: TGGCGCTCCGGGGCTTCTGCAGCGCCGATGGCTCCG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
64% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASPGASC*AELSPG
Trigger: TCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
64% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWASTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
64% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
64% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGCGTGCAGACCCAGGTaGAGGTGCCCACGGCTGACA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWACRPR*RCPRLT
Trigger: TGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
63% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTGGCATTCCTCACGGTaGTGCTGTTCGTGCCCCCGC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGWHSSR*CCSCPR
Trigger: GCGGGGGCACGAACAGCATCACCGTGAGGAATGCCA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDRSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
63% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGA +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRPGASC*AELSPG
Trigger: TCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGA +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSPGASC*AELSPG
Trigger: TCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAPGASC*AELSPG
Trigger: TCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGCTAGGCACACAAGCTaGCGCTGCCCGACACTGAGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGARHTS*RCPTLR
Trigger: CCTCAGTGTCGGGCAGCGCCAGCTTGTGTGCCTAGC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGDHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
63% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
63% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTGCAGAGGACATGGCTaGAACCCTCGCCGAGGCCCC +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELCRGHG*NPRRGP
Trigger: GGGGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
63% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTGCAGAGGACATGGCTaGAACCCTCGCCGAGGCCCC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASCRGHG*NPRRGP
Trigger: GGGGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
63% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTCAGCTCCTCCTGCCTaGTGGCCAGCACCTTGTCCT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDSAPPA*WPAPCP
Trigger: AGGACAAGGTGCTGGCCATCAGGCAGGAGGAGCTGA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAGGTCCGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACTGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: EVRWGAVLLDFSFVQDDHCPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...GTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp GGCGGGATGATGATGGCGGCGATGGGCGTGGCCAGCAGGATAACGATGCAGGCACGGGGATGGAGAAGGTaGTGCCATTCAGTGTGGGAG +
Preference number: 4 (lower is better)
Translates to: GGMMMAAMGVASRITMQARGWRR*CHSVWE
Trigger: CTCCCACACTGAATGGCATCACCTTCTCCATCCCCG...TGCCTGCATCGTTATCCTGCTGGCCACGCCCATCGCCGCCATCATCATCCCGCC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAGGTCCGATGGGGCGCCGTACTCCTGGATTTCTCCTTTGTCCAAGACGATCACAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: EVRWGAVLLDFSFVQDDHRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...GTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCTC
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACGGAGCCATCGGCGCTaGAGAAGCCCCGGAGCGCCA +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPRSHRR*RSPGAP
Trigger: TGGCGCTCCGGGGCTTCTGCAGCGCCGATGGCTCCG...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGACGGAGCCATCGGCGCTaGAGAAGCCCCGGAGCGCCA +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGRSHRR*RSPGAP
Trigger: TGGCGCTCCGGGGCTTCTGCAGCGCCGATGGCTCCG...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCCAGGCCGTCGCTCGATaGTGTCAGGTTCCAGCTCCT +
Preference number: 4 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEAQAVAR*CQVPAP
Trigger: AGGAGCTGGAACCTGACAGCATCGAGCGACGGCCTG...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTGCAGCAGGTCCACGTaGAGACAGCGGGAAGCCAAG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGCSRST*RQREAK
Trigger: CTTGGCTTCCCGCTGTCTGCACGTGGACCTGCTGCA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTGCAGCAGGTCCACGTaGAGACAGCGGGAAGCCAAG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDCSRST*RQREAK
Trigger: CTTGGCTTCCCGCTGTCTGCACGTGGACCTGCTGCA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGGAAGCGCTGGACTCTaGGCAGGGATTAGGGTCGTG +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLGSAGL*AGIRVV
Trigger: CACGACCCTAATCCCTGCCCAGAGTCCAGCGCTTCC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
62% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
62% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATGGTGTTGAGCCGGTaGGCGATGGTGAGGACGGTG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGMVLSR*AMVRTV
Trigger: CACCGTCCTCACCATCGCCCACCGGCTCAACACCAT...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
62% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
62% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GGCGGGATGATGATGGCGGCGATGGGCGTGGCCAGCAGGATAACGATGCAGGCACCTTCTGTGGGGACTTaGCGATCAAAGCCTCCACCT +
Preference number: 4 (lower is better)
Translates to: GGMMMAAMGVASRITMQAPSVGT*RSKPPP
Trigger: AGGTGGAGGCTTTGATCGTCAAGTCCCCACAGAAGG...TGCCTGCATCGTTATCCTGCTGGCCACGCCCATCGCCGCCATCATCATCCCGCC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACACGTGGCCAAGTCCATaGACCTCTGAGCGTCCACAG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDTWPSP*TSERPQ
Trigger: CTGTGGACGCTCAGAGGTTCATGGACTTGGCCACGT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGTCAGCTCCTCCTGCCTaGTGGCCAGCACCTTGTCCT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWSAPPA*WPAPCP
Trigger: AGGACAAGGTGCTGGCCATCAGGCAGGAGGAGCTGA...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGAAGGTGCCCACGGCTaGCAGGTAGGCAGACTTCTT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDEGAHG*QVGRLL
Trigger: AAGAAGTCTGCCTACCTGTCAGCCGTGGGCACCTTC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCGTGCAGACCCAGGTaGAGGTGCCCACGGCTGACA +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGACRPR*RCPRLT
Trigger: TGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGC...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGAGATCCTCAGGCGTTTaGGGGAGACACTCGCCTGCA +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLRSSGV*GRHSPA
Trigger: TGCAGGCGAGTGTCTCCCTCAAACGCCTGAGGATCT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGTGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLCPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCACGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPRSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCGGGGATGGAGAAGGTaGTGCCATTCAGTGTGGGAG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDRGWRR*CHSVWE
Trigger: CTCCCACACTGAATGGCATCACCTTCTCCATCCCCG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGGGGATGGAGAAGGTaGTGCCATTCAGTGTGGGAG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRGWRR*CHSVWE
Trigger: CTCCCACACTGAATGGCATCACCTTCTCCATCCCCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACAGGAGGAGGAGCTGCTaGGCTGTCTCTGCAGTTGCT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDRRRSC*AVSAVA
Trigger: AGCAACTGCAGAGACAGCTCAGCAGCTCCTCCTCCT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLTFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGTFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCACGGCGATCCCTTGTaGAATGCCCAGGGCTCCATA +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDHGDPL*NAQGSI
Trigger: TATGGAGCCCTGGGCATTTCACAAGGGATCGCCGTG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGAAGATGCCACATCCTaGCCCTGCAGAGGACATGGC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGEDATS*PCRGHG
Trigger: GCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTTC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGCGGAGCCATCGGCGCTaGAGAAGCCCCGGAGCGCCA +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLRSHRR*RSPGAP
Trigger: TGGCGCTCCGGGGCTTCTGCAGCGCCGATGGCTCCG...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGTGGGTGACCGCAGGATaGTGTGCAGCAGGTCCACGT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWWVTAG*CAAGPR
Trigger: ACGTGGACCTGCTGCACAGCATCCTGCGGTCACCCA...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GGCGGGATGATGATGGCGGCGATGGGCGTGGCCAGCAGGATAACGATGCAGGCATGGATGAAGCGCTCCTaGTCCTCGAAGGCTCGAATG +
Preference number: 4 (lower is better)
Translates to: GGMMMAAMGVASRITMQAWMKRS*SSKARM
Trigger: CATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCA...TGCCTGCATCGTTATCCTGCTGGCCACGCCCATCGCCGCCATCATCATCCCGCC
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCCAGCACTGAGGCTGTaGCTGGAGATCACCGCAAAC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGPALRL*LEITAN
Trigger: GTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTTGAAGCGGAGGTCGTaGAGGCCGATCTTGGCGATG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGLKRRS*RPILAM
Trigger: CATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGCACACAAGCTGGCGCTaGCCGACACTGAGGTTCTCC +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELHTSWR*PTLRFS
Trigger: GGAGAACCTCAGTGTCGGGCAGCGCCAGCTTGTGTG...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCACACAAGCTGGCGCTaGCCGACACTGAGGTTCTCC +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWHTSWR*PTLRFS
Trigger: GGAGAACCTCAGTGTCGGGCAGCGCCAGCTTGTGTG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACAAAAGACCTCTCTGCTaGAGGAGGTCCGATGGGGCG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDKRPLC*RRSDGA
Trigger: CGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTGGGAGTGCAGAGGCTaGCTCTGGCCCAAAACGAGA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGWECRG*LWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGCTGCCGTTCTCCTCTaGATCCTGCTCCTGCTCTGT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDAAVLL*ILLLLC
Trigger: ACAGAGCAGGAGCAGGATGCAGAGGAGAACGGCAGC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000399408.7
ENST00000621659.2
ENST00000622828.3
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGGAAGCGCTGGACTCTaGGCAGGGATTAGGGTCGTG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWGSAGL*AGIRVV
Trigger: CACGACCCTAATCCCTGCCCAGAGTCCAGCGCTTCC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGTAGCCCTGCCAGTCTaGGGCCTTCGTGTCATTCAC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGVALPV*GLRVIH
Trigger: GTGAATGACACGAAGGCCCCAGACTGGCAGGGCTAC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCTGTCCGATCCCCACTaGGCAGGATTTCCAGGTCTG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGLSDPH*AGFPGL
Trigger: CAGACCTGGAAATCCTGCCCAGTGGGGATCGGACAG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCTGTCCGATCCCCACTaGGCAGGATTTCCAGGTCTG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDLSDPH*AGFPGL
Trigger: CAGACCTGGAAATCCTGCCCAGTGGGGATCGGACAG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGGTAAATGTCAGCGTTaGAGTACACGGCCCGGGCCA +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLGKCQR*STRPGP
Trigger: TGGCCCGGGCCGTGTACTCCAACGCTGACATTTACC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCTTTGCTTCCTTCCCTaGACCGCTGACGCCCGTGAC +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWLCFLP*TADARD
Trigger: GTCACGGGCGTCAGCGGTCCAGGGAAGGAAGCAAAG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTCTGCGGTGCTGTTGTaGTGCCTGCTGATGTCCCCA +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLSAVLL*CLLMSP
Trigger: TGGGGACATCAGCAGGCACCACAACAGCACCGCAGA...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASRPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWRPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGCTAGGCACACAAGCTaGCGCTGCCCGACACTGAGG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRARHTS*RCPTLR
Trigger: CCTCAGTGTCGGGCAGCGCCAGCTTGTGTGCCTAGC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGTCCGGATGGTGGACTaGATGAGGTCGTCCGTTTCC +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDVRMVD*MRSSVS
Trigger: GGAAACGGACGACCTCATCCAGTCCACCATCCGGAC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp CCAGTACACGGAAAGCTTGACCTGCCCTGTCTGCGCCTTGTCAGCCTCCATCAGCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGAT +
Preference number: 4 (lower is better)
Translates to: PVHGKLDLPCLRLVSLHQLQEVR*GAVLLD
Trigger: ATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAG...CTGATGGAGGCTGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGTGTACTGG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCAGATATGCCAGCTCTaGGGCTCACACCAAGCCGGC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASQICQL*GSHQAG
Trigger: GCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASVLTPP*ALAYRP
Trigger: GGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
61% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWADHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GTCACTCTGGTGGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATGACGCTGACGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 4 (lower is better)
Translates to: VTLVDEALLLLEGSNDADDHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...GTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGAC
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
61% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGATGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACAGCAAGTCTGAGTCTTaGGGCAGCCTCAGCTCTGGC +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDSKSES*GSLSSG
Trigger: GCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCAGCAAGTCTGAGTCTTaGGGCAGCCTCAGCTCTGGC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGSKSES*GSLSSG
Trigger: GCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
61% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGCTGGTATTCCACGTaGCATTCCAGTCCCAGAGCG +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLCWYST*HSSPRA
Trigger: CGCTCTGGGACTGGAATGTCACGTGGAATACCAGCA...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCCTTCTGTGGGGACTTaGCGATCAAAGCCTCCACCT +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLPSVGT*RSKPPP
Trigger: AGGTGGAGGCTTTGATCGTCAAGTCCCCACAGAAGG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTCAGCTCCTCCTGCCTaGTGGCCAGCACCTTGTCCT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWASAPPA*WPAPCP
Trigger: AGGACAAGGTGCTGGCCATCAGGCAGGAGGAGCTGA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GTCACTCTGGTGGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATGACGCTGACTCAGCTCCTCCTGCCTaGTGGCCAGCACCTTGTCCT +
Preference number: 4 (lower is better)
Translates to: VTLVDEALLLLEGSNDADSAPPA*WPAPCP
Trigger: AGGACAAGGTGCTGGCCATCAGGCAGGAGGAGCTGA...GTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGAC
60% GC, longest homopolymer 2 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGAAGGTGCCCACGGCTaGCAGGTAGGCAGACTTCTT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWEGAHG*QVGRLL
Trigger: AAGAAGTCTGCCTACCTGTCAGCCGTGGGCACCTTC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAGCGTGCAGACCCAGGTaGAGGTGCCCACGGCTGACA +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPACRPR*RCPRLT
Trigger: TGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGC...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGAGATCCTCAGGCGTTTaGGGGAGACACTCGCCTGCA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWRSSGV*GRHSPA
Trigger: TGCAGGCGAGTGTCTCCCTCAAACGCCTGAGGATCT...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGTGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPCPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGTGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: PEASQRLAVHRLRLERSECPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTTGGCATTCCTCACGGTaGTGCTGTTCGTGCCCCCGC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAWHSSR*CCSCPR
Trigger: GCGGGGGCACGAACAGCATCACCGTGAGGAATGCCA...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCGGGGATGGAGAAGGTaGTGCCATTCAGTGTGGGAG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWRGWRR*CHSVWE
Trigger: CTCCCACACTGAATGGCATCACCTTCTCCATCCCCG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCAGCTCATGCTGTGCGTaGCCAAGATCCGCGTCTTGT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGSSCCA*PRSASC
Trigger: ACAAGACGCGGATCTTGGTCACGCACAGCATGAGCT...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTGTTGTGGTGCCTGCTaGTGTCCCCACTATAGGAGG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDCCGAC*CPHYRR
Trigger: CCTCCTATAGTGGGGACATCAGCAGGCACCACAACA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCTGTTGTGGTGCCTGCTaGTGTCCCCACTATAGGAGG +
Preference number: 4 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEACCGAC*CPHYRR
Trigger: CCTCCTATAGTGGGGACATCAGCAGGCACCACAACA...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELTFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGGTCACTCTGGTGGATaGAGCGCTCCTGCTCCTCGA +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPGHSGG*SAPAPR
Trigger: TCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGGTCACTCTGGTGGATaGAGCGCTCCTGCTCCTCGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAGHSGG*SAPAPR
Trigger: TCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGGTCACTCTGGTGGATaGAGCGCTCCTGCTCCTCGA +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSGHSGG*SAPAPR
Trigger: TCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCTTCGGCAGACTCGTTaGTCCGAAATAAGCCCAGGG +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLLRQTR*SEISPG
Trigger: CCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCTTCGGCAGACTCGTTaGTCCGAAATAAGCCCAGGG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDLRQTR*SEISPG
Trigger: CCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGGATGGTGGACTGGATaGGGTCGTCCGTTTCCAGGT +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASGWWTG*GRPFPG
Trigger: ACCTGGAAACGGACGACCTCATCCAGTCCACCATCC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCAGGCCGTCGCTCGATaGTGTCAGGTTCCAGCTCCT +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRQAVAR*CQVPAP
Trigger: AGGAGCTGGAACCTGACAGCATCGAGCGACGGCCTG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTTCTCCTCTGCATCCTaGTCCTGCTCTGTGCTGGCA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGFSSAS*SCSVLA
Trigger: TGCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTTCTCCTCTGCATCCTaGTCCTGCTCTGTGCTGGCA +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDFSSAS*SCSVLA
Trigger: TGCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTTCTCCTCTGCATCCTaGTCCTGCTCTGTGCTGGCA +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLFSSAS*SCSVLA
Trigger: TGCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAA...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCTGCAGTTGCTTCCCTaGACTGTCCGTCACCAGCAT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDLQLLP*TVRHQH
Trigger: ATGCTGGTGACGGACAGTGCAGGGAAGCAACTGCAG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCTGCAGTTGCTTCCCTaGACTGTCCGTCACCAGCAT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGLQLLP*TVRHQH
Trigger: ATGCTGGTGACGGACAGTGCAGGGAAGCAACTGCAG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCCTGCTGAGCTGTCTCTaGAGTTGCTTCCCTGCACTG +
Preference number: 4 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEALLSCL*SCFPAL
Trigger: CAGTGCAGGGAAGCAACTGCAGAGACAGCTCAGCAG...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000677164.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGATCCCTTGTGAAATaGCCAGGGCTCCATAGACGC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRSLVK*PGLHRR
Trigger: GCGTCTATGGAGCCCTGGGCATTTCACAAGGGATCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTGCAGCAGGTCCACGTaGAGACAGCGGGAAGCCAAG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWACSRST*RQREAK
Trigger: CTTGGCTTCCCGCTGTCTGCACGTGGACCTGCTGCA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCATGGGTGACCGCAGGATaGTGTGCAGCAGGTCCACGT +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPWVTAG*CAAGPR
Trigger: ACGTGGACCTGCTGCACAGCATCCTGCGGTCACCCA...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTGGGTGACCGCAGGATaGTGTGCAGCAGGTCCACGT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAWVTAG*CAAGPR
Trigger: ACGTGGACCTGCTGCACAGCATCCTGCGGTCACCCA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTGGATGAAGCGCTCCTaGTCCTCGAAGGCTCGAATG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDWMKRS*SSKARM
Trigger: CATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTGGATGAAGCGCTCCTaGTCCTCGAAGGCTCGAATG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGWMKRS*SSKARM
Trigger: CATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACACAGAACGATGCAGTTaGCCACACACTCCAGCCGCA +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDTERCS*PHTPAA
Trigger: TGCGGCTGGAGTGTGTGGGCAACTGCATCGTTCTGT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCCAGCACTGAGGCTGTaGCTGGAGATCACCGCAAAC +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWPALRL*LEITAN
Trigger: GTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCACACAAGCTGGCGCTaGCCGACACTGAGGTTCTCC +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAHTSWR*PTLRFS
Trigger: GGAGAACCTCAGTGTCGGGCAGCGCCAGCTTGTGTG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGA +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGLQKSG*QNSSVG
Trigger: TCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTGGGAGTGCAGAGGCTaGCTCTGGCCCAAAACGAGA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASWECRG*LWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGCTGCCGTTCTCCTCTaGATCCTGCTCCTGCTCTGT +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASAAVLL*ILLLLC
Trigger: ACAGAGCAGGAGCAGGATGCAGAGGAGAACGGCAGC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000399408.7
ENST00000621659.2
ENST00000622828.3
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCTGTCCGATCCCCACTaGGCAGGATTTCCAGGTCTG +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASLSDPH*AGFPGL
Trigger: CAGACCTGGAAATCCTGCCCAGTGGGGATCGGACAG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGGGTAAATGTCAGCGTTaGAGTACACGGCCCGGGCCA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELGKCQR*STRPGP
Trigger: TGGCCCGGGCCGTGTACTCCAACGCTGACATTTACC...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 5 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGGTAAATGTCAGCGTTaGAGTACACGGCCCGGGCCA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWGKCQR*STRPGP
Trigger: TGGCCCGGGCCGTGTACTCCAACGCTGACATTTACC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
CDS-3UTR CCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCACTTTGCTTCCTTCCCTaGACCGCTGACGCCCGTGAC +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPLCFLP*TADARD
Trigger: GTCACGGGCGTCAGCGGTCCAGGGAAGGAAGCAAAG...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTCTGCGGTGCTGTTGTaGTGCCTGCTGATGTCCCCA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELSAVLL*CLLMSP
Trigger: TGGGGACATCAGCAGGCACCACAACAGCACCGCAGA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGCGATGGACACGGCCATaGAGTAGCCAAACACGGCGA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELRWTRP*SSQTRR
Trigger: TCGCCGTGTTTGGCTACTCCATGGCCGTGTCCATCG...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCGATGGACACGGCCATaGAGTAGCCAAACACGGCGA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWRWTRP*SSQTRR
Trigger: TCGCCGTGTTTGGCTACTCCATGGCCGTGTCCATCG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGACCTTCAGGTCACTCTaGTGGATGAAGCGCTCCTGC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLTFRSL*WMKRSC
Trigger: GCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACACCTTCAGGTCACTCTaGTGGATGAAGCGCTCCTGC +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDTFRSL*WMKRSC
Trigger: GCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCACGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPRPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWARPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGCCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGA +
Preference number: 4 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPPGASC*AELSPG
Trigger: TCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGG...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: WFPAFECLEDQMLVRGPSSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp ACGATGCCGACCTTTTCTCCCCCATTGATCGTGACATTGATGTGCCTGAGAACGTCCACTCGGCCCACCTaGGGCCAGCTGCTGGGCGGA +
Preference number: 4 (lower is better)
Translates to: TMPTFSPPLIVTLMCLRTSTRPT*GQLLGG
Trigger: TCCGCCCAGCAGCTGGCCCCAGGTGGGCCGAGTGGA...CGTTCTCAGGCACATCAATGTCACGATCAATGGGGGAGAAAAGGTCGGCATCGT
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGGTCCACGGCTGCCGTaGCCTCATCCAACACAAGGA +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRGPRLP*PHPTQG
Trigger: TCCTTGTGTTGGATGAGGCCACGGCAGCCGTGGACC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGATGGTGTTGAGCCGGTaGGCGATGGTGAGGACGGTG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAMVLSR*AMVRTV
Trigger: CACCGTCCTCACCATCGCCCACCGGCTCAACACCAT...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTATGGTGTTGAGCCGGTaGGCGATGGTGAGGACGGTG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRMVLSR*AMVRTV
Trigger: CACCGTCCTCACCATCGCCCACCGGCTCAACACCAT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGAT +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGLQEVR*GAVLLD
Trigger: ATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCAGATATGCCAGCTCTaGGGCTCACACCAAGCCGGC +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAQICQL*GSHQAG
Trigger: GCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGTACACGGAAAGCTTGACCTGCCCTGTCTGCGCCTTGTCAGCCTCCATCAGCAGATATGCCAGCTCTaGGGCTCACACCAAGCCGGC +
Preference number: 4 (lower is better)
Translates to: PVHGKLDLPCLRLVSLHQQICQL*GSHQAG
Trigger: GCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTG...CTGATGGAGGCTGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGTGTACTGG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGTACTGACTCCTCCCTaGGCGCTGGCATATAGGCCC +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSVLTPP*ALAYRP
Trigger: GGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTAC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
60% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGCCAAAACTCCTCCGTaGGAAGCACCAGGAAACCAC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGAKTPP*EAPGNH
Trigger: GTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
60% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCAGCAAGTCTGAGTCTTaGGGCAGCCTCAGCTCTGGC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASSKSES*GSLSSG
Trigger: GCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
60% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
3UTR CAA 72 bp AGGTCCGATGGGGCGCCGTACTCCTGGATTTCTCCTTaGTCCAAGACGATCACCCTGAGGTTCTCCCCGCCT +
Preference number: 4 (lower is better)
Translates to: RSDGAPYSWISP*SKTITLRFSPP
Trigger: AGGCGGGGAGAACCTCAGGGTGATCGTCTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCCATCGGACCT
60% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCCAGGGACGTCCAGACTTCTTGCTGGTATTCCACGTaGCATTCCAGTCCCAGAGCG +
Preference number: 4 (lower is better)
Translates to: RADTKSFRWASSRDVQTSCWYST*HSSPRA
Trigger: CGCTCTGGGACTGGAATGTCACGTGGAATACCAGCA...AGAAGTCTGGACGTCCCTGGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCCTTCTGTGGGGACTTaGCGATCAAAGCCTCCACCT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWPSVGT*RSKPPP
Trigger: AGGTGGAGGCTTTGATCGTCAAGTCCCCACAGAAGG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAAGATCCTCAGGCGTTTaGGGGAGACACTCGCCTGCA +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPRSSGV*GRHSPA
Trigger: TGCAGGCGAGTGTCTCCCTCAAACGCCTGAGGATCT...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGTGGCATTCCTCACGGTaGTGCTGTTCGTGCCCCCGC +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLWHSSR*CCSCPR
Trigger: GCGGGGGCACGAACAGCATCACCGTGAGGAATGCCA...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGCGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLRSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCCTCGAAGGCTCGAATGACGCTGACCCCCAGCAAGGTCTCGTTGAAATGGGAACGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: SSKARMTLTPSKVSLKWERSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...TTCCCATTTCAACGAGACCTTGCTGGGGGTCAGCGTCATTCGAGCCTTCGAGGA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGATGGGCATCCACTGCTaGGAGGGGATCATCGAAGAG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWMGIHC*EGIIEE
Trigger: CTCTTCGATGATCCCCTCTCAGCAGTGGATGCCCAT...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCATGGGCATCCACTGCTaGGAGGGGATCATCGAAGAG +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASMGIHC*EGIIEE
Trigger: CTCTTCGATGATCCCCTCTCAGCAGTGGATGCCCAT...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
CDS-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTAGGAGGAGGAGCTGCTaGGCTGTCTCTGCAGTTGCT +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRRRRSC*AVSAVA
Trigger: AGCAACTGCAGAGACAGCTCAGCAGCTCCTCCTCCT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGAGGAGGAGGAGCTGCTaGGCTGTCTCTGCAGTTGCT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWARRRSC*AVSAVA
Trigger: AGCAACTGCAGAGACAGCTCAGCAGCTCCTCCTCCT...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPTFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGCGGTGCTGTTGTGGTGCCTGCTGATGTCCCCACTATAGGAGGAGGAGCTGCTACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 4 (lower is better)
Translates to: CGAVVVPADVPTIGGGAATFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...AGCAGCTCCTCCTCCTATAGTGGGGACATCAGCAGGCACCACAACAGCACCGCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCACGGCGATCCCTTGTaGAATGCCCAGGGCTCCATA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAHGDPL*NAQGSI
Trigger: TATGGAGCCCTGGGCATTTCACAAGGGATCGCCGTG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCCAGCAAGGTCTCGTTaGAATGGGAATAGACCGGGG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWPARSR*NGNRPG
Trigger: CCCCGGTCTATTCCCATTTCAACGAGACCTTGCTGG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGTCTCTGAATACTCCTTaGGCCTCTCCACGGCCACGA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWSLNTP*ASPRPR
Trigger: TCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGA...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCTTCGGCAGACTCGTTaGTCCGAAATAAGCCCAGGG +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASLRQTR*SEISPG
Trigger: CCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGGATGGTGGACTGGATaGGGTCGTCCGTTTCCAGGT +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPGWWTG*GRPFPG
Trigger: ACCTGGAAACGGACGACCTCATCCAGTCCACCATCC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCCTCGAAGGCTCGAATGACGCTGACCCCCAGCAAGGTCTCGTTGAAATGGGAAGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 4 (lower is better)
Translates to: SSKARMTLTPSKVSLKWEVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...TTCCCATTTCAACGAGACCTTGCTGGGGGTCAGCGTCATTCGAGCCTTCGAGGA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCTGGTTCCCAGCTTTTaGGTGCCTGGAAGACCAGAT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDLVPSF*VPGRPD
Trigger: ATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDDALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCAGGCCGTCGCTCGATaGTGTCAGGTTCCAGCTCCT +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGQAVAR*CQVPAP
Trigger: AGGAGCTGGAACCTGACAGCATCGAGCGACGGCCTG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCCTGCTCCTGCTCTGTaGTGGCATAGGTACGCAGGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAPAPAL*WHRYAG
Trigger: TCCTGCGTACCTATGCCAGCACAGAGCAGGAGCAGG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTTCTCCTCTGCATCCTaGTCCTGCTCTGTGCTGGCA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELFSSAS*SCSVLA
Trigger: TGCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTTCTCCTCTGCATCCTaGTCCTGCTCTGTGCTGGCA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASFSSAS*SCSVLA
Trigger: TGCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGACCCCGTTCTCCTCTaGATCCTGCTCCTGCTCTGT +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRDPVLL*ILLLLC
Trigger: ACAGAGCAGGAGCAGGATGCAGAGGAGAACGGGGTC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 5 transcripts:
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCTGCAGTTGCTTCCCTaGACTGTCCGTCACCAGCAT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWLQLLP*TVRHQH
Trigger: ATGCTGGTGACGGACAGTGCAGGGAAGCAACTGCAG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCTGCTGAGCTGTCTCTaGAGTTGCTTCCCTGCACTG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWLLSCL*SCFPAL
Trigger: CAGTGCAGGGAAGCAACTGCAGAGACAGCTCAGCAG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTTGGCCTCAGCTTTCTaGAGTTCTGCGGTGCTGTTG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDLASAF*SSAVLL
Trigger: CAACAGCACCGCAGAACTGCAGAAAGCTGAGGCCAA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCACGGAAAGCTTGACCTaGCCTGTCTGCGCCTTGTCA +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASTESLT*PVCALS
Trigger: TGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGT...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTGGATGAAGCGCTCCTaGTCCTCGAAGGCTCGAATG +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASWMKRS*SSKARM
Trigger: CATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACACCTGTTGGCCACGATaGTGGGGTAATAGGCCTTCT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDTCWPR*WGNRPS
Trigger: AGAAGGCCTATTACCCCAGCATCGTGGCCAACAGGT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGACAGAACGATGCAGTTaGCCACACACTCCAGCCGCA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELTERCS*PHTPAA
Trigger: TGCGGCTGGAGTGTGTGGGCAACTGCATCGTTCTGT...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCACCAGCACTGAGGCTGTaGCTGGAGATCACCGCAAAC +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPPALRL*LEITAN
Trigger: GTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGG...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCCGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 4 (lower is better)
Translates to: WSSLSGRADTKSFRWASSAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...GGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCCCACCTGGGGCCAGCTaGTGGGCGGAGCTGTCTCCT +
Preference number: 4 (lower is better)
Translates to: WFPAFECLEDQMLVRGPSPPGAS*WAELSP
Trigger: AGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGGTGG...GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTTGAAGCGGAGGTCGTaGAGGCCGATCTTGGCGATG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWALKRRS*RPILAM
Trigger: CATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTCACACAAGCTGGCGCTaGCCGACACTGAGGTTCTCC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAHTSWR*PTLRFS
Trigger: GGAGAACCTCAGTGTCGGGCAGCGCCAGCTTGTGTG...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTAAAAGACCTCTCTGCTaGAGGAGGTCCGATGGGGCG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRKRPLC*RRSDGA
Trigger: CGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 17 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAAAAAGACCTCTCTGCTaGAGGAGGTCCGATGGGGCG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPKRPLC*RRSDGA
Trigger: CGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTT...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 14 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGAGTTCTGACCAGATATaGCAGCTCTGGGGCTCACAC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLSSDQI*QLWGSH
Trigger: GTGTGAGCCCCAGAGCTGGCATATCTGGTCAGAACT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWLQKSG*QNSSVG
Trigger: TCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCTGGGAGTGCAGAGGCTaGCTCTGGCCCAAAACGAGA +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSWECRG*LWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCA...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTGGGAGTGCAGAGGCTaGCTCTGGCCCAAAACGAGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAWECRG*LWPKTR
Trigger: TCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGCTGCCGTTCTCCTCTaGATCCTGCTCCTGCTCTGT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAAAVLL*ILLLLC
Trigger: ACAGAGCAGGAGCAGGATGCAGAGGAGAACGGCAGC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000399408.7
ENST00000621659.2
ENST00000622828.3
CDS-3UTR GCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCGTCCATCACTGTGCTaGCGTTCTCCTCTGCATCCT +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASRPSLC*RSPLHP
Trigger: AGGATGCAGAGGAGAACGGCAGCACAGTGATGGACG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 3 transcripts:
ENST00000399408.7
ENST00000621659.2
ENST00000622828.3
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGCTGACCAGAAACACTaGGGCCAGGAATATGCCCCG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRADQKH*GQEYAP
Trigger: CGGGGCATATTCCTGGCCCCAGTGTTTCTGGTCAGC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGATGCCCAAGAGAGTTaGGCTGACCAGAAACACTGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGDAQES*ADQKHW
Trigger: CCAGTGTTTCTGGTCAGCCCAACTCTCTTGGGCATC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCAGGGATTAGGGTCGTaGATGGTTTCCGAGAACAGG +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLQGLGS*MVSENR
Trigger: CCTGTTCTCGGAAACCATCCACGACCCTAATCCCTG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCAGGGATTAGGGTCGTaGATGGTTTCCGAGAACAGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGQGLGS*MVSENR
Trigger: CCTGTTCTCGGAAACCATCCACGACCCTAATCCCTG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGAACTCTCTTTCGGCTaGGCAGGATCCTTGGAGGAG +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASELSFG*AGSLEE
Trigger: CTCCTCCAAGGATCCTGCCCAGCCGAAAGAGAGTTC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCATTCGCATCCACCTTaGAACTCTCTTTCGGCTGGG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGHSHPP*NSLSAG
Trigger: CCCAGCCGAAAGAGAGTTCCAAGGTGGATGCGAATG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCATTCGCATCCACCTTaGAACTCTCTTTCGGCTGGG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDHSHPP*NSLSAG
Trigger: CCCAGCCGAAAGAGAGTTCCAAGGTGGATGCGAATG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCAGATGTGGAAGTACTaGTGCAGCACGAGGGTCTGC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASQMWKY*CSTRVC
Trigger: GCAGACCCTCGTGCTGCACCAGTACTTCCACATCTG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGGTAAATGTCAGCGTTaGAGTACACGGCCCGGGCCA +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPGKCQR*STRPGP
Trigger: TGGCCCGGGCCGTGTACTCCAACGCTGACATTTACC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGCTCCTGCTCTGTGCTaGCATAGGTACGCAGGAACT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWAPALC*HRYAGT
Trigger: AGTTCCTGCGTACCTATGCCAGCACAGAGCAGGAGC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPARPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCGGCCAGCCACCTGTTaGCCACGATGCTGGGGTAAT +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGRPATC*PRCWGN
Trigger: ATTACCCCAGCATCGTGGCCAACAGGTGGCTGGCCG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGAGTACTGGCTGAATaGGTCCAGGTTCATTCGGAG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRVLAE*VQVHSE
Trigger: CTCCGAATGAACCTGGACCCATTCAGCCAGTACTCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCGAGTACTGGCTGAATaGGTCCAGGTTCATTCGGAG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDRVLAE*VQVHSE
Trigger: CTCCGAATGAACCTGGACCCATTCAGCCAGTACTCG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAGCTAGGCACACAAGCTaGCGCTGCCCGACACTGAGG +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPARHTS*RCPTLR
Trigger: CCTCAGTGTCGGGCAGCGCCAGCTTGTGTGCCTAGC...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAGCTAGGCACACAAGCTaGCGCTGCCCGACACTGAGG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGARHTS*RCPTLR
Trigger: CCTCAGTGTCGGGCAGCGCCAGCTTGTGTGCCTAGC...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGTCCACGGCTGCCGTaGCCTCATCCAACACAAGGA +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGGPRLP*PHPTQG
Trigger: TCCTTGTGTTGGATGAGGCCACGGCAGCCGTGGACC...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGTCCGGATGGTGGACTaGATGAGGTCGTCCGTTTCC +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAVRMVD*MRSSVS
Trigger: GGAAACGGACGACCTCATCCAGTCCACCATCCGGAC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGAT +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLLQEVR*GAVLLD
Trigger: ATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAG...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTCAGATATGCCAGCTCTaGGGCTCACACCAAGCCGGC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAQICQL*GSHQAG
Trigger: GCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTG...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACAGGGTGTGCGTGTTTTaGGTGGTTCGCATCTCTGTC +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDRVCVF*VVRISV
Trigger: GACAGAGATGCGAACCACCCAAAACACGCACACCCT...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AAGATGCCACATCCTGACCCTGCAGAGGACATGGCTGGAACCCTCGCCGAGGCCAGGGTGTGCGTGTTTTaGGTGGTTCGCATCTCTGTC +
Preference number: 4 (lower is better)
Translates to: KMPHPDPAEDMAGTLAEARVCVF*VVRISV
Trigger: GACAGAGATGCGAACCACCCAAAACACGCACACCCT...GGCCTCGGCGAGGGTTCCAGCCATGTCCTCTGCAGGGTCAGGATGTGGCATCTT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGAACCACTTGCATTCCTaGGGGCGTGAGGCTGTGTGT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWNHLHS*GREAVC
Trigger: ACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTT...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGDHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGTGCAGAGGCTGCCTCTaGCCCAAAACGAGAACTGGT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWCRGCL*PKTRTG
Trigger: ACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCA...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTGCAGAGGCTGCCTCTaGCCCAAAACGAGAACTGGT +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELCRGCL*PKTRTG
Trigger: ACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGAGGGAAGCCCCAGGTaGAACGTCGGCCCTGAGACA +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLEGSPR*NVGPET
Trigger: TGTCTCAGGGCCGACGTTCCACCTGGGGCTTCCCTC...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 4 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGTGATCTCTACAACTTGCCCTTTCTGGCAACAGCTCCCACTAGAGGCGACTTGTGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 4 (lower is better)
Translates to: SDLYNLPFLATAPTRGDLWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...CAAGTCGCCTCTAGTGGGAGCTGTTGCCAGAAAGGGCAAGTTGTAGAGATCACT
59% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
59% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCCTCGAAGGCTCGAATGACGCTGACCCCCAGCAAGGTCTCGTTGAAATGGGAAGGGCAGCCTCAGCTCTaGCTGCCTTCCGGATTCCAC +
Preference number: 4 (lower is better)
Translates to: SSKARMTLTPSKVSLKWEGQPQL*LPSGFH
Trigger: GTGGAATCCGGAAGGCAGCCAGAGCTGAGGCTGCCC...TTCCCATTTCAACGAGACCTTGCTGGGGGTCAGCGTCATTCGAGCCTTCGAGGA
59% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTAGCAAGTCTGAGTCTTaGGGCAGCCTCAGCTCTGGC +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRSKSES*GSLSSG
Trigger: GCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
59% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGCGGTGCTGTTGTGGTGCCTGCTGATGTCCCCACTATAGGAGGAGGAGCTGCTAGCAAGTCTGAGTCTTaGGGCAGCCTCAGCTCTGGC +
Preference number: 4 (lower is better)
Translates to: CGAVVVPADVPTIGGGAASKSES*GSLSSG
Trigger: GCCAGAGCTGAGGCTGCCCCAAGACTCAGACTTGCT...AGCAGCTCCTCCTCCTATAGTGGGGACATCAGCAGGCACCACAACAGCACCGCA
59% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCATGCTGGTATTCCACGTaGCATTCCAGTCCCAGAGCG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPCWYST*HSSPRA
Trigger: CGCTCTGGGACTGGAATGTCACGTGGAATACCAGCA...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTCCAAGAGAGTTGGGCTaGCCAGAAACACTGGGGCCA +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAPRELG*PETLGP
Trigger: TGGCCCCAGTGTTTCTGGTCAGCCCAACTCTCTTGG...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTTCTGGCTGAATTGGTaGTCACCAGGGCCTTCCGAT +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELFWLNW*SPGPSD
Trigger: ATCGGAAGGCCCTGGTGATCACCAATTCAGCCAGAA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGGAGGATTTTCTGGCTaGATTGGTGATCACCAGGGC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASGGFSG*IGDHQG
Trigger: GCCCTGGTGATCACCAATTCAGCCAGAAAATCCTCC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGGAGGATTTTCTGGCTaGATTGGTGATCACCAGGGC +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWGGFSG*IGDHQG
Trigger: GCCCTGGTGATCACCAATTCAGCCAGAAAATCCTCC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGAAGGTGCCCACGGCTaGCAGGTAGGCAGACTTCTT +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGEGAHG*QVGRLL
Trigger: AAGAAGTCTGCCTACCTGTCAGCCGTGGGCACCTTC...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCGCGTGCAGACCCAGGTaGAGGTGCCCACGGCTGACA +
Preference number: 4 (lower is better)
Translates to: WFPAFECLEDQMLVRGPSACRPR*RCPRLT
Trigger: TGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGC...GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGTGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: LEVMGARSISKTCSPQTSCPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGTGGCATTCCTCACGGTaGTGCTGTTCGTGCCCCCGC +
Preference number: 4 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPWHSSR*CCSCPR
Trigger: GCGGGGGCACGAACAGCATCACCGTGAGGAATGCCA...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGTGGCATTCCTCACGGTaGTGCTGTTCGTGCCCCCGC +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLWHSSR*CCSCPR
Trigger: GCGGGGGCACGAACAGCATCACCGTGAGGAATGCCA...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTCGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVRSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCACGGAGAGAATCATTCTaGATCCAGGCCTGCTGTGGC +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPRRESF*IQACCG
Trigger: GCCACAGCAGGCCTGGATTCAGAATGATTCTCTCCG...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000621144.4
ENST00000622828.3
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGATGGGCATCCACTGCTaGGAGGGGATCATCGAAGAG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAMGIHC*EGIIEE
Trigger: CTCTTCGATGATCCCCTCTCAGCAGTGGATGCCCAT...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGAGCTCATGCTGTGCGTaGCCAAGATCCGCGTCTTGT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWASSCCA*PRSASC
Trigger: ACAAGACGCGGATCTTGGTCACGCACAGCATGAGCT...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTGTTGTGGTGCCTGCTaGTGTCCCCACTATAGGAGG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWACCGAC*CPHYRR
Trigger: CCTCCTATAGTGGGGACATCAGCAGGCACCACAACA...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTTGTTGTGGTGCCTGCTaGTGTCCCCACTATAGGAGG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRCCGAC*CPHYRR
Trigger: CCTCCTATAGTGGGGACATCAGCAGGCACCACAACA...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGCATCAGTCCAGAGGCTaGGCCAATAGTTGGAAGCCA +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELHQSRG*ANSWKP
Trigger: TGGCTTCCAACTATTGGCTCAGCCTCTGGACTGATG...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCATCAGTCCAGAGGCTaGGCCAATAGTTGGAAGCCA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWHQSRG*ANSWKP
Trigger: TGGCTTCCAACTATTGGCTCAGCCTCTGGACTGATG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAAAAGAAGCTCATGGGTaGCCGCAGGATGCTGTGCAG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPKEAHG*PQDAVQ
Trigger: CTGCACAGCATCCTGCGGTCACCCATGAGCTTCTTT...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTAAAGAAGCTCATGGGTaGCCGCAGGATGCTGTGCAG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRKEAHG*PQDAVQ
Trigger: CTGCACAGCATCCTGCGGTCACCCATGAGCTTCTTT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: LEVMGARSISKTCSPQTSRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGTCACTCTGGTGGATaGAGCGCTCCTGCTCCTCGA +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLGHSGG*SAPAPR
Trigger: TCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACC...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAGGTCACTCTGGTGGATaGAGCGCTCCTGCTCCTCGA +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPGHSGG*SAPAPR
Trigger: TCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACC...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTTCTCTGAATACTCCTTaGGCCTCTCCACGGCCACGA +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRSLNTP*ASPRPR
Trigger: TCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGA...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCTCCTTCTCAGTCTCTaGATACTCCTTGAGCCTCTC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGLLLSL*ILLEPL
Trigger: GAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTCTTCGGCAGACTCGTTaGTCCGAAATAAGCCCAGGG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRLRQTR*SEISPG
Trigger: CCCTGGGCTTATTTCGGATCAACGAGTCTGCCGAAG...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCATCCGAGTACTGGCTaGATGGGTCCAGGTTCATTC +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWHPSTG*MGPGSF
Trigger: GAATGAACCTGGACCCATTCAGCCAGTACTCGGATG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTGTCAGGAAGGGCTaGCACGAAGTCCTTCAGGTG +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSLVRKG*HEVLQV
Trigger: CACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTTGTCAGGAAGGGCTaGCACGAAGTCCTTCAGGTG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWALVRKG*HEVLQV
Trigger: CACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGCGGTGCTGTTGTGGTGCCTGCTGATGTCCCCACTATAGGAGGAGGAGCTGCTCTTGTCAGGAAGGGCTaGCACGAAGTCCTTCAGGTG +
Preference number: 4 (lower is better)
Translates to: CGAVVVPADVPTIGGGAALVRKG*HEVLQV
Trigger: CACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAG...AGCAGCTCCTCCTCCTATAGTGGGGACATCAGCAGGCACCACAACAGCACCGCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCATTCTCCTCTGCATCCTaGTCCTGCTCTGTGCTGGCA +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPFSSAS*SCSVLA
Trigger: TGCCAGCACAGAGCAGGAGCAGGATGCAGAGGAGAA...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGACCCCGTTCTCCTCTaGATCCTGCTCCTGCTCTGT +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGDPVLL*ILLLLC
Trigger: ACAGAGCAGGAGCAGGATGCAGAGGAGAACGGGGTC...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 5 transcripts:
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTGACACGAAGTCCTTCAGGTGGGCCAGCTCCAGGGACGTCCAGACTTCTTCATGACCCCGTTCTCCTCTaGATCCTGCTCCTGCTCTGT +
Preference number: 4 (lower is better)
Translates to: LTRSPSGGPAPGTSRLLHDPVLL*ILLLLC
Trigger: ACAGAGCAGGAGCAGGATGCAGAGGAGAACGGGGTC...ATGAAGAAGTCTGGACGTCCCTGGAGCTGGCCCACCTGAAGGACTTCGTGTCAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGAGCTGTCTCTGCAGTTaGTTCCCTGCACTGTCCGTC +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWASCLCS*FPALSV
Trigger: GACGGACAGTGCAGGGAAGCAACTGCAGAGACAGCT...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTACGGAAAGCTTGACCTaGCCTGTCTGCGCCTTGTCA +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRTESLT*PVCALS
Trigger: TGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGACGGAAAGCTTGACCTaGCCTGTCTGCGCCTTGTCA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWATESLT*PVCALS
Trigger: TGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGT...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTCTAGCTTGTCAGGAAGGGCTGACACGAAGTCCTTCAGGTGGGCCAGCTCCACGGAAAGCTTGACCTaGCCTGTCTGCGCCTTGTCA +
Preference number: 4 (lower is better)
Translates to: WSSLSGRADTKSFRWASSTESLT*PVCALS
Trigger: TGACAAGGCGCAGACAGGGCAGGTCAAGCTTTCCGT...GGAGCTGGCCCACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAGCTAGACCA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp GTCACTCTGGTGGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATGACGCTGACCGATCCCTTGTGAAATaGCCAGGGCTCCATAGACGC +
Preference number: 4 (lower is better)
Translates to: VTLVDEALLLLEGSNDADRSLVK*PGLHRR
Trigger: GCGTCTATGGAGCCCTGGGCATTTCACAAGGGATCG...GTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGACCTGTTGGCCACGATaGTGGGGTAATAGGCCTTCT +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWTCWPR*WGNRPS
Trigger: AGAAGGCCTATTACCCCAGCATCGTGGCCAACAGGT...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAACAGAACGATGCAGTTaGCCACACACTCCAGCCGCA +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPTERCS*PHTPAA
Trigger: TGCGGCTGGAGTGTGTGGGCAACTGCATCGTTCTGT...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCCAGCACTGAGGCTGTaGCTGGAGATCACCGCAAAC +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGPALRL*LEITAN
Trigger: GTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCTTGAAGCGGAGGTCGTaGAGGCCGATCTTGGCGATG +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGLKRRS*RPILAM
Trigger: CATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAA...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCAAAAGACCTCTCTGCTaGAGGAGGTCCGATGGGGCG +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGKRPLC*RRSDGA
Trigger: CGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTT...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCGGCGTCTTTGGCCATaGTGTAGAAAAGACCTCTCT +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLRRLWP*CRKDLS
Trigger: AGAGAGGTCTTTTCTACAGCATGGCCAAAGACGCCG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGGCGTCTTTGGCCATaGTGTAGAAAAGACCTCTCT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRRLWP*CRKDLS
Trigger: AGAGAGGTCTTTTCTACAGCATGGCCAAAGACGCCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCCGGATGGCGGTGGCTaGTGCTTTGAATATGTTTTG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGPDGGG*CFEYVL
Trigger: CAAAACATATTCAAAGCAGCAGCCACCGCCATCCGG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTCCAGAAGTCTGGCTaGCAAAACTCCTCCGTGGGA +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWALQKSG*QNSSVG
Trigger: TCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGCTGGCGCTGAGATaGTGGTTCCCAGCTTTTGAG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRELALR*WFPAFE
Trigger: CTCAAAAGCTGGGAACCAGCATCTCAGCGCCAGCTC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTG +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRSLSSG*LPDSTL
Trigger: CAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCT...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCAGCCTCAGCTCTGGCTaGCTTCCGGATTCCACTTTG +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSSLSSG*LPDSTL
Trigger: CAAAGTGGAATCCGGAAGGCAGCCAGAGCTGAGGCT...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCGTCCATCACTGTGCTaGCGTTCTCCTCTGCATCCT +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWARPSLC*RSPLHP
Trigger: AGGATGCAGAGGAGAACGGCAGCACAGTGATGGACG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 3 transcripts:
ENST00000399408.7
ENST00000621659.2
ENST00000622828.3
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTTTTGGATCTCAGGATaGCTAGGGCACACACTAGGG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDFWISG*LGHTLG
Trigger: CCCTAGTGTGTGCCCTAGCCATCCTGAGATCCAAAA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAGGAAGCGCTGGACTCTaGGCAGGGATTAGGGTCGTG +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPGSAGL*AGIRVV
Trigger: CACGACCCTAATCCCTGCCCAGAGTCCAGCGCTTCC...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGAACTCTCTTTCGGCTaGGCAGGATCCTTGGAGGAG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAELSFG*AGSLEE
Trigger: CTCCTCCAAGGATCCTGCCCAGCCGAAAGAGAGTTC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGCATTCGCATCCACCTTaGAACTCTCTTTCGGCTGGG +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELHSHPP*NSLSAG
Trigger: CCCAGCCGAAAGAGAGTTCCAAGGTGGATGCGAATG...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCATTCGCATCCACCTTaGAACTCTCTTTCGGCTGGG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWHSHPP*NSLSAG
Trigger: CCCAGCCGAAAGAGAGTTCCAAGGTGGATGCGAATG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCGTTCCACTCCTTCTGTaGGGACTTGACGATCAAAGC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGVPLLL*GLDDQS
Trigger: GCTTTGATCGTCAAGTCCCCACAGAAGGAGTGGAAC...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGTAGCCCTGCCAGTCTaGGGCCTTCGTGTCATTCAC +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGVALPV*GLRVIH
Trigger: GTGAATGACACGAAGGCCCCAGACTGGCAGGGCTAC...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCAGATGTGGAAGTACTaGTGCAGCACGAGGGTCTGC +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAQMWKY*CSTRVC
Trigger: GCAGACCCTCGTGCTGCACCAGTACTTCCACATCTG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GTCACTCTGGTGGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATGACGCTGACCAGATGTGGAAGTACTaGTGCAGCACGAGGGTCTGC +
Preference number: 4 (lower is better)
Translates to: VTLVDEALLLLEGSNDADQMWKY*CSTRVC
Trigger: GCAGACCCTCGTGCTGCACCAGTACTTCCACATCTG...GTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGAC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGCTGACGAAGCAGATGTaGAAGTACTGGTGCAGCACG +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWLTKQM*KYWCST
Trigger: CGTGCTGCACCAGTACTTCCACATCTGCTTCGTCAG...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCAATCTCCCCGACCGTaGAGGATTTTCTGGCTGAAT +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGQSPRP*RIFWLN
Trigger: ATTCAGCCAGAAAATCCTCCACGGTCGGGGAGATTG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAATCTCCCCGACCGTaGAGGATTTTCTGGCTGAAT +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDQSPRP*RIFWLN
Trigger: ATTCAGCCAGAAAATCCTCCACGGTCGGGGAGATTG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCCACCTGATACGTCTTaGTCTTCATCGCCATCACAG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGPPDTS*SSSPSQ
Trigger: CTGTGATGGCGATGAAGACCAAGACGTATCAGGTGG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCGGTTCCAGCTCCTCATaGGAGAGAAAGATCCTCAGG +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASGSSSS*ERKILR
Trigger: CCTGAGGATCTTTCTCTCCCATGAGGAGCTGGAACC...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGCACGGACCTGTAATATaGTTCCTCCAGCTGACATCC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLHGPVI*FLQLTS
Trigger: GGATGTCAGCTGGAGGAACCATATTACAGGTCCGTG...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 5 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000621144.4
ENST00000622828.3
ENST00000678422.1
CDS-3UTR CCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCGCTCCTGCTCTGTGCTaGCATAGGTACGCAGGAACT +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSAPALC*HRYAGT
Trigger: AGTTCCTGCGTACCTATGCCAGCACAGAGCAGGAGC...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTTCTGCGGTGCTGTTGTaGTGCCTGCTGATGTCCCCA +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPASAVLL*CLLMSP
Trigger: TGGGGACATCAGCAGGCACCACAACAGCACCGCAGA...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACGCCAGCGCGGACACATaGTTACACATGAAAAGGAAG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDASADT*LHMKRK
Trigger: CTTCCTTTTCATGTGTAACCATGTGTCCGCGCTGGC...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCGATGGACACGGCCATaGAGTAGCCAAACACGGCGA +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGRWTRP*SSQTRR
Trigger: TCGCCGTGTTTGGCTACTCCATGGCCGTGTCCATCG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGCGGTGCTGTTGTGGTGCCTGCTGATGTCCCCACTATAGGAGGAGGAGCTGCTACCTTCAGGTCACTCTaGTGGATGAAGCGCTCCTGC +
Preference number: 4 (lower is better)
Translates to: CGAVVVPADVPTIGGGAATFRSL*WMKRSC
Trigger: GCAGGAGCGCTTCATCCACCAGAGTGACCTGAAGGT...AGCAGCTCCTCCTCCTATAGTGGGGACATCAGCAGGCACCACAACAGCACCGCA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp CACAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGGGCGGAGCTGTCTCCTaGATTTGCCAGGGCGCCTCC +
Preference number: 4 (lower is better)
Translates to: HRDQHGFKHRASFSLFPGGGAVS*ICQGAS
Trigger: GGAGGCGCCCTGGCAAATCCAGGAGACAGCTCCGCC...CCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTGTG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGCCTGGGGCCAGCTGCTaGGCGGAGCTGTCTCCTGGA +
Preference number: 4 (lower is better)
Translates to: LEVMGARSISKTCSPQTSPGASC*AELSPG
Trigger: TCCAGGAGACAGCTCCGCCCAGCAGCTGGCCCCAGG...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTCTTCATCCGAGTACTaGCTGAATGGGTCCAGGTTC +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLSSSEY*LNGSRF
Trigger: GAACCTGGACCCATTCAGCCAGTACTCGGATGAAGA...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
58% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GGCGGGATGATGATGGCGGCGATGGGCGTGGCCAGCAGGATAACGATGCAGGCACCTTCTGCACATTCATaGTCTAGCTTGTCAGGAAGG +
Preference number: 4 (lower is better)
Translates to: GGMMMAAMGVASRITMQAPSAHS*SSLSGR
Trigger: CCTTCCTGACAAGCTAGACCATGAATGTGCAGAAGG...TGCCTGCATCGTTATCCTGCTGGCCACGCCCATCGCCGCCATCATCATCCCGCC
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGATGGTGTTGAGCCGGTaGGCGATGGTGAGGACGGTG +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLMVLSR*AMVRTV
Trigger: CACCGTCCTCACCATCGCCCACCGGCTCAACACCAT...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAATGGTGTTGAGCCGGTaGGCGATGGTGAGGACGGTG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGMVLSR*AMVRTV
Trigger: CACCGTCCTCACCATCGCCCACCGGCTCAACACCAT...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR CCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGGGGCGCCGTACTCCTaGATTTCTCCTTTGTCCAAG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPGAPYS*ISPLSK
Trigger: CTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGGGGGCGCCGTACTCCTaGATTTCTCCTTTGTCCAAG +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAGAPYS*ISPLSK
Trigger: CTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCC...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
58% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp GTCACTCTGGTGGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATGACGCTGACGGGGCGCCGTACTCCTaGATTTCTCCTTTGTCCAAG +
Preference number: 4 (lower is better)
Translates to: VTLVDEALLLLEGSNDADGAPYS*ISPLSK
Trigger: CTTGGACAAAGGAGAAATCCAGGAGTACGGCGCCCC...GTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGAC
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR CCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGAT +
Preference number: 4 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPLQEVR*GAVLLD
Trigger: ATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAG...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
58% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTCTGCAGGAGGTCCGATaGGGCGCCGTACTCCTGGAT +
Preference number: 4 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVLQEVR*GAVLLD
Trigger: ATCCAGGAGTACGGCGCCCCATCGGACCTCCTGCAG...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCCCAAGCCGGCGTCTTTaGCCATGCTGTAGAAAAGAC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASPSRRL*PCCRKD
Trigger: GTCTTTTCTACAGCATGGCCAAAGACGCCGGCTTGG...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACAGATATGCCAGCTCTaGGGCTCACACCAAGCCGGC +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPQICQL*GSHQAG
Trigger: GCCGGCTTGGTGTGAGCCCCAGAGCTGGCATATCTG...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGCTCCTCCCTGGGCGCTaGCATATAGGCCCTGCAGTT +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLLLPGR*HIGPAV
Trigger: AACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTGTGCGTGTTTTGGGTaGTTCGCATCTCTGTCTCTC +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGCACFG*FASLSL
Trigger: GAGAGACAGAGATGCGAACCACCCAAAACACGCACA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGAGGGTGTGCGTGTTTTaGGTGGTTCGCATCTCTGTC +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWRVCVF*VVRISV
Trigger: GACAGAGATGCGAACCACCCAAAACACGCACACCCT...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGACCATCCAGGGCCCTaGGACACTGCCAAGGGGAGA +
Preference number: 4 (lower is better)
Translates to: PEASQRLAVHRLRLERSEDHPGP*DTAKGR
Trigger: TCTCCCCTTGGCAGTGTCCCAGGGCCCTGGATGGTC...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTCCTGAGACAATCCCCTaGCCCTACAGTTCCAGGTCC +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPAPETIP*PYSSRS
Trigger: GGACCTGGAACTGTAGGGCCAGGGGATTGTCTCAGG...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGAGGGAAGCCCCAGGTaGAACGTCGGCCCTGAGACA +
Preference number: 4 (lower is better)
Translates to: PEASQRLAVHRLRLERSEEGSPR*NVGPET
Trigger: TGTCTCAGGGCCGACGTTCCACCTGGGGCTTCCCTC...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGGAGGGAAGCCCCAGGTaGAACGTCGGCCCTGAGACA +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLEGSPR*NVGPET
Trigger: TGTCTCAGGGCCGACGTTCCACCTGGGGCTTCCCTC...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
58% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR CCA 90 bp CAGAGACCAACACGGTTTCAAACACAGGGCGAGCTTCTCACTATTTCCTGGGAATGGAGTCGGGGTGGGTaGGGAGGGAAGCCCCAGGTG +
Preference number: 4 (lower is better)
Translates to: QRPTRFQTQGELLTISWEWSRGG*GGKPQV
Trigger: CACCTGGGGCTTCCCTCCCCACCCACCCCGACTCCA...TTCCCAGGAAATAGTGAGAAGCTCGCCCTGTGTTTGAAACCGTGTTGGTCTCTG
58% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTTGCTGGTATTCCACGTaGCATTCCAGTCCCAGAGCG +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPACWYST*HSSPRA
Trigger: CGCTCTGGGACTGGAATGTCACGTGGAATACCAGCA...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAACGAGGACCGTGTTCTaGAAGCACTTGGTGAAGTCG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPTRTVF*KHLVKS
Trigger: CGACTTCACCAAGTGCTTTCAGAACACGGTCCTCGT...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCACGAGGACCGTGTTCTaGAAGCACTTGGTGAAGTCG +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSTRTVF*KHLVKS
Trigger: CGACTTCACCAAGTGCTTTCAGAACACGGTCCTCGT...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGGGGTACTGACTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGGACAAGACGAGCTaGATGAGTAAGAGGGAAAAG +
Preference number: 4 (lower is better)
Translates to: PGVLTPPWALAYRPCSSDQDKTS*MSKREK
Trigger: CTTTTCCCTCTTACTCATTCAGCTCGTCTTGTCCTG...GTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAGTCAGTACCCCTGG
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCATTCTGGCTGAATTGGTaGTCACCAGGGCCTTCCGAT +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPFWLNW*SPGPSD
Trigger: ATCGGAAGGCCCTGGTGATCACCAATTCAGCCAGAA...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCAGGAGGATTTTCTGGCTaGATTGGTGATCACCAGGGC +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPGGFSG*IGDHQG
Trigger: GCCCTGGTGATCACCAATTCAGCCAGAAAATCCTCC...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GTCACTCTGGTGGATGAAGCGCTCCTGCTCCTCGAAGGCTCGAATGACGCTGACGGAGGATTTTCTGGCTaGATTGGTGATCACCAGGGC +
Preference number: 4 (lower is better)
Translates to: VTLVDEALLLLEGSNDADGGFSG*IGDHQG
Trigger: GCCCTGGTGATCACCAATTCAGCCAGAAAATCCTCC...GTCAGCGTCATTCGAGCCTTCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGAC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAACGTGGCCAAGTCCATaGACCTCTGAGCGTCCACAG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGTWPSP*TSERPQ
Trigger: CTGTGGACGCTCAGAGGTTCATGGACTTGGCCACGT...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGTTCATGTGGGCCACCTaGTACGTCTTGGTCTTCATC +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELFMWAT*YVLVFI
Trigger: GATGAAGACCAAGACGTATCAGGTGGCCCACATGAA...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CTCCTCCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTTCATGTGGGCCACCTaGTACGTCTTGGTCTTCATC +
Preference number: 4 (lower is better)
Translates to: LLPGRWHIGPAVLTRYASFMWAT*YVLVFI
Trigger: GATGAAGACCAAGACGTATCAGGTGGCCCACATGAA...GCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGGAGGAG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGTCAGCTCCTCCTGCCTaGTGGCCAGCACCTTGTCCT +
Preference number: 4 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPSAPPA*WPAPCP
Trigger: AGGACAAGGTGCTGGCCATCAGGCAGGAGGAGCTGA...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTAGAGGTGATGGGAGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCGTGCAGACCCAGGTaGAGGTGCCCACGGCTGACA +
Preference number: 4 (lower is better)
Translates to: LEVMGARSISKTCSPQTSACRPR*RCPRLT
Trigger: TGTCAGCCGTGGGCACCTTCACCTGGGTCTGCACGC...CGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCTCCCATCACCTCTAA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCCTGGGCGCTGGCATATAGGCCCTGCAGTTCTGACCAGATATGCCAGCTCTGGGAAACCGGAGGATGTTaGACAAGGCCAAAGACACGA +
Preference number: 4 (lower is better)
Translates to: PWALAYRPCSSDQICQLWETGGC*TRPKTR
Trigger: TCGTGTCTTTGGCCTTGTTCAACATCCTCCGGTTTC...CCAGAGCTGGCATATCTGGTCAGAACTGCAGGGCCTATATGCCAGCGCCCAGGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTATGCCCCCGCCGTCTTTaGCAGGCCGTCGCTCGATGC +
Preference number: 4 (lower is better)
Translates to: AFRIPLWALTRHLKEQALCPRRL*QAVARC
Trigger: GCATCGAGCGACGGCCTGTCAAAGACGGCGGGGGCA...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCTGGCATTCCTCACGGTaGTGCTGTTCGTGCCCCCGC +
Preference number: 4 (lower is better)
Translates to: WFPAFECLEDQMLVRGPSWHSSR*CCSCPR
Trigger: GCGGGGGCACGAACAGCATCACCGTGAGGAATGCCA...GGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGCGCTCCTGGCCCAGGTaGATGTGGCATTCCTCACGG +
Preference number: 4 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRRSWPR*MWHSSR
Trigger: CCGTGAGGAATGCCACATTCACCTGGGCCAGGAGCG...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCGGAGAGAATCATTCTaGATCCAGGCCTGCTGTGGC +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGRRESF*IQACCG
Trigger: GCCACAGCAGGCCTGGATTCAGAATGATTCTCTCCG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTGCTCCTGAGTCCCGTTaGCGATGGGGTCATCAGTCC +
Preference number: 4 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVAPESR*RWGHQS
Trigger: GGACTGATGACCCCATCGTCAACGGGACTCAGGAGC...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 12 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAACTTTCGTGTGCTCCTaGGTCCCGTTGACGATGGGG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGTFVCS*VPLTMG
Trigger: CCCCATCGTCAACGGGACTCAGGAGCACACGAAAGT...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCAAAGAAGCTCATGGGTaGCCGCAGGATGCTGTGCAG +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGKEAHG*PQDAVQ
Trigger: CTGCACAGCATCCTGCGGTCACCCATGAGCTTCTTT...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCTTCCGGATTCCACTTTGGGCTCTAACGAGACACCTTAAAGAACAGGCTTTAAGACCGGGGAGCGGCTaGCCGACTCGAGGCGCTTCA +
Preference number: 4 (lower is better)
Translates to: AFRIPLWALTRHLKEQALRPGSG*PTRGAS
Trigger: TGAAGCGCCTCGAGTCGGTCAGCCGCTCCCCGGTCT...TAAAGCCTGTTCTTTAAGGTGTCTCGTTAGAGCCCAAAGTGGAATCCGGAAGGC
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGGGTCACTCTGGTGGATaGAGCGCTCCTGCTCCTCGA +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLGHSGG*SAPAPR
Trigger: TCGAGGAGCAGGAGCGCTTCATCCACCAGAGTGACC...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGCCACCAAGCCAGCACTaGGGCTGTGCCTGGAGATCA +
Preference number: 4 (lower is better)
Translates to: PEASQRLAVHRLRLERSEPPSQH*GCAWRS
Trigger: TGATCTCCAGGCACAGCCTCAGTGCTGGCTTGGTGG...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTCCACCAAGCCAGCACTaGGGCTGTGCCTGGAGATCA +
Preference number: 4 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVPPSQH*GCAWRS
Trigger: TGATCTCCAGGCACAGCCTCAGTGCTGGCTTGGTGG...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTTCTCTGAATACTCCTTaGGCCTCTCCACGGCCACGA +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPASLNTP*ASPRPR
Trigger: TCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGA...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCTCTCTGAATACTCCTTaGGCCTCTCCACGGCCACGA +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGSLNTP*ASPRPR
Trigger: TCGTGGCCGTGGAGAGGCTCAAGGAGTATTCAGAGA...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp AGGCGTGGGAGTGCAGAGGCTGCCTCTGGCCCAAAACGAGAACTGGTAGAGCTGCTCCTTCTCAGTCTCTaGATACTCCTTGAGCCTCTC +
Preference number: 4 (lower is better)
Translates to: RRGSAEAASGPKRELVELLLLSL*ILLEPL
Trigger: GAGAGGCTCAAGGAGTATTCAGAGACTGAGAAGGAG...CAGCTCTACCAGTTCTCGTTTTGGGCCAGAGGCAGCCTCTGCACTCCCACGCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCATCCGAGTACTGGCTaGATGGGTCCAGGTTCATTC +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSHPSTG*MGPGSF
Trigger: GAATGAACCTGGACCCATTCAGCCAGTACTCGGATG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCATCCGAGTACTGGCTaGATGGGTCCAGGTTCATTC +
Preference number: 4 (lower is better)
Translates to: WFQCGRLGLPGVLTPPWAHPSTG*MGPGSF
Trigger: GAATGAACCTGGACCCATTCAGCCAGTACTCGGATG...CGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCTTGTCAGGAAGGGCTaGCACGAAGTCCTTCAGGTG +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGLVRKG*HEVLQV
Trigger: CACCTGAAGGACTTCGTGTCAGCCCTTCCTGACAAG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAGGATGGTGGACTGGATaGGGTCGTCCGTTTCCAGGT +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGGWWTG*GRPFPG
Trigger: ACCTGGAAACGGACGACCTCATCCAGTCCACCATCC...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR TCA 90 bp TCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGATGGTGGACTGGATaGGGTCGTCCGTTTCCAGGT +
Preference number: 4 (lower is better)
Translates to: SGCQNSSVGSTRKPLAFLGWWTG*GRPFPG
Trigger: ACCTGGAAACGGACGACCTCATCCAGTCCACCATCC...CAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 6 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
CDS-3UTR TCA 90 bp AGTGATCTCTACAACTTGCCCTTTCTGGCAACAGCTCCCACTAGAGGCGACTTGGTTTACCAGGGGTACTaGCTCCTCCCTGGGCGCTGG +
Preference number: 4 (lower is better)
Translates to: SDLYNLPFLATAPTRGDLVYQGY*LLPGRW
Trigger: CCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAAC...CAAGTCGCCTCTAGTGGGAGCTGTTGCCAGAAAGGGCAAGTTGTAGAGATCACT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 2 transcripts:
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCCGGTGGCTGCTGCTTTaGATATGTTTTGGTTGTCTG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGRWLLL*ICFGCL
Trigger: CAGACAACCAAAACATATTCAAAGCAGCAGCCACCG...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTGGTTCCCAGCTTTTaGGTGCCTGGAAGACCAGAT +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSLVPSF*VPGRPD
Trigger: ATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAG...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TGCGGTGCTGTTGTGGTGCCTGCTGATGTCCCCACTATAGGAGGAGGAGCTGCTCTGGTTCCCAGCTTTTaGGTGCCTGGAAGACCAGAT +
Preference number: 4 (lower is better)
Translates to: CGAVVVPADVPTIGGGAALVPSF*VPGRPD
Trigger: ATCTGGTCTTCCAGGCACTCAAAAGCTGGGAACCAG...AGCAGCTCCTCCTCCTATAGTGGGGACATCAGCAGGCACCACAACAGCACCGCA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR TCA 90 bp TTCCCAGCTTTTGAGTGCCTGGAAGACCAGATGTTGGTAAGAGGACCATCCAGGGTGGAACGTCGGCCCTaGGACAATCCCCTGGCCCTA +
Preference number: 4 (lower is better)
Translates to: FPAFECLEDQMLVRGPSRVERRP*DNPLAL
Trigger: TAGGGCCAGGGGATTGTCTCAGGGCCGACGTTCCAC...CCTGGATGGTCCTCTTACCAACATCTGGTCTTCCAGGCACTCAAAAGCTGGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp GCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGATGCTCTCTGGGTTTaGAGTCGGCGGCGTAATTCT +
Preference number: 4 (lower is better)
Translates to: AKTPPWEAPGNHLHSWGRDALWV*SRRRNS
Trigger: AGAATTACGCCGCCGACTTCAAACCCAGAGAGCATC...ACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR TCA 90 bp TCTGGCCCAAAACGAGAACTGGTAGAGCTGGCGCTGAGATGCTGGTTCCCAGCTAGGAGGAGGAGCTGCTaGGCTGTCCATGAGATCTGT +
Preference number: 4 (lower is better)
Translates to: SGPKRELVELALRCWFPARRRSC*AVHEIC
Trigger: ACAGATCTCATGGACAGCTCAGCAGCTCCTCCTCCT...AGCTGGGAACCAGCATCTCAGCGCCAGCTCTACCAGTTCTCGTTTTGGGCCAGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 1 transcripts:
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGCAGGCCGTCGCTCGATaGTGTCAGGTTCCAGCTCCT +
Preference number: 4 (lower is better)
Translates to: PEASQRLAVHRLRLERSEQAVAR*CQVPAP
Trigger: AGGAGCTGGAACCTGACAGCATCGAGCGACGGCCTG...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCCCTTGATAGCCACGTaGCCCTCCACTTTGTCCATC +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGPLIAT*PSTLSI
Trigger: GATGGACAAAGTGGAGGGGCACGTGGCTATCAAGGG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000678422.1
CDS-3UTR GCA 90 bp TCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCGCTGGCTGTCCGTCACCAGCATaGCATTCTCCATTTGCTTTG +
Preference number: 4 (lower is better)
Translates to: SVWEAWFTRGTDSSLGAGCPSPA*HSPFAL
Trigger: CAAAGCAAATGGAGAATGGCATGCTGGTGACGGACA...GCCAGCGCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp GAAACCACTTGCATTCCTGGGGGCGTGAGGCTGTGTGTCTGTCTCAGGGCACCATTGGCCTCAGCTTTCTaGAGTTCTGCGGTGCTGTTG +
Preference number: 4 (lower is better)
Translates to: ETTCIPGGVRLCVCLRAPLASAF*SSAVLL
Trigger: CAACAGCACCGCAGAACTGCAGAAAGCTGAGGCCAA...TGGTGCCCTGAGACAGACACACAGCCTCACGCCCCCAGGAATGCAAGTGGTTTC
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTGGTTTCAGTGTGGGAGGCTTGGTTTACCAGGGGTACTGACTCCTCCCTGGGCCGATCCCTTGTGAAATaGCCAGGGCTCCATAGACGC +
Preference number: 4 (lower is better)
Translates to: LVSVWEAWFTRGTDSSLGRSLVK*PGLHRR
Trigger: GCGTCTATGGAGCCCTGGGCATTTCACAAGGGATCG...GCCCAGGGAGGAGTCAGTACCCCTGGTAAACCAAGCCTCCCACACTGAAACCAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 8 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGTGCAGCAGGTCCACGTaGAGACAGCGGGAAGCCAAG +
Preference number: 4 (lower is better)
Translates to: PEASQRLAVHRLRLERSECSRST*RQREAK
Trigger: CTTGGCTTCCCGCTGTCTGCACGTGGACCTGCTGCA...CTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGG
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AGCCAGAAGCATCTCAAAGACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGGACCGCAGGATGCTGTaGAGCAGGTCCACGTGCAGA +
Preference number: 4 (lower is better)
Translates to: SQKHLKDLQSTDFGWRDPDRRML*SRSTCR
Trigger: TCTGCACGTGGACCTGCTGCACAGCATCCTGCGGTC...CGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGTCTTTGAGATGCTTCTGGCT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ACTTGCAGTCCACAGACTTCGGCTGGAGAGATCCGAGGCAGTAGGCTGAATTTGTGGGTGACCGCAGGATaGTGTGCAGCAGGTCCACGT +
Preference number: 4 (lower is better)
Translates to: TCSPQTSAGEIRGSRLNLWVTAG*CAAGPR
Trigger: ACGTGGACCTGCTGCACAGCATCCTGCGGTCACCCA...CAAATTCAGCCTACTGCCTCGGATCTCTCCAGCCGAAGTCTGTGGACTGCAAGT
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGACCAGCACTGAGGCTGTaGCTGGAGATCACCGCAAAC +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGPALRL*LEITAN
Trigger: GTTTGCGGTGATCTCCAGGCACAGCCTCAGTGCTGG...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAGCTGTCTCCTGGATTTaGCAGGGCGCCTCCTTCTCA +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPAVSWI*QGASFS
Trigger: TGAGAAGGAGGCGCCCTGGCAAATCCAGGAGACAGC...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
57% GC, longest homopolymer 4 nt, total homopolymer stretches 4 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp CTCCTCCGTGGGAAGCACCAGGAAACCACTTGCATTCCTGGGGGCGTGAGGCTGATCGTGACATTGATGTaGCTGAGAACGAAGTCCAGG +
Preference number: 4 (lower is better)
Translates to: LLRGKHQETTCIPGGVRLIVTLM*LRTKSR
Trigger: CCTGGACTTCGTTCTCAGGCACATCAATGTCACGAT...CAGCCTCACGCCCCCAGGAATGCAAGTGGTTTCCTGGTGCTTCCCACGGAGGAG
57% GC, longest homopolymer 5 nt, total homopolymer stretches 5 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGATTGAAGCGGAGGTCGTaGAGGCCGATCTTGGCGATG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGLKRRS*RPILAM
Trigger: CATCGCCAAGATCGGCCTGCACGACCTCCGCTTCAA...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
57% GC, longest homopolymer 3 nt, total homopolymer stretches 0 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp AGGGGACCGGATGGCGGTGGCTGCTGCTTTGAATATGTTTTGGTTGTCTGGGTTCACACAAGCTGGCGCTaGCCGACACTGAGGTTCTCC +
Preference number: 4 (lower is better)
Translates to: RGPDGGGCCFEYVLVVWVHTSWR*PTLRFS
Trigger: GGAGAACCTCAGTGTCGGGCAGCGCCAGCTTGTGTG...AACCCAGACAACCAAAACATATTCAAAGCAGCAGCCACCGCCATCCGGTCCCCT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000621659.2
ENST00000622828.3
ENST00000677164.1
CDS-3UTR GCA 90 bp TTCCTCCAGAAGTCTGGCTGCCAAAACTCCTCCGTGGGAAGCACCAGGAAACCAAAAAGACCTCTCTGCTaGAGGAGGTCCGATGGGGCG +
Preference number: 4 (lower is better)
Translates to: FLQKSGCQNSSVGSTRKPKRPLC*RRSDGA
Trigger: CGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTT...TGGTTTCCTGGTGCTTCCCACGGAGGAGTTTTGGCAGCCAGACTTCTGGAGGAA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 13 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp TACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCCTTCCAGGAGGAAAAAGACCTCTCTGCTaGAGGAGGTCCGATGGGGCG +
Preference number: 4 (lower is better)
Translates to: YSSRSRLAVSPTRSLPGGKRPLC*RRSDGA
Trigger: CGCCCCATCGGACCTCCTGCAGCAGAGAGGTCTTTT...TCCTCCTGGAAGGGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTA
57% GC, longest homopolymer 5 nt, total homopolymer stretches 9 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4
ENST00000622828.3
ENST00000677164.1
ENST00000678422.1
CDS-3UTR GCA 90 bp ATCCCCTGGCCCTACAGTTCCAGGTCCAGGTTAGCCGTTAGTCCAACCAGGTCCAGTTCTGACCAGATATaGCAGCTCTGGGGCTCACAC +
Preference number: 4 (lower is better)
Translates to: IPWPYSSRSRLAVSPTRSSSDQI*QLWGSH
Trigger: GTGTGAGCCCCAGAGCTGGCATATCTGGTCAGAACT...GGACCTGGTTGGACTAACGGCTAACCTGGACCTGGAACTGTAGGGCCAGGGGAT
57% GC, longest homopolymer 4 nt, total homopolymer stretches 8 nt.
Matches the following 7 transcripts:
ENST00000399408.7
ENST00000399410.8
ENST00000572882.3
ENST00000621144.4